Skip to main content
AACR Open Access logoLink to AACR Open Access
. 2024 Dec 13;24(4):511–522. doi: 10.1158/1535-7163.MCT-23-0655

Preclinical Evaluation of Bavdegalutamide (ARV-110), a Novel PROteolysis TArgeting Chimera Androgen Receptor Degrader

Lawrence B Snyder 1, Taavi K Neklesa 2, Ryan R Willard 2, Deborah A Gordon 2, Jennifer Pizzano 2, Nicholas Vitale 2, Kaitlynn Robling 2, Madeline A Dorso 2, Walid Moghrabi 3, Sean Landrette 2, Richard Gedrich 2, Sang Hyun Lee 2, Ian CA Taylor 2,*, John G Houston 3
PMCID: PMC11962395  PMID: 39670468

Abstract

Androgen receptor (AR) signaling is the principal driver of prostate cancer, and drugs that target this pathway (e.g., abiraterone and enzalutamide) are standard treatments for metastatic hormone-sensitive prostate cancer and metastatic castration-resistant prostate cancer. However, continual evolution during prostate cancer progression can result in AR alterations (e.g., mutation, amplification, and splicing) that can cause tumors to become resistant to these therapies. Bavdegalutamide (ARV-110) is a PROteolysis TArgeting Chimera (PROTAC) protein degrader that recruits the cereblon-containing E3 ubiquitin ligase to direct the polyubiquitination and subsequent proteasomal degradation of AR. Bavdegalutamide selectively degrades wild-type AR and most clinically relevant mutants with low nanomolar potency. The advantages of the degradation mechanism of action are demonstrated by the higher activity of bavdegalutamide relative to the AR antagonist enzalutamide in cell-based systems that assess effects on PSA synthesis, proliferation of prostate cancer cells, and induction of apoptosis. In an AR-expressing patient-derived xenograft mouse model, bavdegalutamide showed substantial AR degradation and greater tumor growth inhibition compared with enzalutamide. Bavdegalutamide also showed robust tumor growth inhibition in enzalutamide- and abiraterone-resistant prostate cancer animal models and enhanced activity in combination with abiraterone. These promising preclinical data supported the clinical development of bavdegalutamide as a potential treatment for patients with prostate cancer. Bavdegalutamide was the first PROTAC protein degrader to enter human clinical trials, specifically in patients with metastatic castration-resistant prostate cancer in a phase I/II study (NCT03888612).

Watch the interview with Jennifer Pizzano, LATg, recipient of the 2026 Molecular Cancer Therapeutics Award for Outstanding Journal Article: https://vimeo.com/1208910913

Graphical Abstract

graphic file with name mct-23-0655_ga.jpg

Introduction

Prostate cancer is the most frequently diagnosed malignancy in men in the United States, with an estimated 288,300 new cases and 34,700 projected deaths in 2023 (1). Androgen receptor (AR) signaling is a key driver of prostate cancer, including disease transition from a localized to metastatic state, and aberrations in the AR gene have been reported in 60% to 85% of patients (26). AR pathway inhibitors (ARPI) that disrupt the AR pathway by decreasing androgen levels (e.g., abiraterone) or by blocking androgen binding to AR (e.g., enzalutamide) have become standard treatments for patients with prostate cancer (7). However, these therapies offer limited clinical benefit; up to 25% of patients with metastatic castration-resistant prostate cancer (mCRPC) do not respond to either abiraterone or enzalutamide, and most responsive patients develop resistance to these agents within 6 to 15 months (810). The most commonly observed AR mutations in patients with advanced prostate cancer occur in the ligand-binding domain (LBD). The prevalence of AR LBD mutations in patients with mCRPC is 15% following treatment with first-generation ARPIs and increases to up to 24% following treatment with second-generation ARPIs, with the most prevalent mutations being L702H (∼12%), T878A (∼7%), and H875Y (∼5%; ref. 11). Importantly, this class of mutations has been associated with resistance to abiraterone (2, 12) and/or enzalutamide (1315). Treatments with different mechanisms of action (MOA; e.g., PARP inhibitors, pembrolizumab, sipuleucel-T, and lutetium-177–labeled prostate-specific membrane antigen-617) are beneficial for specific patient populations with mCRPC (7), but new therapeutic strategies are still needed.

PROteolysis TArgeting Chimera (PROTAC) protein degraders represent a novel potential therapeutic approach to eliminate proteins involved in the pathogenesis of a variety of diseases by usurping a natural, intracellular protein disposal machinery, the ubiquitin–proteasome system (UPS; ref. 16). In the UPS, proteins that have been polyubiquitinated by the concerted activity of a ubiquitin-activating enzyme (E1), a ubiquitin-conjugating enzyme (E2), and a ubiquitin ligase (E3) are recognized and degraded to small peptides by the 26S proteasome, a multiprotein protease complex. PROTAC protein degraders are heterobifunctional small molecules comprising two domains—one that binds a target protein and another that engages an E3 ubiquitin ligase—joined by a linker. Simultaneous binding of the target and E3 ligase by the PROTAC results in the formation of a trimer complex, which enables ubiquitination of the target protein by the E3 ubiquitin ligase, leading to degradation of the target protein by the proteasome. Furthermore, PROTAC small molecules have been shown to function iteratively or “catalytically,” in that they induce the ubiquitination of super-stoichiometric quantities of proteins and thus are not limited by equilibrium occupancy (17). PROTAC technology has been validated in cell culture studies and animal models, and multiple PROTAC protein degraders are now being investigated in clinical studies (18, 19).

Bavdegalutamide (ARV-110) is a PROTAC protein degrader designed to target AR for ubiquitination and degradation through recruitment of the E3 ubiquitin ligase substrate adapter cereblon (Fig. 1A). The structure and function of AR are well established: AR is a large (110 kDa) protein that consists of an N-terminal domain, a DNA-binding domain, a hinge region, and an LBD; upon androgen binding, AR is dissociated from heat shock proteins (HSPs) in the cytoplasm and translocated to the nucleus as a dimer, where it induces transcription of androgen-responsive genes, producing factors that spur prostate cancer growth and survival (20, 21). Several approved ARPIs, e.g., enzalutamide, apalutamide, and darolutamide, function as antagonists by binding to the AR LBD (21), supporting direct AR blockade as an effective approach for the treatment of prostate cancer. Here, we report data from preclinical studies of bavdegalutamide, assessing if the PROTAC MOA may offer advantages over small-molecule inhibitors.

Figure 1.

Figure 1.

Bavdegalutamide degrades AR via the ubiquitin–proteasome pathway. A, Bavdegalutamide structure and MOA. B, Binding affinity of bavdegalutamide vs. enzalutamide for AR. The data shown are representative of two independent experiments; mean and SEM are plotted. C, Dose-dependent degradation of AR by bavdegalutamide in VCaP and LNCaP cells at 24 hours (representative of two independent experiments). D, Time course of AR degradation with 10 nmol/L bavdegalutamide in VCaP cells. E, Polyubiquitination of AR with 10 nmol/L bavdegalutamide. F, E3 ligase–dependent and proteasome-dependent degradation of AR by bavdegalutamide. FL, full length; hMito, human mitochondria; Ub, ubiquitin.

