Abstract
Idiopathic generalized epilepsy (IGE) is a class of genetically determined, phenotypically related epilepsy syndromes. Linkage analysis identified a chromosome 18 locus predisposing to a number of adolescent-onset IGEs. We report a single-nucleotide polymorphism (SNP) association analysis of the region around the marker locus with the high LOD score. This analysis, which used both case-control and family-based association methods, yielded strong evidence that malic enzyme 2 (ME2) is the gene predisposing to IGE. We also observed association among subgroups of IGE syndromes. An ME2-centered nine-SNP haplotype, when present homozygously, increases the risk for IGE (odds ratio 6.1; 95% confidence interval 2.9–12.7) compared with any other genotype. Both the linkage analysis and the association analysis support recessive inheritance for the locus, which is compatible with the fact that ME2 is an enzyme. ME2 is a genome-coded mitochondrial enzyme that converts malate to pyruvate and is involved in neuronal synthesis of the neurotransmitter γ-aminobutyric acid (GABA). The results suggest that GABA synthesis disruption predisposes to common IGE and that clinical seizures are triggered when mutations at other genes, or perhaps other insults, are present.
Idiopathic generalized epilepsy (IGE [MIM 600699]) is one of the most common forms of epilepsy, representing ∼30% of all epilepsies (Annegers 1994). Diagnostically, the classification of different forms of IGE is dependent on the specifics of seizure characteristics, including type(s) of seizures, age at onset, timing of seizures, factors precipitating seizures, etc. (International League Against Epilepsy 1989). The most important aspect of syndrome classification in IGE is the type of seizures seen, of which there are usually three forms: myoclonic seizures (bilateral brief jerks of the upper and sometimes lower limbs), absence seizures (brief staring spells with loss of consciousness), and generalized tonic-clonic seizures, which involve loss of consciousness and generalized convulsions. The IGEs usually begin in childhood and adolescence and are primarily, if not exclusively, genetic (Greenberg et al. 1992). The problem for genetic studies is that not only do the syndrome characteristics overlap, thus making the phenotype definition for genetic studies unclear, but different IGE syndromes frequently occur within the same family (Beck-Mannagetta and Janz 1991). This mixed familiality further complicates phenotype definition. The mode of inheritance of the IGEs is complex and likely involves an oligogenic model in which several genes must interact to produce a phenotype (Greenberg et al. 1988a, 1992; Durner et al. 2001). There appear to be several loci, some of which are specific for certain seizure types—for example, myoclonic seizures may be determined in part by a gene on chromosome 6, BRD2 (Greenberg et al. 2000; Pal et al. 2003), whereas absence seizures may be influenced by a gene or genes on chromosome 5 (Durner et al. 2001). However, we have identified one locus on chromosome 18 that appears to be common to all the adolescent-onset IGE syndromes we studied: juvenile myoclonic epilepsy (JME [MIM 606904]), juvenile absence epilepsy (JAE [MIM 607631]), and epilepsy with generalized tonic-clonic seizures (EGTCS). Here, we report the identification of that locus and of a specific SNP haplotype that conveys a sixfold increase in the odds of disease for these IGEs.
Our previous linkage analysis results showed a maximum two-point LOD score of 5.2 at D18S474, under a recessive model, with evidence of heterogeneity (Durner et al. 2001). The data consisted of many small nuclear families. Unambiguous recombinants, which would have allowed us to limit the candidate region, could not be identified. Because simulation studies of linkage suggested that, at LOD scores >5, the sought-for locus was likely to lie within 3 cM of the peak (Greenberg and Abreu 2001), we started the search for association at the point of maximum evidence for linkage and typed SNPs on either side of D18S474 (dbSNP Home Page).
Probands had received diagnoses of one of the following IGE syndromes: JME, JAE, or EGTCS. Study-eligibility criteria have been described elsewhere (Greenberg et al. 1995). All subjects signed informed consent forms and were interviewed in person to confirm the diagnosis, to confirm that study entry criteria were met, and to collect blood for DNA extraction. Subjects for the case-control analysis included 156 patients with IGE (88 with JME; 68 with JAE + EGTCS) and 126 randomly chosen controls of European origin. For family-based association, we included 108 families (59 with JME; 49 with JAE + EGTCS) and used the program TRANSMIT (D. Clayton's Web site) to evaluate excess transmission. All family members were included, so that maximum information was obtained even from families missing a parent, but only the proband was used to test for transmission distortion. We used the program SNPHAP to infer haplotypes (Clayton and Jones 1999). We SNP-typed 35 SNPs in the region of D18S474. The SNP names and positions are listed in table 1. We also used the program GOLD (Abecasis and Cookson 2000) to examine the marker-marker linkage disequilibrium (LD) in the region.
Table 1.
