Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2025 Apr 3;15(5):111. doi: 10.1007/s13205-025-04269-7

Ellipticine targets FGFR3 to mediate the RAS/MAPK-P38 signalling pathway to induce apoptosis in hepatocellular carcinoma cells

Deng Ling 1,✉, Chen Xiang 2, Hu Guolin 1, Song Huisheng 1, Niu Xiaohua 2,✉
PMCID: PMC11968639  PMID: 40191451

Abstract

This study aimed to investigate the toxic effects of ellipticine on liver cancer cells and predict its anti-liver cancer mechanism through network pharmacology, especially by targeting FGFR3 to regulate the RAS/MAPK-P38 signaling pathway, thereby inducing apoptosis of liver cancer cells. The inhibitory effect of ellipticine on the proliferation of HepG2, Huh-7, SMMC7721, BEL-7402, SK-HEP-1, LX-2, and MHCC97H cells was detected by CCK-8 assay, and the IC50 value was calculated. The potential targets of ellipticine were predicted by the database, and the intersection analysis with liver cancer-related targets was performed to construct a protein interaction network (PPI), (KEGG) pathway enrichment analysis, and molecular docking verification. FGFR3 in HepG2 cells was knocked down by siRNA, and the effects on cell proliferation, apoptosis, and ROS levels were observed. The expression changes of FGFR3, RAS, P38, and their phosphorylated forms after ellipticine treatment, as well as the effects of RAS agonist ML-908 and P38 inhibitor PD169316 on cell proliferation, apoptosis, and migration, were detected by Western blotting. Ellipticine has an inhibitory effect on all tested liver cancer cell lines, among which HepG2 has the strongest inhibitory effect, with an IC50 of 5.15 ± 0.25 μM. Ellipticine is predicted to have 32 potential targets, and 5 common targets among the 225 targets related to liver cancer, including PDGFRA, KIT, FGFR3, ERBB2, and STAT3. KEGG analysis showed that these targets are mainly involved in cancer pathways. Molecular docking showed that Ellipticine can bind strongly to FGFR3. FGFR3 expression is highest in HepG2 cells. After knocking down FGFR3, the proliferation ability of HepG2 cells is further weakened, and the addition of apoptosis inhibitor ZVAD can partially restore the proliferation ability. ROS levels increase after Ellipticine treatment, and ROS levels further increase after knocking down FGFR3, and ZVAD treatment can reduce ROS levels. After Ellipticine treatment, the expression levels of FGFR3, RAS, and p-P38 decrease. Ellipticine-induced cell proliferation inhibition and apoptosis were reversed by RAS agonist ML-908, whereas P38 inhibitor PD169316 exacerbated cell apoptosis and migration inhibition. Ellipticine induces apoptosis of liver cancer cells by targeting FGFR3 and inhibiting the RAS/MAPK-P38 signaling pathway. This discovery provides new mechanistic insights into Ellipticine as a liver cancer treatment and may lay the foundation for the development of targeted therapeutic strategies.

Keywords: Ellipticine, FGFR3, RAS, MAPK-P38, Hepatocellular carcinoma cells

Introduction

Liver cancer is a common malignant tumor, ranking third in the causes of cancer-related deaths worldwide and sixth in incidence. According to the 2022 Global Cancer Statistics, the annual number of new cases of liver cancer is approximately 865,000, and the number of deaths is approximately 758,000, accounting for 7.8% of cancer-related deaths in the same year (Bray et al. 2022; Mishra et al. 2023a). The main subtypes of liver cancer include hepatocellular carcinoma, intrahepatic cholangiocarcinoma, and hepatocellular carcinoma combined with cholangiocarcinoma, and hepatocellular carcinoma is the most common pathological type of the three. Common treatments for liver cancer are mainly surgical treatment and drug therapy (Anwanwan et al. 2020; Shi et al. 2018). Surgical treatment is only suitable for patients with early liver cancer without metastasis. Since most liver cancer patients are diagnosed in the middle and late stages, they miss the best time for surgical treatment. The emergence of drug resistance limits the clinical efficacy of liver cancer drugs (Chen et al. 2019; Liu et al. 2017). Although there are multiple treatment options for patients with hepatocellular carcinoma, the high recurrence and metastasis rates result in low postoperative survival rates for patients. Therefore, it is urgent to find effective drugs to inhibit liver cancer metastasis.