Materials and Methods

Compounds

Bavdegalutamide (N-[(1r,4r)-4-(3-chloro-4-cyanophenoxy)cyclohexyl]-6-[4-({4-[2-(2,6- dioxopiperidin-3-yl)-6-fluoro-1,3-dioxo-2,3-dihydro-1H-isoindol-5-yl]piperazin-1-yl}methyl)piperidin-1-yl]pyridazine-3-carboxamide) and pomalidomide were synthesized at Arvinas Operations, Inc. For additional details on the structure and route of synthesis of bavdegalutamide, please refer to US Patent 10584101, Compound 406, and US Patent 12043612, Scheme 3 (22, 23). Abiraterone acetate was synthesized at Sunnylife Pharma. Enzalutamide (Selleckchem, Cat. #S1250), the synthetic androgen R1881 (Sigma, Cat. #R0908), and carfilzomib (Selleckchem, Cat. #S2853) were purchased.

Cell lines

Vertebral cancer of the prostate (VCaP; Cat. #CRL-2876), lymph node carcinoma of the prostate (LNCaP; Cat. #CRL-1740), HEK293 (Cat. #CRL-1573), MDA PCa 2B (Cat. #CRL-2422), SK-N-DZ (Cat. #CRL-2149), Ramos (RA 1; Cat. #CRL-1596), and MCF-7 (Cat. #HTB-22) cells were purchased from ATCC. T-REx-293 cells were purchased from Thermo Fisher Scientific (Cat. #R71007). These cell lines were authenticated using short tandem repeat DNA profiling by the vendors and confirmed approximately every 18 months using the ATCC Cell Line Authentication Service (Cat. #135-XV). VCaP, SK-N-DZ, AR-expressing T-REx-293, and HEK293 cells were cultured under standard conditions (at 37°C, 5% CO2, and 95% humidity) in DMEM (ATCC, Cat. #30-2002) supplemented with 10% FBS (Thermo Fisher Scientific, Cat. #26140095) and 1% penicillin–streptomycin [T-REx-293 additionally supplemented with 5 μg/mL blasticidin (InvivoGen, Cat. #ant-bl-1)]. LNCaP and Ramos cells were cultured in RPMI-1640 medium with 10% FBS and 1% penicillin–streptomycin. MDA PCa 2B cells were cultured in HPC-1 media (Athena, Cat. #ES 0403) with 20% FBS and 1% penicillin–streptomycin in plates coated with FNC Coating Mix (Athena, Cat. #ES 0407H). MCF-7 cells were cultured in DMEM: F-12 (ATCC, Cat. #30-2006) with 10% FBS (at 37°C, 5% CO2, and 95% humidity).

To generate AR-expressing T-REx-293 cells, cDNAs encoding wild-type (WT) AR or clinically relevant mutants were cloned into the pcDNA/4TO vector (Thermo Fisher Scientific, Cat. #V102020). The plasmids were transfected into T-REx-293 cells, and stable pools were selected using 200 μg/mL Zeocin (Thermo Fisher Scientific, Cat. #R25001) in addition to 5 μg/mL blasticidin for continued selection for the Tet repressor.

All cell lines were tested monthly for Mycoplasma using Lonza MycoAlert Mycoplasma Detection Kit (LT07-318) with the Lonza MycoAlert assay control set (LT07-518) and were used within 25 passages.

Western blotting

Assays were performed as previously described (24). Briefly, cells were lysed in RIPA buffer [50 mmol/L Tris (pH 7.5), 150 mmol/L NaCl, 1% NP-40, 0.5% sodium deoxycholate, and 0.1% SDS] supplemented with protease (Roche, Cat. #11697498001) and phosphatase inhibitors (10 mmol/L sodium fluoride, 10 mmol/L β-glycerophosphate, 2 mmol/L sodium orthovanadate, and 10 mmol/L sodium pyrophosphate). Lysates were centrifuged at 15,000 rpm, and the supernatants [5 μg for all cell lines other than VCaP (2 μg because of its AR-amplified status)] were analyzed by SDS-PAGE. Western blotting was performed by transferring samples onto a nitrocellulose membrane, incubating in 5% milk in TBS with Tween 20 at room temperature for 1 hour, and probing with the indicated antibody overnight at 4°C. The membranes were visualized using the ECL Prime Western blotting detection reagent (GE Healthcare, Cat. #RPN2232). The antibodies used include AR antibody clone D6F11 (Cell Signaling Technology, Cat. #5153), GAPDH antibody clone 14C10 (Cell Signaling Technology, Cat. #2118), glucocorticoid receptor (GR) antibody clone D8H2 (Cell Signaling Technology, Cat. #3660), ERG antibody clone EPR3864 (Abcam, Cat. #ab92513), eRF3 (G1–S phase transition 1 protein; Cell Signaling Technology, Cat. #14980), Ikaros (IKZF1; Cell Signaling Technology, Cat. #14859), Aiolos (IKZF3; Cell Signaling Technology, Cat. #15103), spalt-like transcription factor 4 (Sall4; Cell Signaling Technology, Cat. #5850), AR splice variant 7–specific antibody clone RM7 (RevMAb Biosciences, Cat. #31-1109-00), casein kinase 1α (CK1α; Abcam, Cat. #ab206652), and anti-mitochondria (Abcam, Cat. #ab92824; as a loading control).

AR binding assay

Agonist radioligand–receptor binding assays were performed using LNCaP cell lysates. Experiments were performed by Eurofins Pharma Discovery Services in France according to the previously published AR assay protocol (25).

AR degradation assays

LNCaP, VCaP, MDA PCa 2B, and T-REx-293 cells expressing WT AR or clinically relevant mutants and MCF-7 cells expressing AR and the GR were seeded in phenol red–free media with 5% charcoal-stripped FBS (Omega, Cat. #FB-04) and 1% penicillin–streptomycin (Thermo Fisher Scientific, Cat. #15070063) and incubated for 72 hours before treating with bavdegalutamide at the indicated concentrations for 24 hours. AR levels were determined by western blotting or AR ELISA (Cell Signaling Technology, Cat. #12850).

The 22Rv1 CRBN knockout (KO) pool was generated by Synthego using a single-guide RNA (UGUAUGUGAUGUCGGCAGAC). Single clones were generated by single-cell sorting and validated by western blotting utilizing the CRBN antibody D8H3S (Cell Signaling Technology, Cat. #71810) and subsequent Sanger sequencing. An LNCaP CRBN KO pool was generated using the Gene Knockout Kit v2 kit (Synthego) using three single-guide RNAs (CGCACCAUACUGACUUCUUG, GUGAUGAUGAUCCUGAUUCC, and AUAGUACCUAGGUGCUGAUA) and the Neon Transfection system (Thermo Fisher Scientific). Single clones were generated and validated as described above. Doxycycline -inducible CRBN was introduced into validated single clones by lentiviral transduction and selection with 2 μg/mL puromycin (InvivoGen, Cat. #ant-pr-1). 22Rv1 or LNCaP cells were seeded in phenol red–free RPMI + 5% charcoal-stripped FBS (Omega, Cat. #FB-04) + 1% penicillin–streptomycin (Thermo Fisher Scientific, Cat. #15070063) and incubated for 72 hours with or without the indicated concentration of doxycycline (Sigma, Cat. #D9891). Then the indicated concentration of bavdegalutamide or DMSO control was added to the cells, and the cells were incubated for 24 hours before generation of lysates and western blotting as described above. The additional antibodies used were the AR antibody clone D6F11 (Cell Signaling Technology, Cat. #5153) and GAPDH antibody clone 14C10 (Cell Signaling Technology, Cat. #2118).