List of SNPs Used in the Analysis and Their Chromosomal Positions[Note]
| SNP Numbera | SNP Name | SNP Position onChromosome 18(kb) |
| 1 | rs3752087 | 46442.427 |
| 2 | rs3892158 | 46452.5 |
| 3 | rs1370484 | 46481.329 |
| 4 | rs4940007 | 46510.479 |
| 5 | rs1470325 | 46525.278 |
| 6 | rs1954882 | 46542.655 |
| 7 | rs2276186 | 46579.802 |
| 8 | rs2849233 | 46583.54 |
| 9 | rs2255672 | 46585.354 |
| 10 | rs2586775 | 46588.141 |
| 11 | rs2218369 | 46592.104 |
| 12 | rs2586770 | 46595.637 |
| 13 | rs2849239 | 46596.829 |
| 14 | rs2586760 | 46615.12 |
| 15 | rs2586761 | 46618.445 |
| 16 | rs1822459 | 46626.114 |
| 17 | rs674351 | 46639.943 |
| 18 | rs584087 | 46644.537 |
| 19 | rs585344 | 46650.854 |
| 20 | rs608781 | 46659.313 |
| 21 | rs642698 | 46674.972 |
| 22 | rs674210 | 46698.94 |
| 23 | rs645088 | 46708.89 |
| 24 | rs649224 | 46710.649 |
| 25 | rs654136 | 46716.191 |
| 26 | rs685373 | 46732.828 |
| a | rs674965 | 46744.48 |
| 27 | rs2027735 | 46757.401 |
| 28 | rs620898 | 46761.135 |
| 29 | rs2156010 | 46789.476 |
| b | rs4390682 | 46804.44 |
| c | rs10502913 | 46820.258 |
| 30 | rs3764465 | 46823.359 |
| 31 | rs3764466 | 46823.474 |
| d | rs2276163 | 46827.376 |
| 32 | rs2298617 | 46855.39 |
| 33 | rs2282543 | 46945.582 |
| 34 | rs1893379 | 46970.523 |
| 35 | rs1893378 | 46970.847 |
Note.— See table A1 of appendix A (online only) and appendix B (online only) for further information regarding SNP primers and laboratory conditions.
SNPs a–d were added for analysis of the LD region; see text for details.
SNPs centromeric to D18S474 showed strong and consistent evidence of allelic (as opposed to genotypic [see below]) association in both case-control (fig. 1) and family-based (fig. 2) association studies. For the informative loci between rs674351 and rs654136, the SNPs in the region of malic enzyme 2 (ME2) and its putative promoter, the P values from the case-control association analysis ranged from .010 to .0001.
Figure 1.
Evidence for association of adolescent-onset IGE on chromosome 18. The graph shows the χ2 based on the case-control analysis for each SNP tested in this region, which is just centromeric to marker D18S474. There appear to be two peaks, the first of which occurs directly over the promoter and locus for ME2. The second occurs in a region of no known genes that exhibits evidence of strong marker-marker disequilibrium. ME2 is located between SNP locations 200 and 300. The origin of the X-axis in figures 1–3 is the first SNP (rs3752087), which is located at position 46442.427 kb. SNP numbers are given next to each data point.
Figure 2.
Evidence for association in IGE, from family-based association analysis rather than case-control analysis. SNP numbers are given next to each data point.
One of the most important questions in the genetics of IGE involves phenotype definition. Results of our previous linkage analysis (Durner et al. 2001) suggested that most families with the forms of adolescent-onset IGE we studied showed linkage to D18S474. However, whereas JME is genetically linked to chromosome 6, other forms of IGE are not (Greenberg et al. 1995; Durner et al. 1999). We thus performed separate association analyses for JME versus non-JME (non-JME = combined JAE + EGTCS). Both subsets of patients showed the same pattern of association as we saw in the total IGE results, with strong consistent associations with the SNPs in the ME2 region, as well as with SNPs just telomeric to ME2 (fig. 3).
Figure 3.
Evidence for association in two separate diagnostic groups with adolescent-onset IGE: JME (left) and non-JME (right) IGE. Non-JME IGE consists of the two groups: JAE and EGTCS. There were 88 JME cases and 68 JAE + EGTCS cases. The results shown are for case-control analysis. SNP numbers are given next to each data point. Results (not shown) for family-based association were similar for JME, but the sample size for non-JME was not sufficiently large to reach significance.
We then asked whether there was a specific haplotype in the ME2 region that was more prevalent in probands with IGE than in controls. Including only individuals whose haplotype probability was >0.9, we inferred haplotypes for probands and controls in the IGE data set for a nine-SNP-long haplotype covering a 76-kb region encompassing ME2 and the three SNPs just centromeric to it (table 2). (These latter three SNPs lie in or near the putative promoter region of ME2, in a region where there are no known genes and few ESTs [AI024301, BX115263, and AW182546]). Because the original linkage analysis supported recessive inheritance (Greenberg and Berger 1994; Durner et al. 2001), we examined the frequency of homozygotes carrying the nine-SNP haplotype versus other genotypes. (We note that, unlike haplotyping heterozygous haplotype alleles by use of case-control data, haplotyping homozygotes is without ambiguity, because there is only one type of base at each locus of the haplotype.) We identified homozygotes for this haplotype and compared the odds of disease in homozygotes with that for any other genotype. We found that 35% of cases were homozygous for the nine-SNP haplotype, compared with 8% of controls. The χ2 for the case-control association was 30 (1 df; P<.0001). The odds of disease, given homozygosity, was 6.1 times the odds for any other genotype (95% CI 2.9–12.7).
Table 2.
Bases of the Inferred Nine-SNP Haplotype Located in the Promoter Region and within the ME2 Locus That Had the Highest Probability in Patients versus Controls[Note]
| SNP Name | Base |
| rs674351 | A |
| rs584087 | A |
| rs585344 | C |
| rs608781 | A |
| rs642698 | G |
| rs674210 | A |
| rs645088 | C |
| rs649224 | C |
| rs654136 | A |
Note.— The haplotype was found in 81% of patients and 60% of controls. When present homozygously, it was found in 35% of patients and 8% of controls.
Telomeric to the maximum indication of association at the ME2 locus is a second peak suggesting allelic association. We investigated the marker-marker LD in this region (fig. 4) and found an ∼200-kb region of strong LD that ends just centromeric to the start of the ME2 locus. We also investigated the homozygous haplotype association evidence of this peak and compared the results with those in the ME2 region. To make this analysis comparable to the ME2 region analysis, we typed four more SNPs in this region (SNPs a–d in table 1, to bring the total to seven). The region spanned by this seven-SNP haplotype is 10 kb shorter than that spanned by the nine-SNP haplotype over ME2. Thus, the ME2 region has a larger SNP haplotype and has less marker-marker LD, circumstances that, compared with the LD region, should decrease the frequency of homozygotes. In fact, we observed that, in the LD region, 16% of patients were homozygous for the seven-SNP haplotype, versus 3% of controls—a difference of 13%, compared with a 27% difference between homozygotes among cases and controls over the ME2 region. The odds of disease for a carrier of two copies of this seven-SNP haplotype is 5.96 (95% CI 2.03–17.5; P=.001); this CI is wider than that for ME2 and represents more variability in the estimate of the odds ratio.