In the history of the human struggle against diseases, drugs of natural origin have provided the basis for the traditional treatment of various diseases and useful weapons for the chemotherapy of malignant tumors (Gu et al. 2022; Fong and Chu 2022). Ellipticine is naturally present in the leaves of Ochrosia elliptica Labill., the bark and leaves of O. balansae and O. moorei, all plants of the Apocynaceae family (Kouadio et al. 1984; Wen et al. 2017). Ellipticine has anti-tumor and anti-AIDS activities (Sappati et al. 2016). It has growth-inhibitory effects on many tumor cells such as leukemia, melanoma, sarcoma, lymphoma, colon cancer, lung cancer, breast cancer, brain tumor, osteosarcoma, neuroblastoma (Rouëssé et al. 1993; Lu et al. 2008; Kuo et al. 2006; Martinkova et al. 2009; Mishra et al. 2023b, 2023c). The anti-tumor activity of ellipticine is mainly due to its high efficiency, low side effects, and low endogenous toxicity (Auclair 1987). Ellipticine can regulate the progression of the tumor cell cycle and induce apoptosis in many tumors. Its mechanism of action mainly includes DNA intercalation, inhibition of topoisomerase, covalent alkylation of macromolecules, and induction of endoplasmic reticulum stress (Martinkova et al. 2010; Maroufi et al. 2020). In addition, RAS genes are a group of important oncogenes that encode small GTPases and are involved in the signal transduction of cell growth, division, and survival (Lim and Leprivier 2019). The p38 MAPK signaling pathway plays an important role in a variety of biological processes, including cell proliferation, apoptosis, inflammatory response, and cell response to environmental stress (Wang et al. 2024). Previous studies have shown that RAS/MAPK-P38 signaling has received much attention in the field of liver cancer (Rezatabar et al. 2019; Sun et al. 2022). However, few studies are showing the role and mechanism of ellipticine in liver cancer.

Network pharmacology was first proposed by Andrew L Hopkins (2007). It is based on the theories of systems biology and other disciplines. It uses large-scale data, bioinformatics, and computer technologies to reveal complex biological network relationships between drugs, genes, targets, and diseases (Chen et al. 2021). On this basis, it analyzes, predicts, and explains the mechanism of action of drugs and seeks highly effective and low-toxic drugs (Gocho et al. 2021). For identified drugs, the multiple molecular networks and interaction networks constructed by network pharmacology can not only more accurately predict targets, but also comprehensively and systematically explore their effects (Nam et al. 2020).

Based on this, this paper predicted the effect of Ellipticine targeting FGFR3 (fibroblast growth factor receptor 3) to mediate the RAS/MAPK-P38 on apoptosis and migration of liver cancer cells through network pharmacology. Based on network pharmacology, bioinformatics, molecular docking, CCK-8, flow cytometry, protein immunoblotting, and other experiments, the mechanism of Ellipticine inhibiting liver cancer was revealed, providing a theoretical basis for subsequent development and utilization.

Materials and methods

Cell culture and grouping

All cell lines were provided by the National Collection of Authenticated Cell Cultures. Hepg2 (DMEM, BI, Israel), Huh-7 (DMEM, BI, Israel), SMMC7721 (RPMI-1640, BI, Israel), and BEL-7402 (RMPI-1640, BI, Israel), SK-HEP-1 (MEM, BI, Israel), and MHCC97H (DMEM, BI, Israel) were cultured with the corresponding medium plus 10% FBS (BI, Israel) and grown in cell incubators (37 °C, 5% CO2).