Ubiquitination assay

VCaP cells cultured in RPMI + 5% charcoal-stripped serum were treated with 2 μmol/L carfilzomib in 0.01% DMSO/starvation media and then incubated with bavdegalutamide (10 nmol/L) for 2 hours. Cells were lysed in 0.5 mL 1× Pierce RIPA buffer (including 1× Pierce Protease Inhibitor Cocktail, 10 μmol/L PR-619, and 20 μmol/L 1,10-phenanthroline). Samples [500 μL; normalized using bicinchoninic acid assay (Thermo Fisher Scientific, Cat. #23225)] were incubated with 40 μL TUBE1 (LifeSensors) bead slurry in 50% TBS for 2 hours, then centrifuged at 3,000 × g, washed, and material eluted from beads using LDS Lysis Buffer and LDS Sample Buffer. Western blotting was performed by transferring samples onto a nitrocellulose membrane, incubating in 5% BSA in TBS at room temperature for 1 hour, and probing with a primary antibody (Cell Signaling Technology, Cat. #5153) for 2 days at 4°C followed by a horseradish peroxidase–conjugated secondary antibody for 1 hour at room temperature. The membranes were visualized using the Clarity substrate (Bio-Rad, Cat. #1705061).

Proteomic screen

VCaP cells were treated with bavdegalutamide [10 nmol/L, i.e., 10-fold higher than half-maximal degradation concentration (DC50)] for 8 hours. Cell lysates were analyzed by label-free LC/MS-MS methodology. The mass spectrometry proteomic data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD049387.

PSA suppression assay

LNCaP/AR cells cultured in charcoal-stripped FBS supplemented with 0.1 nmol/L R1881 were treated with bavdegalutamide or enzalutamide for 48 hours. Intracellular PSA levels were determined using PSA ELISA (Cell Signaling Technology, Cat. #14119).

Cell proliferation and apoptosis assays

VCaP cells were seeded in 96-well plates at 20,000 cells per well in 150 μL of phenol red–free DMEM + 5% charcoal-stripped FBS (Omega) and incubated at 37°C for 3 days. Cells were then treated with 50 μL of 4× concentrated compound to yield indicated concentrations for each experiment in the presence of 0.1 nmol/L R1881. To measure cell proliferation, treated cells were incubated at 37°C for 4 days, after which CellTiter-Glo reagent (Promega, Cat. #G9242) was added to plates and the plates were shaken for 2 minutes to lyse the cells and then incubated at room temperature for 10 minutes. To measure apoptosis, treated cells were incubated at 37°C for 3 days, after which Caspase-Glo 3/7 (Promega, Cat. #G8091) was added to plates and incubated at room temperature for 1 hour. For both assays, plates were read on a luminometer, and data were analyzed and plotted using GraphPad Prism software.

Animal studies

Animals were maintained in accordance with the guidelines of the Guide for the Care and Use of Laboratory Animals (26). All animal research protocol procedures were reviewed and approved by the Arvinas Animal Care and Use Committee.

In most cases, except where noted below, bavdegalutamide and enzalutamide were prepared in 50% polyethylene glycol (PEG) 300, 30% propylene glycol, 20% dextrose 5% solution in water. Mean tumor volumes were plotted with SEM.

VCaP cells (5 × 106) were suspended in phenol red–free medium with 75% Matrigel (BD Biosciences, Cat. #354234) and were implanted subcutaneously into the dorsal flank of 4-week-old CB17/SCID male mice (Charles River Laboratories, strain 394). Upon tumors becoming palpable, mice were surgically castrated using an Institutional Animal Care and Use Committee–approved protocol by removing the testes through a scrotal incision under isoflurane anesthesia (induction at 4% and maintenance at 3%); subcutaneous meloxicam 2.5 mg/kg (Boehringer Ingelheim, Cat. #NDC 0010-6013-01) was used for analgesia. Following castration, the tumors were allowed to regrow. When the tumor volumes reached approximately 150 mm3, the mice were randomized and dosed with either enzalutamide or bavdegalutamide. The patient-derived xenograft TM00298 (The Jackson Laboratory) was grown in intact male NOD/SCID IL2Rγ mice (The Jackson Laboratory, strain 05557-NSG). Mice were administered oral bavdegalutamide (10 mg/kg) or enzalutamide (20 mg/kg) every day for 20 days, with bavdegalutamide as prepared in 5% DMSO and 95% (2% Tween 80/PEG 400).

Tumor volume was measured twice weekly, and the plasma PSA levels were measured with a PSA ELISA (Sigma, Cat. #RAB0331) 16 hours after the last dose.

For the prostate involution studies, male adult Sprague–Dawley rats [Hilltop Lab Animals, Inc., Cat. #SD Hla (SD)CVF] were administered oral bavdegalutamide (5, 15, or 45 mg/kg) or enzalutamide (100 mg/kg) every day for 10 days. Bavdegalutamide was prepared using 50% PEG 300 and 50% propylene glycol. Prostate tissue was isolated and weighed 24 hours after the final dose to assess prostate tissue involution.

An enzalutamide-resistant tumor model was developed by serial passage of a VCaP xenograft in castrated, enzalutamide-treated (20 mg/kg) CB17/SCID mice for 2.5 years. Mice bearing enzalutamide-resistant VCaP xenograft tumors were dosed with oral bavdegalutamide (3 mg/kg or 10 mg/kg) or enzalutamide (20 mg/kg) every day for 28 days.

Tumor volume was measured twice weekly. Tumors were harvested 16 hours after the last dose of bavdegalutamide or enzalutamide for western blot analysis of the indicated proteins.

In vivo activity of bavdegalutamide in combination with abiraterone and bavdegalutamide following tumor resistance to abiraterone was assessed in a three-phase animal study. In phase I, surgically castrated CB17/SCID male mice with subcutaneously implanted VCaP tumors in the dorsal flank were orally administered single-agent bavdegalutamide (3 mg/kg) or abiraterone (100 mg/kg) or a combination of both agents for 43 days. Bavdegalutamide was prepared in 5% DMSO and 95% (2% Tween 80/PEG 400), and abiraterone was prepared using 1% carboxymethyl cellulose and 0.1% Tween 80 in deionized water. In phase II, mice in the abiraterone arm were continuously dosed until the tumors became abiraterone resistant (i.e., reached the approximate size of the tumors in the vehicle arm at the end of the phase I portion of the study). In phase III, animals bearing abiraterone-resistant tumors generated in phase II were randomized to receive oral bavdegalutamide (10 mg/kg) or abiraterone (100 mg/kg) every day for 19 days, using the same formulations as in phase I. Tumor volume was measured twice weekly.