Figure 4.
Graph of marker-marker LD in the studied region. The colors correspond to the LD measure D′, with red showing the strongest evidence for LD and blue the weakest. The promoter region of ME2 begins just after SNP rs1822459; ME2 ends at about SNP rs654136. Note that LD appears to become most pronounced starting just after the ME2 locus. We suggest that the second peak in association evidence seen in figures 1–3 is due to the LD with ME2 and not to an independent disease association. The plot uses all SNPs listed in table 1.
The homozygote haplotype analyses support the conclusion that the ME2 region, and not the nearby LD region, contains the IGE-related gene. The meaning of this second peak, therefore, remains unclear. The second peak could be the result of the block of LD extending into the ME2 region in a subset of patients, creating a “shadow” peak. There are two known genes in that region telomeric to ME2: MADH4 (MIM 600993), thought to be a transcription factor related to cancer, and ELAC1 (MIM 608079), possibly a tumor-suppressor locus. Neither appears related to brain structure or function.
It is also significant that the results of both the haplotype analysis and the original linkage analysis supported recessive inheritance. Enzyme-related diseases tend to show recessive inheritance. Since ME2 is an enzyme, the observation of recessiveness lends added support to the idea that ME2 is the IGE locus in this region.
A previous genetic study of the IGE syndrome JME suggested, in part, recessive inheritance for an IGE gene (Greenberg et al. 1988a). The results of a segregation analysis involving JME (Greenberg et al. 1988a) supported an oligogenic inheritance model, suggesting that at least two epistatically interacting loci were responsible for JME susceptibility. The best-fitting model was one in which one locus was dominantly inherited and one recessively inherited. In an oligogenic model, the gene frequencies of the disease alleles must be high if the population prevalence is at all appreciable, because disease-related alleles must be present at several loci; hence, the proposed high frequency (60%) of the nine-SNP haplotype is predictable. We previously reported evidence that the BRD2 locus on chromosome 6 is EJM1, the gene that predisposes to a common form of JME (Pal et al. 2003), and the linkage analysis and analysis of SNPs and haplotypes of BRD2 supported dominant inheritance (Greenberg et al. 1988b, 2000; Durner et al. 1991; Weissbecker et al. 1991). Thus, the results of both linkage analysis and allelic and genotypic association studies of families with JME and other IGE syndromes have identified two loci that follow the prediction of the segregation analysis.
How do these results help explain the observations of the phenotypic overlap and co-occurrence of different IGE syndromes within families? According to the hypothesis of Durner et al. (2001), the variety of seizure types seen in families with IGE is explained by genes that are specific for different seizure types (rather than IGE syndromes), genes that may interact (either directly or indirectly) with a more general epilepsy susceptibility locus. Supporting this hypothesis is (1) suggestive evidence of linkage to chromosome 8 for families identified through patients with absence and/or tonic-clonic seizures (but without myoclonus) (Durner et al. 1999), (2) evidence of a locus on chromosome 5 that conveys susceptibility to absence seizures (Durner et al. 2001), (3) the chromosome 6 locus predisposing to myoclonic seizures (but not to JAE or EGTCS) (Greenberg et al. 1995), and (4) the identification of ME2 as the likely locus that conveys overall IGE susceptibility.
ME2 is a nuclear genome-coded enzyme that localizes in the mitochondria and is expressed in the brain. Its primary function appears to be reversibly catalyzing NADP- and NADPH (nicotinamide adenine dinucleotide phosphate)–dependent oxidative decarboxylation of malate to pyruvate and carbon dioxide. However, it also is indirectly involved in the synthesis of γ-aminobutyric acid (GABA) in neurons, in that it supplies a perhaps critical pool of pyruvate for GABA synthesis (Hassel 2001). The connection of GABA to epilepsy susceptibility is compelling. GABA is the main inhibitory neurotransmitter in the CNS, and many antiepilepsy drugs are known to modulate the GABA neurotransmitter system (Meldrum 1982). Mutations in GABA receptors play a role in susceptibility to some forms of epilepsy (Baulac et al. 2001), and GABA is involved in modulation of spike-wave activity (Lang et al. 1996). ME2 activity is reported to be highly enriched in mitochondria from cortical synaptic terminals, compared with mitochondria from cerebellar or cultured cortical neurons (McKenna et al. 2000), and it may also be involved in the glutamate cycle in neurons (Hassel and Brathe 2000). The finding that ME2, an enzyme related to GABA synthesis, is strongly linked to and associated with IGE suggests that disruptions in GABA synthesis in the brain may change the overall threshold of cortical excitability, allowing other mechanisms to trigger specific types of seizures, types determined by malfunctions in other genes. This would explain the observed variety of IGE syndromes, with their overlapping symptoms and multiple seizure types, as well as the occurrence of different IGE syndromes and seizure types within the same family.
The BRD2 locus has been suggested as playing a strong role in a common form of JME. Both the BRD2 locus and ME2 have been shown to be linked and associated with JME, but their functions suggest no obvious interaction. BRD2 is thought to interact directly with H4 histones during DNA transcription (Kanno et al. 2004). The nature of both of these proteins is so fundamental to cell functioning that it suggests that the mechanisms leading to IGE may be quite subtle and may operate during brain development.