First, CCK-8 was used to detect the IC50 of 50 μM, 25 μM, 10 μM, 5 μM, 1 μM, 100 nM, and 10 nM Ellipticine (HY-15753, MCE) on Hepg2, Huh-7, SMMC7721, BEL-7402, SK-HEP-1, LX-2, and MHCC97H. Then RT-qPCR was used to determine the expression of FGFR3 in Hepg2. In addition, the inhibitors Ferrostatin-1 (Fer-1, HY-100579, MCE), Z-VAD-FMK (Zvad, HY-16658B, mce), and Necrostatin (Nec-1,HY-15760, MCE) were co-administered with Ellipticine to explore the cell death pathway induced by Ellipticine in Hepg2 cells. Furthermore, silencing FGFR3 was used to verify the regulation of apoptosis inhibitors on the effect of Ellipticine on Hepg2 viability and ROS by CCK-8 and flow cytometry. Next, cck-8, flow cytometry, and cell migration experiments were used to explore the effects of RAS agonist ML-908 (1 μM, HY-19800, MCE) and P38 inhibitor PD169316 (2 μM, HY-10578, MCE) on Ellipticine. Lastly, western blost was used to verify the effects of 2.5 μM, 5 μM, and 10 μM ellipticine on FGFR3, RAS, P38, and p-P38 proteins.

CCK-8 assay

Hepg2 (2 × 104cells/well) were seeded into 96-well plates and cultured for 24 h. Then, the cells were incubated with Ellipticine, RAS agonist ML-908 or P38 inhibitor PD169316 for 24 h. The cell vitality of Hepg2 was determined by CCK-8 (Thermo Fisher Scientific) as directed by the manufacturer. Absorbance was recorded at 450 nm.

Network pharmacology prediction

The chemical structure of Ellipticine was obtained from PubChem (https://pubchem.ncbi.nlm.nih.gov/), and the target of Ellipticine was predicted in Swiss Target Prediction (http://www.swisstargetprediction.ch/), and the targets with higher scores were screened. Ellipticine targets with “Probability*” greater than 0.1 were retained. Then, based on the GeneCards (https://www.genecards.org/) database, we used “liver cancer” as the keyword to search for targets related to liver cancer. Disease targets and compound targets were uploaded to the Calculate and draw custom Venn diagrams website (http://bioinformatics.psb.ugent.be/webtools/Venn/) for data analysis to obtain a common set of targets.

Next, the drug prediction targets and disease intersection targets were analysed for Protein–Protein Interaction Networks (PPI) using the String database (https://string-db.org/). Select Multiple Proteins by Names/Identities on the STRING webpage, use the spacebar to distinguish different targets, set the species to Homosapiens, and set Mesiumconfidenc ≥ 0.7. Then, iGEMDOCK software was used to perform molecular docking of Ellipticine and FGFR3 (PDB: 3GRW) and to analyze binding energy. Based on the Metascape (http://metascape.org/gp/index.html) database, KEEG pathway signaling pathway enrichment analysis was performed on drug prediction targets and disease intersection targets. The KEEG pathway signaling pathway and GO enrichment analysis were performed. Entries with a p-value ≤ 0.05 were screened out.

Transfection assay

The siRNA transfection was carried out according to the instruction of lipofectamine2000™ (Carlsbad, CA). One microliter of the transfection reagent was diluted with 50 µL serum-free medium and incubated at room temperature for 5 min. Diluted siRNA mixed with diluted transfection reagent was incubated at room temperature for 20 min to form the RNA-liposome complexes (50 ng/mL). A hundred microliters of RNA-liposome complexes were directed to each well of the cell culture plate and the plate was then incubated at 37 °C, with 5% CO2 for 24 ~ 48 h. The siRNAs (NM_001354810.2) were synthesized from GenePharma (Shanghai, China) (Table 1).

Table 1.

Sequence of siRNA

si-RNA Sequence (5′ → 3′)
si-FGFR3 (1#) GGCAATTCTATTGGGTTTTCTCA
si-FGFR3(2#) GAGCCTTTACCTTTTATGCAAAA
Open in a new tab

RT-qPCR experiments

Total cellular RNA in Hepg2 cells was extracted by Trizol Total RNA Extraction Kit (TaKaRa, Japan), and reverse transcribed into cDNA by Reverse Transcription Kit (TaKaRa, Japan). SYBR Premix Ex TaqTM II kit (TaKaRa, Japan) was used to detect the expression of FGFR3, and the results were analyzed by relative quantification according to the ddCT method, and the average Ct value of each sample was calculated, and the relative mRNA expression level was expressed by 2−ddCt. The primer sequences used in this study are as follows: FGFR3 Forward Primer 5′-CCACCAGGATGAACAGGAAGAA-3′, FGFR3 Reverse Primer 5′-GCGGGCAGTGTGTATGCA-3′; β-actin Forward Primer 5′-CTGGTGCTGTCTGCGCTG-3′, β-actin Reverse Primer 5′-CTGGGTTTCGTCTTTCTGG-3′. These primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