Statistical analysis

One-way ANOVA was used to determine statistically significant differences between the means of the vehicle-treated group and the treatment group using GraphPad Prism.

Data availability

Raw data for this study were generated at Arvinas Operations, Inc. Derived data supporting the findings of this study are available from the corresponding author upon request.

Results

Bavdegalutamide induces ubiquitin-dependent proteasomal degradation of AR

Bavdegalutamide (ARV-110) is a heterobifunctional PROTAC protein degrader of AR, employing the cereblon-containing E3 ubiquitin ligase to enable polyubiquitination and consequent proteasomal degradation of AR (Fig. 1A). Bavdegalutamide utilizes a cyclohexyl moiety to bind to the AR LBD. In a binding affinity determination assay, bavdegalutamide had approximately five times higher affinity to AR than the AR antagonist enzalutamide (Fig. 1B). Bavdegalutamide induced robust degradation of AR at a DC50 of 1 nmol/L in LNCaP and VCaP cells, with >95% of AR degraded in both prostate cancer cell lines (Fig. 1C). A time course of VCaP cells showed that AR degradation with 10 nmol/L bavdegalutamide was rapid, with only 10% of AR protein remaining after the first 4 hours of treatment (Fig. 1D).

To verify that bavdegalutamide employed the PROTAC protein degrader MOA, AR polyubiquitination and proteasome-mediated degradation were assessed. Polyubiquitinated AR species were readily detected upon the treatment of VCaP cells with 10 nmol/L bavdegalutamide (Fig. 1E). Moreover, AR degradation was blocked by co-incubation of bavdegalutamide with the cereblon ligand pomalidomide or the proteasome inhibitor carfilzomib (Fig. 1F), confirming that bavdegalutamide-induced AR degradation is dependent on both the E3 ligase and proteasome. Furthermore, AR degradation was confirmed to be cereblon dependent in CRBN-KO LNCaP and 22Rv1 cells (Fig. 2).

Figure 2.

Figure 2.

Bavdegalutamide-induced AR degradation is CRBN dependent. A, AR degradation with increasing concentrations of bavdegalutamide in LNCaP parental cells (left) and LNCaP KO clone with doxycycline (dox)-inducible CRBN (right). CRBN expression is induced with 32–0.5 ng/mL (twofold dilutions) dox. Representative western blots from two independent experiments are shown. B, AR degradation with increasing concentrations of bavdegalutamide in 22Rv1 parental cells (left) and 22Rv1 KO clone with dox-inducible CRBN (right). CRBN expression is induced with 20–1.3 ng/mL (twofold dilutions) dox. Representative western blots from two independent experiments are shown.

Bavdegalutamide selectively targets WT AR and clinically relevant mutants

To investigate the selectivity of bavdegalutamide, we examined whether bavdegalutamide induced degradation of the GR, another nuclear hormone receptor that is closely related to AR. In the MCF-7 breast cancer cell line, bavdegalutamide treatment (30–300 nmol/L) resulted in the degradation of AR but not GR (Fig. 3A). In addition, an unbiased proteomic screen of nearly 4,000 detectable proteins in VCaP cells showed that treatment with 10 nmol/L bavdegalutamide for 8 hours led to degradation of only AR when a filter of >2× degradation and a P value of <0.05 were applied (Fig. 3B).

Figure 3.

Figure 3.

Bavdegalutamide selectively degrades AR and targets WT AR and clinically relevant mutants. A, Degradation of AR but not GR at 30, 100, or 300 nmol/L bavdegalutamide in MCF-7 cells. B, Selective degradation of AR among nearly 4,000 proteins measured by mass spectrometry following treatment of VCaP cells with 10 nmol/L bavdegalutamide for 8 hours (representative of four experiments). C, Degradation of stably expressed WT AR and clinically relevant mutants of AR in T-REx-293 cells treated with up to 100 nmol/L of bavdegalutamide. (representative of five independent experiments; mean and SEM are plotted). D, Degradation of stably expressed WT AR and ARL702H in T-REx-293 cells and endogenously expressed ART878A/L702H in MDA PCa 2B cells (representative of three independent experiments). hMito, human mitochondria.

As specific point mutations in the AR LBD have been shown to confer resistance to existing prostate cancer therapies (2, 1215), we tested if clinically relevant mutants that were stably expressed in T-REx-293 cells were susceptible to degradation by bavdegalutamide. Four of the six AR-mutant proteins tested (F877L, T878A, M896V, and H875Y) were degraded with similar potency to WT AR (Fig. 3C), whereas L702H and the T878A/L702H double mutant were degraded at lesser potency in T-REx-293 and MDA PCa 2B cells (DC50 of >3 μmol/L and >100 nmol/L, respectively; Fig. 3D). To further evaluate the range of clinically identified AR mutants that bavdegalutamide can degrade, an additional eight AR single mutants and four double mutants were tested. All mutants were degraded with similar efficiency to WT AR (<10 nmol/L in the T-REx-293 overexpression system; Supplementary Table S1). Due to its binding to AR via the AR LBD, bavdegalutamide treatment did not induce the degradation of AR splice variant 7, which lacks the AR LBD (Supplementary Fig. S1; ref. 15).

As bavdegalutamide engages cereblon at the same binding site as thalidomide and other immunomodulatory imide drugs, a study was conducted to evaluate whether bavdegalutamide presents neomorphic substrates to cereblon for degradation as has been shown for thalidomide analogues (lenalidomide and pomalidomide; refs. 2730). Treatment of Ramos cells with increasing concentrations of bavdegalutamide did not lead to degradation of G1–S phase transition 1 protein, IKZF3 (Aiolos), or IKZF1 (Ikaros), and only modest degradation of CK1α was observed at 300 to 1,000 nmol/L (Supplementary Fig. S2). In SK-N-DZ cells, SALL4 was modestly degraded at 1,000 nmol/L (Supplementary Fig. S3). Given that the in vitro functional efficacy of bavdegalutamide is in the range of 1 to 30 nmol/L, these data demonstrate at least a 10× window between AR and CK1α and SALL4 modulations.