Although there have been a number of reports of loci linked to the phenotype of IGE (Charlier et al. 1998; Escayg et al. 2000; Cossette et al. 2002; Kananura et al. 2002; Haug et al. 2003), they are almost exclusively linkage analyses of single or a few large pedigrees with autosomal dominant inheritance; with multiple affected members, sometimes with phenotypes not typical of IGE; and with forms of epilepsy variant to the classically described syndromes. Such families are atypical of the inheritance patterns observed in families of the common IGEs seen in clinics. The loci and the putative mutations identified at those loci have not been shown to influence the common IGEs.
This report presents analysis of an IGE locus based on data from families collected specifically for common forms of IGE, in a genomic region previously identified through linkage analysis. The linkage and association evidence suggests that ME2 is a major susceptibility locus for IGE. If confirmed, it may suggest that a general susceptibility to adolescent-onset IGE could be due to a disruption in GABA synthesis, which sets the stage for a second insult to trigger seizures.
Acknowledgments
Our thanks to the families participating in the New York Epilepsy Project. We also want to express our most grateful thanks to other dedicated neurologists who graciously referred families to our study: Alan M. Aron, MD; Gregory K. Bergey, MD; Karen Ballaban-Gil, MD; Blaise Bourgeois, MD; Carol Eisenberg, MBChB, MD; Edward S. Gratz, MD; Eric B. Geller, MD; Steven L. Kugler, MD; Daniel Luciano, MD; David E. Mandelbaum, MD, PhD; Joseph Maytal, MD; Gerold Novak, MD; David Rosenbaum, MD; Gail Solomon, MD; Sibylle A. Wallace, MD; and Steven M. Wolf, MD. This study was supported, in part, by National Institutes of Health grants NS27941, MH48858, and DK31775 (to D.A.G.) and grant NS37466 (to M.D.); by a Royal Society–Fulbright Distinguished Postdoctoral Scholarship; and by grants from the Dunhill Medical Trust and the Epilepsy Foundation of America (to D.K.P.).
Appendix A
Table A1.
SNP Primers and Conditions
| SNP Number (Locus) and Name | Primer and Oligo Template Sequences | Product Size(bp) | Variant | Annealing Temperature(°C) | Annealing Time(s) |
| 1 (MAPK4): | |||||
| rs3752087-ampF | CATCGCCAGTGTCTATGGGTATGACCTC | ||||
| rs3752087-ampR | TCGTACACTTTGACGATGTTGTCGTGGT | ||||
| rs3752087-snpF | GTCAATGGTTTGGTGCTGTCGGCC | 225 | A/G | 68 | 45 |
| 2 (MAPK4): | |||||
| rs3892158-ampF | GGGCCTCGGTGCATAAGTGTTGAATAAT | ||||
| rs3892158-ampR | TTTCAGGAGAAAACGGAAAAGGATTTGA | ||||
| rs3892158-snpF | CTCCCTCTCAGAGGGTGTTTTCAGT | 280 | C/T | 68 | 45 |
| 3 (MAPK4): | |||||
| rs1370484-ampF | GGCCTGTTAAAAGAGCATCTGAAATGAGAC | ||||
| rs1370484-ampR | ACCCTGACTTTGGGAAAGGTCTTTTTGG | ||||
| rs1370484-snpF | TGTGGGCACTTCAAAAGTGGTGTATCT | 203 | G/T | 68 | 45 |
| 4 (Genomic): | |||||
| rs4940007-ampF | CTGGTGAGACCTGGTGTCCATATTGTGA | ||||
| rs4940007-ampR | TTACAAAGGGGTCGACTTCAGATGGATG | ||||
| rs4940007-snpR | ACGGGTGGGTATTTTTAGGTAGTTGGTTC | 208 | T/C | 68 | 45 |
| 5 (Genomic): | |||||
| rs1470325-ampF | ATTCTGTTGCAGGCTCATGCTTTTTCTG | ||||
| rs1470325-ampR | CCCCAGACCCTCTTTCCCACTCTAATCT | ||||
| rs1470325-snpF | CTCAATGGTGTGGCTGTTAAGGGCTAGAG | 231 | A/G | 68 | 45 |
| 6 (Genomic): | |||||
| rs1954882-ampF | TCATATACCAAGACACAGCAGAGGGTGA | ||||
| rs1954882-ampR | GCGATTAGATGTCAGGCTCCTGGAATAG | ||||
| rs1954882-snpF | GTAGGAAGAATCAGTTAAGGAAAAGCTCA | 229 | C/T | 66 | 45 |
| 7 (B29): | |||||
| rs2276186(x3)-ampF | CCTGTAAATGGATCAGGAGGGAATCTCG | ||||
| rs2276186(x3)-ampR | GTGTTCTGATTGACGGCTGTGATGTGTT | ||||