Wound healing assay to detect the healing ability

Hepg2 cells were inoculated in 24-well plates (Nest, China) at a density of 2 × 105 cells/well, and when cell fusion reached 90% or higher, a vertical scratch was made in the center of the plate with a 10 μl gun tip, and the suspended cells were washed three times with PBS to remove the scratch, before being placed in an incubator (37 °C, 5% CO2) for further incubation. The scratch distance was calculated using ImageJ software after photographing the scratch area at 0 and 24 h after the scratch. The migration distance equals the mean distance between the initial scratches minus the mean distance between the scratches after 24 h of cell culture.

Flow cytometry ROS detection

Hepg2 cells were seeded in 6-well plates according to group 2, with 2 × 105 cells per well. After the cells adhered to the wall, the drugs were administered according to group 2, with 3 replicates per group. After the cells were administered, the cells were collected and washed twice with PBS. The probe was added to the cells to make a 500 μL cell suspension containing 5 mol/L DCFH-DA (S0033S, Beyontime). The reaction was carried out at 37 ℃ in the dark for 30 min, and the cells were washed twice with PBS after centrifugation. The FITC channel was selected to detect the changes in ROS between different groups, and the cell optical density detected by the FITC channel was used as a quantitative indicator of ROS changes.

Flow cytometry apoptosis experiment

Hepg2 cells in the logarithmic growth phase were taken, the cell density was adjusted to 2 × 105 cells/well, and 2 mL/well was inoculated in a 6-well plate and cultured at 37 °C and 5% CO2. According to group 2, the supernatant was aspirated into the corresponding numbered centrifuge tube for use, the cells were washed once with PBS, and the supernatant was aspirated. Digested with trypsin (without ethylenediaminetetraacetic acid, EDTA), and waited for the cytoplasm to shrink. The cells were no longer connected into pieces, added the collected cell supernatant was to stop digestion and collected in the corresponding centrifuge tube, centrifuged at 250 g for 5 min, aspirated the supernatant, added an appropriate amount of PBS was for washing and transferred the suspension to a 1.5 mL conical EP tube, centrifuged at 250 g for 5 min, aspirated the supernatant, and obtained the cell pellet. After resuspending the cells with 500 μL of Binding Buffer, 5 μL of Annexin V-APC (40311ES20, YEASEN, China) was added and gently blown to mix well, and then 5 μL of PI (40311ES20, YEASEN, China) was added and mixed well; the reaction was allowed to react at room temperature in the dark for 15 min, and the apoptosis of cells in each group was analyzed by the instrument.

Western blot experiment

Total protein was extracted from Hepg2 cells using RIPA (RIPA Lysis Buffer) lysis buffer, and the protein concentration was determined using a BCA kit. Proteins were separated by 10% SDS-PAGE gel electrophoresis and transferred to a PVDF membrane. The PVDF membrane was blocked in 5% skim milk at room temperature for 1 h. Then the following primary antibodies were added: FGFR3 primary antibody (1:1000, ab10651, Abcam), RAS primary antibody (1:1000, ab108602, Abcam), P38 primary antibody (1:1000, #9212, Cell signaling TECHNOLOGY), p-P38 primary antibody (1:2000, #9211, cell signaling TECHNOLOGY), β-actin primary antibody (1:50,000, AC026, abclona), and then incubated overnight at 4 °C. Subsequently, a biotinylated secondary antibody (1:8000, BA1001, Wuhan Boster Biological Technology, Ltd.) was added and incubated at room temperature for 1 h. Finally, the protein bands were detected using an ECL analysis kit, and the optical density values were analyzed. The relative protein expression level was calculated as the optical density value of the target protein divided by the optical density value of β-actin.

Statistical analysis

All data are expressed as x¯ ± s. The t-test was used to analyze the differences between two independent samples, and p < 0.05 was considered statistically different. One-way (ANOVA) was used for groups of 3 or more. Statistical analysis was performed using Graph Pad Prism5 software.