Effects of bavdegalutamide-induced AR degradation on prostate cancer cells

To understand the functional consequences of AR degradation versus inhibition, several cell-based experiments were designed to compare bavdegalutamide with enzalutamide. First, LNCaP cells overexpressing WT AR and stimulated with 0.1 nmol/L of the synthetic androgen R1881 were tested for the effects of respective compounds on PSA synthesis. Consistent with its AR degradation potency, bavdegalutamide treatment inhibited PSA synthesis at an IC50 of 10 nmol/L; enzalutamide was 10-fold less active (Fig. 4A). Next, we examined the effect of compounds on prostate cancer cell proliferation in the absence and presence of elevated levels of androgen in VCaP cells, in which the AR gene is amplified and AR expression levels were approximately 10-fold higher than those in LNCaP cells (31). In the presence of 0.1 nmol/L R1881, bavdegalutamide inhibited VCaP cell proliferation at an IC50 of 20 nmol/L, whereas enzalutamide had a potency of 1 μmol/L (Fig. 4B). To test if the antiproliferative activity of bavdegalutamide was retained in the presence of elevated androgen, VCaP cells were cultured in androgen-depleted, charcoal-stripped serum and co-treated with 300 nmol/L bavdegalutamide and increasing concentrations of R1881 (Fig. 4C). As expected, R1881 alone increased the proliferation of VCaP cells, showing that proliferation can be induced by the activation of the AR signaling pathway. Bavdegalutamide showed antiproliferative effects even in the presence of 1 nmol/L R1881, whereas enzalutamide was antiproliferative only at R1881 concentrations <0.1 nmol/L, demonstrating the advantage of the event-driven pharmacology of bavdegalutamide compared with that of the occupancy-driven pharmacology of enzalutamide as all three compounds bind to the LBD. Lastly, we assessed apoptosis in VCaP cells (stimulated with 0.1 nmol/L R1881) following treatment with increasing concentrations of bavdegalutamide or enzalutamide. Bavdegalutamide induced apoptosis with a 50- to 100-fold increased potency compared with enzalutamide and was accompanied by PARP cleavage (Fig. 4D).

Figure 4.

Figure 4.

Bavdegalutamide inhibits PSA synthesis, blocks prostate cancer cell proliferation in the absence and presence of elevated androgen levels, and induces apoptosis. A, PSA levels with increasing concentrations of bavdegalutamide or enzalutamide in LNCaP/AR cells. The data shown are representative of two independent experiments. B, Proliferation of VCaP cells with increasing concentrations of bavdegalutamide or enzalutamide (representative of nine independent experiments; mean and SEM are plotted). C, Proliferation of VCaP cells with 300 nmol/L bavdegalutamide or 1,000 nmol/L enzalutamide and co-treatment with increasing concentrations of R1881 for 5 days. D, Apoptosis, measured by the activity of caspase-3 and caspase-7 and PARP cleavage, with increasing concentrations of bavdegalutamide or enzalutamide in VCaP cells. (representative of three independent experiments; mean and SEM are plotted). A825 is a BET degrader used as a positive control for apoptosis. BET, bromodomain and extra terminal; hMito, human mitochondria; MitoC, mitochondria control; RLU, relative light unit.

Bavdegalutamide inhibits tumor growth in prostate cancer animal models

We tested the degree of AR degradation induced by bavdegalutamide in VCaP xenografts implanted in castrated male mice. Administration of oral dosages of 0.3, 1, or 3 mg/kg of bavdegalutamide every day for 3 days resulted in dose-dependent reduction of the AR protein in tumors by 70%, 87%, and 90%, respectively (Fig. 5A). Robust tumor growth inhibition (TGI) was observed at bavdegalutamide doses ≥0.3 mg/kg in this castrated VCaP xenograft model (TGI of 20%, 69%, 101%, and 109% at 0.1, 0.3, 1, and 3 mg/kg, respectively; Fig. 5B); enzalutamide was also active (79% TGI) in this model because of low circulating testosterone levels. Body weights were maintained during treatment with bavdegalutamide or enzalutamide (Supplementary Fig. S4).

Figure 5.

Figure 5.

Oral doses of bavdegalutamide every day result in substantial degradation of AR in xenografts, provide TGI in prostate cancer mouse models, and induce rat prostate involution. A, AR degradation with increasing doses (every day × 3) of bavdegalutamide in a castrated VCaP xenograft model (16 hours after last dose, mean and SD are denoted. The data shown are representative of at least 10 similar studies that were conducted. B, TGI with bavdegalutamide vs. enzalutamide in a castrated VCaP xenograft model. Mean tumor volume and SEM are plotted. The data shown are representative of at least 10 similar studies that were conducted. C, TGI (mean tumor volume and SEM are plotted) and AR degradation (16 hours after the last dose; mean and SD are denoted) with increasing doses of bavdegalutamide vs. enzalutamide in an intact (noncastrated) VCaP xenograft model. The data shown are representative of four independent studies that were conducted. D, TGI (mean tumor volume and SEM are plotted) and PSA reduction (16 hours after the last dose, mean and SD are denoted) with bavdegalutamide vs. enzalutamide in an AR-expressing patient-derived xenograft model. The data shown are representative of the two independent studies that were conducted. E, Rat prostate involution with bavdegalutamide vs. enzalutamide. Intact male adult rats were treated orally for 10 days, after which prostates were isolated and weighed (24 hours after the last dose, mean and SD are denoted). One-way ANOVA with the Tukey multiple comparison test was used to compare treatments. The data shown are representative of three independent studies conducted. hMito, human mitochondria.

We next assessed TGI by bavdegalutamide in intact (noncastrated) mice implanted with human VCaP tumor xenografts to mimic a higher androgen-concentration environment. Previous reports indicated that enzalutamide had little to no effect on tumor growth in this model (32, 33), presumably owing to its inability to completely block higher levels of intracellular androgens from engaging and activating AR. In this model, bavdegalutamide dosages of 1, 3, or 10 mg/kg administered orally every day for 20 days resulted in substantial TGI (60%, 67%, and 70%, respectively)—unlike enzalutamide (−11% TGI)—and dose-dependent reductions in AR levels by 64%, 70%, and 78%, respectively, in tumors harvested 16 hours after the last dose (Fig. 5C).

Bavdegalutamide activity was also examined and compared with enzalutamide in two additional intact in vivo models. In the AR-expressing patient-derived xenograft model TM00298, in which enzalutamide treatment has been shown to reduce PSA levels by approximately 50% without affecting tumor growth (34), bavdegalutamide provided robust TGI (100%), in contrast with enzalutamide (25%; Fig. 5D) and similar to our findings with the intact VCaP xenograft model. Moreover, bavdegalutamide reduced circulating PSA levels by >90% (93%), whereas only the expected 50% (58%) reduction was observed for enzalutamide (Fig. 5D). Second, we studied rat prostate tissue involution following administration of bavdegalutamide or enzalutamide. Based on published toxicology studies (35), we selected a clinically relevant 100 mg/kg dose of enzalutamide for this study. Oral administration of bavdegalutamide induced rat prostate involution in a dose-dependent manner, and both 15 and 45 mg/kg doses showed significantly higher activity than enzalutamide (Fig. 5E).

Bavdegalutamide is active in enzalutamide- and abiraterone-resistant animal models

Given the ability of bavdegalutamide to inhibit tumor growth in enzalutamide-refractory models (i.e., intact VCaP and patient-derived xenograft mouse models), we tested bavdegalutamide in an enzalutamide-resistant model. We serially propagated VCaP tumors in castrated mice that were continually treated with enzalutamide for 2.5 years, after which the tumor growth accelerated dramatically, suggesting the development of acquired resistance to enzalutamide. However, the definitive mechanisms of resistance are unknown. A cohort of 45 enzalutamide-resistant tumor-bearing mice were separated into four groups that were orally administered enzalutamide (20 mg/kg; n = 15), bavdegalutamide (3 and 10 mg/kg; n = 10 each), or vehicle (n = 10). Bavdegalutamide showed substantial TGI at 3 and 10 mg/kg doses (60% and 70%, respectively); as expected, TGI was not observed in enzalutamide-treated animals (Fig. 6A). Furthermore, robust (∼90%) AR degradation was seen in tumors harvested 16 hours after the last dose of 3 or 10 mg/kg bavdegalutamide. Concomitant reductions in the AR target gene TMPRSS–ERG (Fig. 6A) were also observed in the tumors of bavdegalutamide-treated mice, whereas this effect did not occur with enzalutamide treatment. Body weights were maintained during treatment with bavdegalutamide or enzalutamide (Fig. 6A).