| rs2276186(x3)-snpF | GTGAAAAATTTTTTCCATTTCCTCCC | 247 | A/G | 68 | 45 |
| 8 (B29): | |||||
| rs2849233(x1)-ampF | AAGCCCATTTTGATTTCAATAACCCAGAA | ||||
| rs2849233(x1)-ampR | CCTCGACCTGCTGGTGTATGGACTGTAT | ||||
| rs2849233(x1)-snpF | GTCATCTAATAAAGTCCTGGTCTGAAGGG | 207 | C/T | 68 | 45 |
| 9 (B29): | |||||
| rs2255672-ampF | AGAGACCTGGGTGATGGGTCAAAAATGT | ||||
| rs2255672-ampR | TGCCCTCTTTCTCCATCAATTTCTTCGT | ||||
| rs2255672-snpF | TCTCCTACTAAAGACGGCTGGGTTTTGT | 207 | C/T | 68 | 45 |
| 10 (B29): | |||||
| rs2586775-ampF | ACAGTGCTATGGTGGCTATCCTTTGTGT | ||||
| rs2586775-ampR | TCCCCACTCCATTCTGCAGATTTCTTTT | ||||
| rs2586775-snpR | GTTTTTAAAAGTTCTCTGAGAATGTAAATC | 287 | G/A | 68 | 45 |
| 11 (B29): | |||||
| rs2218369-ampF | ACCAAGCATGTTTTTTGACTCTATGTG | ||||
| rs2218369-ampR | GTACAGTGTAGCTTCTCTCCAGAATAAAGG | ||||
| rs2218369-snpF | CCACTTATAAGTGAGAACATGAGAACATGC | 401 | A/G | 68 | 45 |
| 12 (B29): | |||||
| rs2586770-ampF | CCGGGGAATTCTGATATAGAAGGTGCAA | ||||
| rs2586770-ampR | AGAACTGAGTGGCTCCACCTGGAAGATT | ||||
| rs2586770-snpF | GAAGGTGCAACCAACACTGAGAAATGCT | 227 | C/T | 68 | 45 |
| 13 (B29): | |||||
| rs2849239-ampF | GTTTGCAAAAGCAGATGGGAGTCAGTGT | ||||
| rs2849239-ampR | ACTCATCTCTGCACACGTTCTTCAACGA | ||||
| rs2849239-snpF | AGGTAGAGCACAACCTGGCAATGAA | 225 | C/T | 68 | 45 |
| 14 (Genomic): | |||||
| rs2586760-ampF | CCACAACTAGCCATATGGGCACTTCCTT | ||||
| rs2586760-ampR | GACCCAGGACCAAGAATGCTTTGAATTT | ||||
| rs2586760-snpR | CAAATTATGGCAATCCATCTTCCTTTTG | 207 | T/C | 68 | 45 |
| 15 (Genomic): | |||||
| rs2586761-ampF | ATCAGGTGAAGAATGCACCAATGCCTAA | ||||
| rs2586761-ampR | AAGCCCCTGCTTCAGAAAACACTTGAAC | ||||
| rs2586761-snpF | CTCCCTACACCAAAACAGAGGATACAC | 224 | C/G | 68 | 45 |
| 16 (Genomic): | |||||
| rs1822459-ampF | TGAGTAAATTACAGCCAAATGCATGGAG | ||||
| rs1822459-ampR | GACCTGTCAAAATGCTCTTTCTGTGCTT | ||||
| rs1822459-snpR | GAGATGTCACCTACTCCATGGGCTTCA | 157 | G/A | 66 | 45 |
| 17 (Genomic): | |||||
| rs674351-ampF | TGGGTTAGGTGGGTGTCTCTTCTTTGTG | ||||
| rs674351-ampR | CAGAGAGGTGAAGAGAGGTGGGAGACAG | ||||
| rs674351-snpF | CCTGAGTAGCTGGATTACGGGCAT | 426 | A/G | 69 | 45 |
| 18 (Genomic): | |||||
| rs584087-ampF | CCAAATGTTCTTCTCGTGGCCGTTAGTT | ||||
| rs584087-ampR | GTGGTTCAAGTGCAAGGAAGGAAAGACA | ||||
| rs584087-snpR | TTCCTTTGGATGCCTGTTAATCAGGAA | 210 | C/T | 69 | 45 |
| 19 (Genomic): | |||||
| rs585344-ampF | TCAAGGACAAATTCTAATCTCAGCTCTTCA | ||||
| rs585344-ampR | TGTCAACACTGAGTGATTTGCACAATAAAA | ||||
| rs585344-snpR | TAAAGCTCCCTGGTGATTCCAGTGTGC | 330 | G/A | 66 | 45 |
| 20 (ME2): | |||||
| rs608781-ampF | GTCTAGTTTGTCTGAAATTCACCAAAATCA | ||||
| rs608781-ampR | GGCTATGCTTCTGTAGAAATATTCTCTTGAG | ||||
| rs608781-snpR | ACCATTTGGGAACTTCTTTTGTAAAATTAAAAACTTA | 273 | T/C | 67 | 45 |
| 21 (ME2): | |||||
| rs642698-ampF | TATTTTCCCTGATAGTGGGAAACAAACG | ||||
| rs642698-ampR | TCATCTATGTTTGGTTCGGTGGACAAGT | ||||
| rs642698-snpF | CAATAAACTCAATGTATCCTCTTGCAA | 248 | G/T | 67 | 45 |
| 22 (ME2): | |||||
| rs674210-ampF | TTTTTGTGCTGCAAGAAGACCTGCTAGA | ||||
| rs674210-ampR | TGCTGTTTTTAGATATGGCCGGAACACA | ||||
| rs674210-snpF | AATGTTTAAAAAGTAGGAATCAAAACCCT | 261 | A/G | 68 | 45 |
| 23 (ME2): | |||||
| rs645088-ampF | TGGCATAGAATTTTGACTAGTCGTCACCTG | ||||
| rs645088-ampR | CTGCCTCCCTGCCCATTTAACTCAATAA | ||||
| rs645088-snpF | CTTCAGAATAAGAATATACTATTATCATTAAAA | 250 | C/T | 68 | 45 |
| 24 (ME2): | |||||
| rs649224(X)-ampF | GTTGCTCAGTTCAGTCTCCCATTCCAAA | ||||
| rs649224(X)-ampR | TGAATTCACCTCAATTTTCTCATCCACAGA | ||||
| rs649224(X)-snpF | CTCGCCCATCTGTAAGTTTCACTGGC | 264 | C/T | 68 | 45 |
| 25 (ME2): | |||||
| rs654136-ampF | CAATTTCATAACACTGTGCCTTGATGTGC | ||||