Results

Ellipticine inhibits the proliferation of hepatocellular carcinoma cells

To detect the toxicity of Ellipticine on liver cancer cells, Hepg2, Huh-7, SMMC7721, BEL-7402, SK-HEP-1, and MHCC97H were used in this study. As shown in Fig. 1A–F, Ellipticine has the effect of inhibiting the proliferation of liver cancer cells, with IC50 of 5.15 ± 0.25 μM for Hepg2, 10.20 ± 0.31 μM for Huh-7, 11.32 ± 0.56 μM for SMMC7721, 7.82 ± 0.79 μM for BEL-7402, 13.22 ± 0.29 μM for SK-HEP-1, 14.69 ± 0.56 μM for MHCC97H, and 25.33 ± 0.17 μM for LX-2. The above experimental results show that Ellipticine can inhibit the proliferation of liver cancer cells for 24 h and has the strongest cytotoxicity to Hepg2 cells.

Fig. 1.

Fig. 1

Open in a new tab

Toxicity of Ellipticine to Hepatocellular Carcinoma Cells. IC50 of Ellipticine against Hepg2 (A), Huh-7 (B), SMMC7721 (C), BEL-7402 (D), SK-HEP-1 (E), MHCC97H (F), and LX-2 (G)

Network pharmacology predicts the anti-hepatocellular carcinoma mechanism of Ellipticine

Ellipticine is a cytotoxic alkaloid composed of indole and isoquinoline (Fig. 2A). There are 32 predicted targets for ellipticine (Fig. 2B) and 225 targets for liver cancer (Fig. 2C). Through the Venn diagram, we found that ellipticine and liver cancer have five targets in common, namely PDGFRA, KIT, FGFR3, ERBB2, and STAT3 (Fig. 2D). As shown in Fig. 2E, the PPI network shows the regulatory relationship between PDGFRA, KIT, FGFR3, ERBB2, and STAT3. FGFR3 is highly expressed in liver cancer cells, and its expression level is closely related to the malignancy and prognosis of liver cancer (Fearon et al. 2021). Among them, molecular docking revealed that Elipticine can bind strongly to FGFR3 (−9.2 kJ/mol) (Fig. 2F). KEGG enrichment analysis of these five targets revealed central carbon metabolism in cancer, EGFR tyrosine kinase inhibitor resistance, and Pathways in cancer. According to the prediction results, Ellipticine’s targets FGFR3 and Pathways in cancer need more attention next.

Fig. 2.

Fig. 2

Open in a new tab

Exploration of the potential mechanism of ellipticine’s inhibition of liver cancer. A Chemical structure of ellipticine. B Predicted targets of ellipticine. C Targets of liver cancer. D Venn diagram of ellipticine and liver cancer targets. E PPI of common targets of ellipticine and liver cancer. F Molecular docking of ellipticine and FGFR. G KEGG of common targets of ellipticine and liver cancer

Ellipticine induces apoptosis of liver cancer cells via FGFR3

As shown in Fig. 3A, among the liver cancer cells Hepg2, Huh-7, SMMC7721, BEL-7402, SK-HEP-1, and MHCC97H, FGFR3 is expressed most highly in Hepg2, so Hepg2 was selected as the research object. The IC50 of ellipticine against Hepg2 after 24 h treatment is 5.15 ± 0.25 μM, and the IC50 of ellipticine against Hepg2 after 48 h treatment is 4.56 ± 0.38 μM (Fig. 3B). To further explore the cell death model of Ellipticine on hepatocellular carcinoma cells, the inhibitors Zvad, Fer-1, and Nec-1 were co-administered with Ellipticine. It was found that Zvad significantly inhibited the cell death of hepatocellular carcinoma cells caused by Ellipticine (Fig. 3C), which advanced apoptosis of AC on hepatocellular carcinoma cells. In addition, FGFR3 was silenced to verify the effect of Ellipticine on apoptosis. si-FGFR3(1#) had a better silencing effect (Fig. 3D) and was used for mechanism study. Compared with the control group, the proliferation ability of Hepg2 cells was weakened after Ellipticine treatment. Compared with Ellipticine, the proliferation ability of Hepg2 cells was further weakened after si-FGFR3 treatment (Fig. 3E). As shown in Fig. 3F, compared with the Ellipticine + si-FGFR3 group, the apoptosis inhibitor ZVAD promoted the proliferation ability of Hepg2. ROS can cause DNA chain breaks and induce cell apoptosis. Compared with the control group, ROS was enhanced after Ellipticine treatment and further enhanced after si-FGFR3 treatment, while Zvad inhibited the intensity of ROS (Fig. 3G, H). The above experiments suggest that Ellipticine can induce apoptosis of liver cancer cells through FGFR3.