Figure 6.

Figure 6.

Bavdegalutamide shows activity in enzalutamide- and abiraterone-resistant xenograft models. A, TGI (mean tumor volume and SEM are plotted), animal body weight (mean and SEM are plotted), AR degradation (mean and SD are denoted), and downstream signaling inhibition (ERG protein levels; mean and SD are denoted) with 10 or 3 mg/kg bavdegalutamide orally every day vs. 20 mg/kg enzalutamide in an enzalutamide-resistant VCaP model. VCaP cells harbor the TMPRSS2–ERG fusion, putting ERG under the transcriptional control of AR. Tumors were harvested 16 hours after the last dose. The data shown are representative of four independent studies conducted. B, TGI with oral, 3 mg/kg bavdegalutamide every day, 100 mg/kg abiraterone, or combination treatment in a VCaP xenograft model (phase I) and with 10 mg/kg bavdegalutamide or 100 mg/kg abiraterone (phase III) after emergence of abiraterone resistance (phase II; mean tumor volume and SEM are plotted). AR degradation with 3 mg/kg bavdegalutamide vs. 3 mg/kg bavdegalutamide in combination with 100 mg/kg abiraterone in the VCaP xenografts in phase I of the model. Tumors were harvested 16 hours after the last dose. The data shown are representative of two independent studies conducted. ERG, ETS-related gene; hMito, human mitochondria.

To evaluate the activity of bavdegalutamide in combination with abiraterone, followed by testing its effect in an abiraterone-resistant setting, a three-phase study in castrated mice implanted with human VCaP tumor xenografts was conducted. In phase I, animals were treated with bavdegalutamide (3 mg/kg; n = 10), abiraterone (100 mg/kg; n = 10), bavdegalutamide plus abiraterone (n = 9), or vehicle (n = 10). AR protein levels were reduced similarly in animals treated with bavdegalutamide or with bavdegalutamide in combination with abiraterone as compared to animals treated with the vehicle (Fig. 6B). The combination of bavdegalutamide and abiraterone provided greater TGI (92%) than either bavdegalutamide or abiraterone alone (74% and 60%, respectively; Fig. 6B). In phase II, animals in the abiraterone group were continually treated until their tumors reached the approximate size of those in the vehicle group at the end of phase I (based on overlapping error bars at the final time points of phases I and II); the animals with abiraterone-resistant tumors were then randomized to receive oral bavdegalutamide (10 mg/kg; n = 4) or abiraterone (100 mg/kg; n = 4) every day for 19 days in phase III. Given the limited number of animals available in phase III, only the 10 mg/kg dose of bavdegalutamide was tested. Bavdegalutamide reduced the volume of these abiraterone-resistant tumors over the course of the treatment period (Fig. 6B).

Discussion

As a nuclear hormone receptor, AR does not have some of the pharmacologic barriers of other transcription factors, which have traditionally been considered “undruggable” (36). Specifically, the LBD of AR, which when bound by androgens leads to AR activation, has been exploited successfully as a drug target. However, mutations in the LBD are associated with drug resistance to approved AR antagonists, such as enzalutamide (1315). Degradation of AR rather than inhibition of its function is an appealing therapeutic strategy that could circumvent and/or overcome many of the AR-linked drug resistance mechanisms associated with prostate cancer progression. The preclinical data reported here suggest that the PROTAC MOA of bavdegalutamide may offer advantages over currently approved AR-targeting therapies, driven by event-driven versus occupancy-driven pharmacology and elimination of the AR protein versus inhibition of AR activity.

Bavdegalutamide is a potent AR degrader, with a DC50 of 1 nmol/L. Importantly, we confirmed that bavdegalutamide degrades AR via the UPS, based on experiments showing that AR degradation was inhibited by the cereblon ligand pomalidomide, deletion of CRBN, or the proteasome inhibitor carfilzomib. Bavdegalutamide is a selective degrader of AR, showing no activity toward the closely related GR and no impact on the abundance of other proteins in a proteomic screen. Furthermore, limited to no degradation of several known neomorphic substrates of cereblon was observed in cell lines; only minimal degradation of CK1α and SALL4 was observed. How these latter in vitro data translate to in vivo settings was not investigated. Notably, bavdegalutamide degraded all tested AR LBD mutants that are associated with resistance to abiraterone (2, 12) and/or enzalutamide (1315) to a similar degree to WT AR with the exception of L702H and T878A/L702H, which were degraded but with lesser potency. Together, these data suggest that bavdegalutamide may be a potential treatment option for patients in whom WT AR is the tumor driver as well as in those whose tumors have developed resistance to ARPIs.

Bavdegalutamide-induced AR degradation demonstrated significant downstream functional effects that are superior to inhibition. In prostate cancer cell lines, bavdegalutamide had more potent effects than enzalutamide for the reduction of PSA levels, inhibition of cell proliferation, and induction of apoptosis. Of note, bavdegalutamide showed greater antiproliferative effects than enzalutamide in the presence of higher concentrations of the synthetic androgen R1881 in VCaP cells, which are known to possess a significant AR gene amplification, a resistance mechanism to antiandrogen therapy. These findings are consistent with the PROTAC protein degrader MOA that has been described as “catalytic” (17) or, more appropriately, iterative, and uses event-driven rather than occupancy-driven pharmacology and suggest that bavdegalutamide can retain activity in a high androgen milieu in patients with prostate cancer, such as when intratumoral androgen production drives treatment resistance (37, 38). Indeed, whereas both enzalutamide and bavdegalutamide inhibited tumor growth in a castrated mouse model in which androgen levels were low, only bavdegalutamide showed this activity in an intact mouse model with higher levels of circulating testosterone, lending further support to greater potency via the event-driven PROTAC protein degrader MOA compared with a small-molecule inhibitor.

Bavdegalutamide also blocked tumor growth in enzalutamide- and abiraterone-resistant prostate cancer models. These data suggest that bavdegalutamide could have efficacy as a later-line mCRPC treatment for patients who have developed resistance to the ARPIs that are currently the standard of care for mCRPC. Combination treatment with bavdegalutamide plus abiraterone showed greater TGI than either monotherapy in our animal model, indicating clinical potential for dual AR pathway inhibition through different MOAs.

In summary, these data demonstrate that orally bioavailable bavdegalutamide can robustly degrade AR, which translates into antitumor activity in various preclinical settings in which currently approved therapies are not effective. Based on these data, bavdegalutamide became the first PROTAC protein degrader to enter human clinical trials, specifically a phase I/II trial in patients with mCRPC after treatment with prior ARPIs (NCT03888612).