| rs654136-ampR | TCACCTAAAAAGAGAGCAAAGGACAGGAGA | ||||
| rs654136-snpF | CTTGTTCCCTGACATTTATATTTTCTGAT | 255 | A/G | 68 | 45 |
| 26 (Genomic): | |||||
| rs685373-ampF | CCCCCTTCATCACAAAATCAACATAGTC | ||||
| rs685373-ampR | CTTGATCTCTTGGGAATGTATTGTTGGA | ||||
| rs685373-snpR | TTGTTGAGCTCCCTACCCTATTCCTCT | 245 | T/C | 66 | 45 |
| a (Genomic): | |||||
| rs674965-AmpF | GAGGGATCTGGGTTGCATGCTTCTTAT | ||||
| rs674965-AmpR | ACAAAGCATTGAACACTGGAACTTGGAC | ||||
| rs674965-snpF | TATGCCCACCCCCTGCTCCCAAGGAAAA | 277 | A/G | 67 | 45 |
| 27 (ELAC1): | |||||
| rs2027735-ampF | ACTGATGGTGATGTCCTGGACCTAGAGA | ||||
| rs2027735-ampR | GTACACCTTGCCACCTCAACTCCTACTG | ||||
| rs2027735-snpF | AGGCACAGGCCAGAGTAGAGACTTGA | 289 | T/C | 68 | 45 |
| 28 (ELAC1): | |||||
| rs620898-ampF | TGAACCCAAAATTGCCTTTTAAGGACTC | ||||
| rs620898-ampR | CAGACTGAAAGGAAGAATGGACCCAAGT | ||||
| rs620898-snpF | ACTGAGAAGGAAGGTGGGCAACAGA | 273 | A/T | 68 | 45 |
| 29 (Genomic): | |||||
| rs2156010-ampF | AAAGACCATTTTTAGGCATGTTTTGCAG | ||||
| rs2156010-ampR | TGGATTGTGACTATTCTACTTACCAAGATGG | ||||
| rs2156010-snpF | TCCTAATTCATAACATATGGATATTAAATA | 244 | A/G | 66 | 45 |
| b (Genomic): | |||||
| rs4390682-AmpF | GAGAATGATTGAGGAGAGGACATGCAAC | ||||
| rs4390682-AmpR | ATCACAATCACTCTTACACATGCCCTCA | ||||
| rs4390682-snpF | GTTCATGGTGATGAAATTAAAGTGAA | 281 | A/G | 67 | 45 |
| c (MADH4): | |||||
| rs10502913-AmpF | TGTCCTATCCCTTCTCCTGCCATTTAAG | ||||
| rs10502913-AmpR | AAATGAGGGAGCATGGAAAGTTCATAGG | ||||
| rs10502913-snpF | GCATAGACTAGCCAATCCTGACTGATAC | 258 | A/G | 67 | 45 |
| 30 (MADH4): | |||||
| rs3764465-ampF | CAGCATGTGTATTAATGTGGGCAAGTGCT | ||||
| rs3764465-ampR | CCCATTCTCCCTGCCACTGTTGTAGTTT | ||||
| rs3764465-ampR | TCCCTCTGTTGTTATCTCTTTCACATAA | 191 | G/A | 68 | 45 |
| 31 (MADH4): | |||||
| rs3764466-ampF | AACAACAGAGGGAGGAGCAAGTCTTCAA | ||||
| rs3764466-ampR | GGAAGCTTTGCAAAAGATCTCTGACGTG | ||||
| rs3764466-snpF | GTGGCAGGGAGAATGGGAGGAGAGA | 192 | G/T | 68 | 45 |
| d (MADH4): | |||||
| rs2276163-AmpF | ATAAATTTGGAAGATAGCCCGCGACTTT | ||||
| rs2276163-AmpR | TCATGAACCATTTCAATTCAGAAGTAGCA | ||||
| rs2276163-snpR | TTAGCAGTCAAAATATAAGTTTGTTCCTAA | 249 | G/A | 67 | 45 |
| 32 (MADH4): | |||||
| rs2298617-ampF | TCCAATTCTGAAATTGAAATATGCTTTCCT | ||||
| rs2298617-ampR | CCTATGACCCTGTTTGCATTCTTTTTGT | ||||
| rs2298617-snpF | ATAATAAGCATCAACAAAAAAGGAGGAGAT | 208 | A/G | 66 | 45 |
| 33 (Genomic): | |||||
| rs2282543-ampF | GCCTTGAGACGGTGCTGCTTAATCTC | ||||
| rs2282543-ampR | CGAAGCTGGACAATTTCCTCTCCTGA | ||||
| rs2282543-snpF | GCAGGTAAGCACTTTAAGAACACAGCAT | 211 | G/T | 68 | 45 |
| 34 (LOC51320): | |||||
| rs1893379-ampF | TGGGAAATGAAGTGGTAATTCAAGGGTGT | ||||
| rs1893379-ampR | GGCAAAAGTATTCAAAACCAAATCAGCAA | ||||
| rs1893379-snpR | CTAACAGACTAACACAAATACTTGGTTCCCT | 246 | G/A | 68 | 45 |
| 35 (LOC51320): | |||||
| rs1893378-ampF | TGGTGTCTGTACTACCCACAAGGCACAG | ||||
| rs1893378-ampR | CCCCACCCATTTGCAAAAACAATTACAG | ||||
| rs1893378-snpR | TGTACTACAAATGACAGTAAATTTTTAGCT | 249 | G/A | 68 | 45 |
Appendix B: Laboratory Procedures and Quality Control
SNP Amplification
SNPs were detected using the instructions in the AcycloPrime-FP SNP Detection Kit (Perkin Elmer Life Sciences). The technique initially PCR amplifies an ∼200-bp fragment containing the SNP. This is followed by degradation of the unincorporated dNTPs and primers by incubation with shrimp alkaline phosphatase and Escherichia coli exonuclease 1, followed by the denaturation of these enzymes after incubation. The final step involves single base extension of an oligonucleotide adjacent to the SNP with the addition of one of two fluorescent dNTPs corresponding to the SNP to be typed.