Fig. 3.

Fig. 3

Open in a new tab

Ellipticine induces apoptosis of hepatocellular carcinoma cells via FGFR3. A Expression of FGFR3 in hepatocellular carcinoma cells. B IC50 of Ellipticine on Hepg2 cells at 24 h and 48 h. C Reverse effect of the inhibitors Zvad (10 μM), Fer-1 (10 μM), Nec-1 (10 μM) on Ellipticine-induced death of hepatocellular carcinoma cells. D Silencing effect of si-FGFR3. E Effect of Ellipticine on Hepg2 cell inhibition after silencing FGFR3. F Effect of silencing FGFR3 on the action of apoptosis inhibitor ZVAD. G, H: Effect of Ellipticine on ROS. * Compared with the control group, ***p < 0.001. # Compared with the Ellipticine group, # p < 0.05 and ###p < 0.001. @ Compared with ellipticine + si-FGFR3, @ p < 0.05

Ellipticine induces apoptosis of hepatocellular carcinoma cells via RAS/MAPK-P38

Compared with the control group, the proliferation ability of Hepg2 cells was weakened after Ellipticine treatment; compared with Ellipticine, the proliferation ability of Hepg2 cells was enhanced after RAS agonist ML-908 treatment (Fig. 4A). In addition, compared with the control group, the apoptosis of Hepg2 cells increased after Ellipticine treatment; compared with Ellipticine, the apoptotic cells decreased after ML-908 treatment (Fig. 4B, C). The scratch test showed that compared with the control group, the migration ability of Hepg2 cells was weakened after Ellipticine treatment; compared with Ellipticine, the migration ability of Hepg2 cells was increased after ML-908 treatment (Fig. 4D, E). Regarding the MAPK-P38 pathway, compared with Ellipticine, the proliferation ability of Hepg2 cells was further weakened after the treatment of P38 inhibitor PD169316 (Fig. 4F). In addition, compared with the control group, the apoptosis of Hepg2 cells increased after Ellipticine treatment; compared with Ellipticine, the apoptotic cells increased after PD169316 treatment (Fig. 4G and H). At the same time, compared with Ellipticine, the migration ability of Hepg2 cells was weakened after PD169316 treatment (Fig. 4I, J).

Fig. 4.

Fig. 4

Open in a new tab

A Effect of RAS agonist ML-908 on the proliferation of Hepg2 cells treated with Ellipticine. B, C Effect of ML-908 on the apoptosis of Hepg2 cells treated with Ellipticine by flow cytometry. D, E Effect of ML-908 on the migration of Hepg2 cells treated with Ellipticine. F Effect of MAPK-P38 inhibitor PD169316 on the proliferation of Hepg2 cells treated with Ellipticine. G, H Effect of PD169316 on the apoptosis of Hepg2 cells treated with Ellipticine by flow cytometry. I, J Effect of PD169316 on the migration of Hepg2 cells treated with Ellipticine. * Compared with the control group, ***p < 0.001. # Compared with the Ellipticine group, # p < 0.05, ## p < 0.01, and ###p < 0.001

Effects of Ellipticine on FGFR3/RAS/MAPK-P38 signalling pathway

To further verify the mechanism of Ellipticine inducing liver cancer cells, 2.5, 5, and 10 μM Ellipticine was used to treat Hepg2 for 24 h to observe the changes in FGFR3, RAS, P38, and p-P38 proteins. Protein detection results showed that compared with the control group, 2.5, 5, and 10 μM Ellipticine could inhibit the expression of FGFR3, RAS, p-P38, and p-P38/P38 in a dose-dependent manner, and the total P38 protein did not change. These experimental results indicate that Ellipticine can target FGFR3 and inhibit the RAS/MAPK-P38 signaling pathway in Hepg2 cells (Fig. 5).

Fig. 5.