Supplementary Material

Supplementary Table S1

Supplementary Table S1 shows bavdegalutamide half-maximal degradation concentrations for wild-type and clinically relevant mutant AR

Supplementary Figure S1

Supplementary Figure S1 shows the effect of bavdegalutamide on AR versus AR-V7

Supplementary Figure S2

Supplementary Figure S2 shows the effect of bavdegalutamide on neomorphic substrates

Supplementary Figure S3

Supplementary Figure S3 shows the effect of bavdegalutamide on SALL4

Supplementary Figure S4

Supplementary Figure S4 shows maintenance of animal body weights during treatment with bavdegalutamide or enzalutamide in prostate cancer mouse models

Acknowledgments

This work was funded by Arvinas Operations, Inc. The investigation of several novel AR degraders to treat castration-resistant prostate cancer was supported by the NCI of the NIH under award number R44CA203199. The content does not necessarily represent the official views of the NIH. We would like to thank Jennifer Macaluso, Eric Sanford and Andrew P. Crew for their contributions to these analyses and Joanna Bloom (Arvinas Operations, Inc.) for her assistance with drafting of the manuscript. Editorial support was provided by Paula Stuckart and Melissa Austin of Apollo Medical Communications, part of Helios Global Group, and funded by Arvinas Operations, Inc.

Footnotes

Note: Supplementary data for this article are available at Molecular Cancer Therapeutics Online (http://mct.aacrjournals.org/).

Authors’ Disclosures

L.B. Snyder reports a patent for US10584101 issued, a patent for US10844021 issued, a patent for US11236051 issued, a patent for US11952347 issued, a patent for PCTUS2020056684 pending, a patent for PCTUS2319496 pending, and a patent for PCTUS2024025572 pending, as well as employment with Arvinas at the time of this work and stock ownership in Arvinas. R.R. Willard reports employment with Arvinas at the time of this work and stock ownership in Arvinas. D.A. Gordon reports employment with Arvinas and stock ownership in Arvinas. J. Pizzano reports employment with Arvinas and stock ownership in Arvinas at the time of this work. N. Vitale reports employment with Arvinas at the time of this work and stock ownership in Arvinas. K. Robling reports employment with Arvinas and stock ownership in Arvinas. M.A. Dorso reports employment with Arvinas and stock ownership in Arvinas. W. Moghrabi reports ownership of few stocks in Arvinas. S. Landrette reports employment with Arvinas and stock ownership in Arvinas. R. Gedrich reports a patent for PCTUS24028421 pending; employment with Arvinas and stock ownership in Arvinas at the time of this work; and current employment with PIC Therapeutics and stock ownership in PIC Therapeutics. S.H. Lee reports a patent for PCTUS2319496 pending; employment with Arvinas at the time of this work; and current employment with a biotech/pharma company other than Arvinas and stock ownership in other biotech/pharma companies. I.C.A. Taylor reports grants from department of health & human services/NIH/NCI/small business innovation research during the conduct of the study, as well as employment with Arvinas and stock ownership in Arvinas. J.G. Houston reports employment with Arvinas and stock ownership in Arvinas. T. K. Neklesa reports employment with Arvinas at the time of this work.

Authors’ Contributions

L.B. Snyder: Conceptualization, supervision, investigation. T.K. Neklesa: Conceptualization, investigation, writing–original draft, writing–review and editing. R.R. Willard: Investigation, methodology, writing–original draft, writing–review and editing. D.A. Gordon: Data curation. J. Pizzano: Data curation. N. Vitale: Data curation, formal analysis, investigation, visualization, methodology. K. Robling: Investigation. M.A. Dorso: Investigation. W. Moghrabi: Investigation. S. Landrette: Investigation, writing–review and editing. R. Gedrich: Supervision, writing–review and editing. S.H. Lee: Conceptualization, investigation. I.C.A. Taylor: Supervision, writing–review and editing. J.G. Houston: Supervision, writing–review and editing.