Amplification Conditions
All amplification reactions were performed in 96-well microtiter plates by use of the Perkin Elmer Gene Amp PCR system 9600 or 9700. The PCR consisted of the final concentrations of 0.2 mM dNTP, 20 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.25 μM each primer, 0.5 U of Platinum Taq DNA polymerase (Invitrogen), 10 ng of template DNA and water, to a total volume of 5 μl. The amplification conditions included an initial denaturation cycle at 96°C for 1 min; followed by 37 cycles of denaturation at 96°C for 10 s and annealing for 45 s at 65–70°C, depending on the primers used; and an extension cycle at 72°C for 1 min. This was followed by a single extension cycle at 72°C for 7 min.
SNP Calling
Single-base extension products were read on the Criterion Analyst AD of LJL Biosystems. Each reaction was read twice: once through use of R110 and once through use of Tamra light filters. Parallel and perpendicular emission intensities, as well as milli polarization (mP) for each reading, were recorded with instrument software. mP values corresponding to each well ID were output as a text file, and these data were analyzed using a clustering program to identify genotype clustering
Quality-Control Procedures
The percentage error of duplicate experiments depends on the SNP used. Generally, experiments were duplicated only if the clustering in the TAMRA versus R110 fluorescent-polarization incorporation scatterplots were not absolutely clear. When they were not clear, only the data from the good experimental set was used. Comparison of two such data sets generally gave ∼5% genotype calling error. Identical results were obtained with good data sets. At the end of each series of experiments, all uncertain genotypes of each different SNP were collected together and regenotyped. The number of samples to be genotyped at the end of this series was so small that these were left as blanks. Because we also typed family members for family-based association studies, samples could be checked for non-Mendelian errors. Where possible, non-Mendelian errors were corrected by using new DNA and regenotyping the family. In the few cases in which the Mendelian errors remained, those individuals were removed.
Electronic-Database Information
The URLs for data presented herein are as follows:
- dbSNP Home Page, http://www.ncbi.nlm.nih.gov/SNP/
- D. Clayton's Web site, http://www-gene.cimr.cam.ac.uk/clayton/software/ (for TRANSMIT)
- Online Mendelian Inheritance in Man (OMIM), http://www.ncbi.nlm.nih.gov/Omim (for IGE, JME, JAE, MADH4, and ELAC1)
References
- Abecasis GR, Cookson WO (2000) GOLD—graphical overview of linkage disequilibrium. Bioinformatics 16:182–183 10.1093/bioinformatics/16.2.182 [DOI] [PubMed] [Google Scholar]
- Annegers JF (1994) Epidemiology and genetics of epilepsy. Neurol Clin 12:15–29 [PubMed] [Google Scholar]
- Baulac S, Huberfeld G, Gourfinkel-An I, Mitropoulou G, Beranger A, Prud’homme JF, Baulac M, Brice A, Bruzzone R, LeGuern E (2001) First genetic evidence of GABAA receptor dysfunction in epilepsy: a mutation in the γ2-subunit gene. Nat Genet 28:46–48 10.1038/88254 [DOI] [PubMed] [Google Scholar]
- Beck-Mannagetta G, Janz D (1991) Syndrome-related genetics in generalized epilepsy. Epilepsy Res Suppl 4:105–111 [PubMed] [Google Scholar]
- Charlier C, Singh NA, Ryan SG, Lewis TB, Reus BE, Leach RJ, Leppert M (1998) A pore mutation in a novel KQT-like potassium channel gene in an idiopathic epilepsy family. Nat Genet 18:53–55 10.1038/ng0198-53 [DOI] [PubMed] [Google Scholar]
- Clayton D, Jones H (1999) Transmission/disequilibrium tests for extended marker haplotypes. Am J Hum Genet 65:1161–1169 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Commission on Classification and Terminology of the International League Against Epilepsy (1989) Proposal for revised classification of epilepsies and epileptic syndromes. Epilepsia 30:389–399 [DOI] [PubMed] [Google Scholar]
- Cossette P, Liu L, Brisebois K, Dong H, Lortie A, Vanasse M, Saint-Hilaire JM, Carmant L, Verner A, Lu WY, Wang YT, Rouleau GA (2002) Mutation of GABRA1 in an autosomal dominant form of juvenile myoclonic epilepsy. Nat Genet 31:184–189 10.1038/ng885 [DOI] [PubMed] [Google Scholar]
- Durner M, Keddache MA, Tomasini L, Shinnar S, Resor SR, Cohen J, Harden C, Moshe SL, Rosenbaum D, Kang H, Ballaban-Gil K, Hertz S, Labar DR, Luciano D, Wallace S, Yohai D, Klotz I, Dicker E, Greenberg DA (2001) Genome scan of idiopathic generalized epilepsy: evidence for major susceptibility gene and modifying genes influencing the seizure type. Ann Neurol 49:328–335 10.1002/ana.69.abs [DOI] [PubMed] [Google Scholar]
- Durner M, Sander T, Greenberg DA, Johnson K, Beck-Mannagetta G, Janz D (1991) Localization of idiopathic generalized epilepsy on chromosome 6p in families of juvenile myoclonic epilepsy patients. Neurology 41:1651–1655 [DOI] [PubMed] [Google Scholar]