References

  • 1. Siegel RL, Miller KD, Wagle NS, Jemal A. Cancer statistics, 2023. CA Cancer J Clin 2023;73:17–48. [DOI] [PubMed] [Google Scholar]
  • 2. Azad AA, Volik SV, Wyatt AW, Haegert A, Le Bihan S, Bell RH, et al. Androgen receptor gene aberrations in circulating cell-free DNA: biomarkers of therapeutic resistance in castration-resistant prostate cancer. Clin Cancer Res 2015;21:2315–24. [DOI] [PubMed] [Google Scholar]
  • 3. Robinson D, Van Allen EM, Wu Y-M, Schultz N, Lonigro RJ, Mosquera J-M, et al. Integrative clinical genomics of advanced prostate cancer. Cell 2015;162:454. [DOI] [PubMed] [Google Scholar]
  • 4. Quigley DA, Dang HX, Zhao SG, Lloyd P, Aggarwal R, Alumkal JJ, et al. Genomic hallmarks and structural variation in metastatic prostate cancer. Cell 2018;174:758–69.e9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Takeda DY, Spisák S, Seo J-H, Bell C, O’Connor E, Korthauer K, et al. A somatically acquired enhancer of the androgen receptor is a noncoding driver in advanced prostate cancer. Cell 2018;174:422–32.e13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Herberts C, Annala M, Sipola J, Ng SWS, Chen XE, Nurminen A, et al. Deep whole-genome ctDNA chronology of treatment-resistant prostate cancer. Nature 2022;608:199–208. [DOI] [PubMed] [Google Scholar]
  • 7. Sayegh N, Swami U, Agarwal N. Recent advances in the management of metastatic prostate cancer. JCO Oncol Pract 2022;18:45–55. [DOI] [PubMed] [Google Scholar]
  • 8. Antonarakis ES. Current understanding of resistance to abiraterone and enzalutamide in advanced prostate cancer. Clin Adv Hematol Oncol 2016;14:316–9. [PubMed] [Google Scholar]
  • 9. Beer TM, Armstrong AJ, Rathkopf DE, Loriot Y, Sternberg CN, Higano CS, et al. Enzalutamide in metastatic prostate cancer before chemotherapy. N Engl J Med 2014;371:424–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Poon DMC, Wong KCW, Chan TW, Law K, Chan K, Lee KC, et al. The survival outcome, prostate-specific antigen (PSA) response and risk of fatigue of enzalutamide as first- and later-line treatment options in patients with metastatic castration-resistant prostate cancer (mCRPC): the real-world experience. J Clin Oncol 2018;36(Suppl 6):330. [Google Scholar]
  • 11. Antonarakis ES, Zhang N, Saha J, Nevalaita L, Ikonen T, Tsai, LJ, et al. Prevalence and spectrum of AR ligand-binding domain mutations detected in circulating-tumor DNA across disease states in men with metastatic castration-resistant prostate cancer. JCO Precis Oncol 2024:8:e2300330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Romanel A, Tandefelt DG, Conteduca V, Jayaram A, Casiraghi N, Wetterskog D, et al. Plasma AR and abiraterone-resistant prostate cancer. Sci Transl Med 2015;7:312re10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Lallous N, Volik SV, Awrey S, Leblanc E, Tse R, Murillo J, et al. Functional analysis of androgen receptor mutations that confer anti-androgen resistance identified in circulating cell-free DNA from prostate cancer patients. Genome Biol 2016;17:10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Wyatt AW, Azad AA, Volik SV, Annala M, Beja K, McConeghy B, et al. Genomic alterations in cell-free DNA and enzalutamide resistance in castration-resistant prostate cancer. JAMA Oncol 2016;2:1598–606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Jernberg E, Bergh A, Wikström P. Clinical relevance of androgen receptor alterations in prostate cancer. Endocr Connect 2017;6:R146–1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Sakamoto KM, Kim KB, Kumagai A, Mercurio F, Crews CM, Deshaies RJ. Protacs: chimeric molecules that target proteins to the Skp1-Cullin-F box complex for ubiquitination and degradation. Proc Natl Acad Sci U S A 2001;98:8554–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Bondeson DP, Mares A, Smith IED, Ko E, Campos S, Miah AH, et al. Catalytic in vivo protein knockdown by small-molecule PROTACs. Nat Chem Biol 2015;11:611–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Békés M, Langley DR, Crews CM. PROTAC targeted protein degraders: the past is prologue. Nat Rev Drug Discov 2022;21:181–200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Chirnomas D, Hornberger KR, Crews CM. Protein degraders enter the clinic—a new approach to cancer therapy. Nat Rev Clin Oncol 2023;20:265–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Ferraldeschi R, Welti J, Luo J, Attard G, de Bono JS. Targeting the androgen receptor pathway in castration-resistant prostate cancer: progresses and prospects. Oncogene 2015;34:1745–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Westaby D, Fenor de La Maza MdLD, Paschalis A, Jimenez-Vacas JM, Welti J, de Bono J, et al. A new old target: androgen receptor signaling and advanced prostate cancer. Annu Rev Pharmacol Toxicol 2022;62:131–53. [DOI] [PubMed] [Google Scholar]
  • 22. Crew AP, Snyder LB, Wang J. inventor; Arvinas, Inc. , assignee. Compounds and methods for the targeted degradation of androgen receptor. United States patent US 20180099940. 2018 Apr 12. [Google Scholar]
  • 23. Allan LEN, Chen CH, Dong H, Grosso JA, Haskell RJ III, Lloyd R, et al. inventor; Arvinas Operations, Inc. , assignee. Methods of manufacturing a bifunctional compound, ultrapure forms of the bifunctional compound, and dosage forms comprising the same. United States patent US 20230012321. 2023 Jan 12. [Google Scholar]
  • 24. Salami J, Alabi S, Willard RR, Vitale NJ, Wang J, Dong H, et al. Androgen receptor degradation by the proteolysis-targeting chimera ARCC-4 outperforms enzalutamide in cellular models of prostate cancer drug resistance. Commun Biol 2018;1:100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Zava DT, Landrum B, Horwitz KB, McGuire WL. Androgen receptor assay with [3H]methyltrienolone (R1881) in the presence of progesterone receptors. Endocrinology 1979;104:1007–12. [DOI] [PubMed] [Google Scholar]
  • 26. National Research Council (US) . Committee for the update of the guide for the care and use of laboratory animals. In: Guide for the care and use of laboratory animals. 8th ed. Washington (DC): National Academies Press (US); 2011. [Google Scholar]
  • 27. Lu G, Middleton RE, Sun H, Naniong M, Ott CJ, Mitsiades CS, et al. The myeloma drug lenalidomide promotes the cereblon-dependent destruction of Ikaros proteins. Science 2014;343:305–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Krönke J, Fink EC, Hollenbach PW, MacBeth KJ, Hurst SN, Udeshi ND, et al. Lenalidomide induces ubiquitination and degradation of CK1α in del(5q) MDS. Nature 2015;523:183–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Matyskiela ME, Lu G, Ito T, Pagarigan B, Lu C-C, Miller K, et al. A novel cereblon modulator recruits GSPT1 to the CRL4(CRBN) ubiquitin ligase. Nature 2016;535:252–7. [DOI] [PubMed] [Google Scholar]
  • 30. Matyskiela ME, Couto S, Zheng X, Lu G, Hui J, Stamp K, et al. SALL4 mediates teratogenicity as a thalidomide-dependent cereblon substrate. Nat Chem Biol 2018;14:981–7. [DOI] [PubMed] [Google Scholar]
  • 31. Makkonen H, Kauhanen M, Jääskeläinen T, Palvimo JJ. Androgen receptor amplification is reflected in the transcriptional responses of vertebral-cancer of the Prostate cells. Mol Cell Endocrinol 2011;331:57–65. [DOI] [PubMed] [Google Scholar]
  • 32. Asangani IA, Dommeti VL, Wang X, Malik R, Cieslik M, Yang R, et al. Therapeutic targeting of BET bromodomain proteins in castration-resistant prostate cancer. Nature 2014;510:278–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Raina K, Lu J, Qian Y, Altieri M, Gordon D, Rossi AMK, et al. PROTAC-induced BET protein degradation as a therapy for castration-resistant prostate cancer. Proc Natl Acad Sci U S A 2016;113:7124–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Jin L, Garcia J, Chan E, de la Cruz C, Segal E, Merchant M, et al. Therapeutic targeting of the CBP/p300 bromodomain blocks the growth of castration-resistant prostate cancer. Cancer Res 2017;77:5564–75. [DOI] [PubMed] [Google Scholar]
  • 35. Center for drug evaluation and research application number: 203415Orig1s000. [cited 2022 Jun 15]. Available from:https://www.accessdata.fda.gov/drugsatfda_docs/nda/2012/203415Orig1s000PharmR.pdf.
  • 36. Henley MJ, Koehler AN. Advances in targeting ‘undruggable’ transcription factors with small molecules. Nat Rev Drug Discov 2021;20:669–88. [DOI] [PubMed] [Google Scholar]
  • 37. Yuan X, Cai C, Chen S, Chen S, Yu Z, Balk SP. Androgen receptor functions in castration-resistant prostate cancer and mechanisms of resistance to new agents targeting the androgen axis. Oncogene 2014;33:2815–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Schmidt KT, Huitema ADR, Chau CH, Figg WD. Resistance to second-generation androgen receptor antagonists in prostate cancer. Nat Rev Urol 2021;18:209–26. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Table S1

Supplementary Table S1 shows bavdegalutamide half-maximal degradation concentrations for wild-type and clinically relevant mutant AR

Supplementary Figure S1

Supplementary Figure S1 shows the effect of bavdegalutamide on AR versus AR-V7

Supplementary Figure S2

Supplementary Figure S2 shows the effect of bavdegalutamide on neomorphic substrates

Supplementary Figure S3

Supplementary Figure S3 shows the effect of bavdegalutamide on SALL4

Supplementary Figure S4

Supplementary Figure S4 shows maintenance of animal body weights during treatment with bavdegalutamide or enzalutamide in prostate cancer mouse models

Data Availability Statement

Raw data for this study were generated at Arvinas Operations, Inc. Derived data supporting the findings of this study are available from the corresponding author upon request.


Articles from Molecular Cancer Therapeutics are provided here courtesy of American Association for Cancer Research

RESOURCES