- Durner M, Zhou G, Fu D, Abreu P, Shinnar S, Resor SR, Moshe SL, Rosenbaum D, Cohen J, Harden C, Kang H, Wallace S, Luciano D, Ballaban-Gil K, Klotz I, Dicker E, Greenberg DA (1999) Evidence for linkage of adolescent-onset idiopathic generalized epilepsies to chromosome 8—and genetic heterogeneity. Am J Hum Genet 64:1411–1419 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Escayg A, MacDonald BT, Meisler MH, Baulac S, Huberfeld G, An-Gourfinkel I, Brice A, LeGuern E, Moulard B, Chaigne D, Buresi C, Malafosse A (2000) Mutations of SCN1A, encoding a neuronal sodium channel, in two families with GEFS+2. Nat Genet 24:343–345 10.1038/74159 [DOI] [PubMed] [Google Scholar]
- Greenberg DA, Abreu PC (2001) Determining trait locus position from multipoint analysis: accuracy and power of three different statistics. Genet Epidemiol 21:299–314 10.1002/gepi.1036 [DOI] [PubMed] [Google Scholar]
- Greenberg DA, Berger B (1994) Using lod-score differences to determine mode of inheritance: a simple, robust method even in the presence of heterogeneity and reduced penetrance. Am J Hum Genet 55:834–840 [PMC free article] [PubMed] [Google Scholar]
- Greenberg DA, Delgado-Escueta AV, Maldonado H, Widelitz H (1988a) Segregation analysis of juvenile myoclonic epilepsy. Genet Epidemiol 5:81–94 [DOI] [PubMed] [Google Scholar]
- Greenberg DA, Delgado-Escueta AV, Widelitz H, Sparkes RS, Treiman L, Maldonado HM, Park MS, Terasaki PI (1988b) Juvenile myoclonic epilepsy (JME) may be linked to the BF and HLA loci on human chromosome 6. Am J Med Genet 31:185–192 [DOI] [PubMed] [Google Scholar]
- Greenberg DA, Durner M, Delgado-Escueta AV (1992) Evidence for multiple gene loci in the expression of the common generalized epilepsies. Neurology 42:56–62 [PubMed] [Google Scholar]
- Greenberg DA, Durner M, Keddache M, Shinnar S, Resor SR, Moshe SL, Rosenbaum D, Cohen J, Harden C, Kang H, Wallace S, Luciano D, Ballaban-Gil K, Tomasini L, Zhou G, Klotz I, Dicker E (2000) Reproducibility and complications in gene searches: linkage on chromosome 6, heterogeneity, association, and maternal inheritance in juvenile myoclonic epilepsy. Am J Hum Genet 66:508–516 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Greenberg DA, Durner M, Resor S, Rosenbaum D, Shinnar S (1995) The genetics of idiopathic generalized epilepsies of adolescent onset: differences between juvenile myoclonic epilepsy and epilepsy with random grand mal and with awakening grand mal. Neurology 45:942–946 [DOI] [PubMed] [Google Scholar]
- Hassel B (2001) Pyruvate carboxylation in neurons. J Neurosci Res 66:755–762 10.1002/jnr.10044 [DOI] [PubMed] [Google Scholar]
- Hassel B, Brathe A (2000) Neuronal pyruvate carboxylation supports formation of transmitter glutamate. J Neurosci 20:1342–1347 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Haug K, Warnstedt M, Alekov AK, Sander T, Ramirez A, Poser B, Maljevic S, Hebeisen S, Kubisch C, Rebstock J, Horvath S, Hallmann K, Dullinger JS, Rau B, Haverkamp F, Beyenburg S, Schulz H, Janz D, Giese B, Muller-Newen G, Propping P, Elger CE, Fahlke C, Lerche H, Heils A (2003) Mutations in CLCN2 encoding a voltage-gated chloride channel are associated with idiopathic generalized epilepsies. Nat Genet 33:527–532 10.1038/ng1121 [DOI] [PubMed] [Google Scholar]
- Kananura C, Haug K, Sander T, Runge U, Gu W, Hallmann K, Rebstock J, Heils A, Steinlein OK (2002) A splice-site mutation in GABRG2 associated with childhood absence epilepsy and febrile convulsions. Arch Neurol 59:1137–1141 10.1001/archneur.59.7.1137 [DOI] [PubMed] [Google Scholar]
- Kanno T, Kanno Y, Siegel RM, Jang MK, Lenardo MJ, Ozato K (2004) Selective recognition of acetylated histones by bromodomain proteins visualized in living cells. Mol Cell 13:33–43 10.1016/S1097-2765(03)00482-9 [DOI] [PubMed] [Google Scholar]
- Lang EJ, Sugihara I, Llinas R (1996) GABAergic modulation of complex spike activity by the cerebellar nucleoolivary pathway in rat. J Neurophysiol 76:255–275 [DOI] [PubMed] [Google Scholar]
- McKenna MC, Stevenson JH, Huang X, Tildon JT, Zielke CL, Hopkins IB (2000) Mitochondrial malic enzyme activity is much higher in mitochondria from cortical synaptic terminals compared with mitochondria from primary cultures of cortical neurons or cerebellar granule cells. Neurochem Int 36:451–459 10.1016/S0197-0186(99)00148-5 [DOI] [PubMed] [Google Scholar]
- Meldrum B (1982) Pharmacology of GABA. Clin Neuropharmacol 5:293–316 [DOI] [PubMed] [Google Scholar]
- Pal DK, Evgrafov OV, Tabares P, Zhang F, Durner M, Greenberg DA (2003) BRD2 (RING3) is a probable major susceptibility gene for common juvenile myoclonic epilepsy. Am J Hum Genet 73:261–270 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Weissbecker KA, Durner M, Janz D, Scaramelli A, Sparkes RS, Spence MA (1991) Confirmation of linkage between juvenile myoclonic epilepsy locus and the HLA region of chromosome 6. Am J Med Genet 38:32–36 [DOI] [PubMed] [Google Scholar]