Fig. 5

Open in a new tab

Effects of Ellipticine on FGFR3, RAS, P38, and p-P38 proteins. A Representative protein bands of FGFR3, RAS, P38, and p-P38 after 24 h treatment of Hepg2 cells with 2.5, 5, and 10 μM Ellipticine. Relative expression of FGFR3 (B), RAS (C), P38 (D), p-P38 (E), and p-P38/P38 (F) after 24 h treatment of Hepg2 cells with Ellipticine. *p < 0.05 and ***p < 0.001 compared with the control group

Discussion

Most liver cancer patients are diagnosed at an advanced stage and are accompanied by tumor metastasis, which is the main cause of death in liver cancer patients (Fu and Wang 2018). For patients with advanced liver cancer who have metastasized, systemic therapy (chemoradiotherapy, sorafenib, etc.) is the main treatment. Small molecule targeted therapy has been a hot topic in recent years (Thumpati et al. 2025). However, radiotherapy has great toxic side effects, and the clinical efficacy of traditional chemotherapy drugs (5-fluorouracil, cisplatin, doxorubicin gemcitabine, etc.) is poor (Chen et al. 2019). Sorafenib is only beneficial to about 30% of liver cancer patients, and these patients often develop acquired drug resistance within 6 months (Cheng et al. 2009; Yau et al. 2020). Therefore, the development of potential anti-metastatic drugs for liver cancer is of great research significance. This article explores the mechanism of action of the drug Ellipticine in inhibiting cell proliferation and inducing cell apoptosis in hepatocellular carcinoma. Through experimental and network pharmacology analysis, it was revealed that Ellipticine induces apoptosis of hepatocellular carcinoma by targeting FGFR3 and regulating the RAS/MAPK-P38 signaling pathway.

Previous studies have reported that ellipticine has a growth inhibitory effect on a variety of tumor cells, with a half inhibitory concentration (IC50) ranging from 1 × 10−10 to 1 × 10−6 mol·L−1 (Isah 2016). In this study, ellipticine showed a significant inhibitory effect on the proliferation of a variety of liver cancer cell lines (Hepg2, Huh-7, SMMC7721, BEL-7402, SK-HEP-1, MHCC97H) in vitro experiments. Hepg2 cells are most sensitive to ellipticine, with an IC50 value of 5.15 ± 0.25 μM, indicating that ellipticine is the most toxic to Hepg2 cells. However, the heterogeneity of the disease in different liver cancer patients may lead to uncertainty in clinical trial results. In the future, the activity of FGFR3 and RAS/MAPK-P38 pathways in liver cancer patients will be evaluated before treatment to provide patients with personalized treatment options. This stratified approach can optimize treatment effects and reduce unnecessary treatments. This result provides preliminary experimental evidence for ellipticine as a potential drug for the treatment of liver cancer.

On the premise of completing the in vitro anti-liver cancer activity of Ellipticine, we comprehensively predicted the potential targets of Ellipticine by integrating multiple databases and prediction tools, which helps to understand the characteristics of its multi-target action and provide a more complete explanation for its anti-tumor activity. Network pharmacology is an emerging research method that combines bioinformatics, systems biology, and pharmacology. It aims to reveal the multi-target mechanism of action of drugs by constructing and analyzing the network of complex interactions between drugs and biological systems (Zhao et al. 2023; Li et al. 2019). Ellipticine is predicted to have 5 common targets related to liver cancer: PDGFRA, KIT, FGFR3, ERBB2, and STAT3. Among these 5 targets, Ellipticine’s binding energy to FGFR3 has a higher score, and the role of FGFR3 in liver cancer is also clear (Fearon et al. 2021). FGFR3 is the key target for the interaction between Ellipticine and liver cancer cells. Further molecular docking experiments confirmed that Ellipticine can bind to FGFR3 with a high binding strength (−9.2 kJ/mol). KEGG pathway enrichment analysis showed that Ellipticine affected central carbon metabolism, EGFR tyrosine kinase inhibitor resistance, and cancer-related pathways through FGFR3. These results suggest that Ellipticine may exert its anti-hepatocellular carcinoma effect by regulating FGFR3 and its downstream signaling pathways.

Fibroblast growth factor receptor (FGFR) regulates various biological processes such as embryonic development, angiogenesis, cell proliferation and differentiation, and metabolic homeostasis (Kanai et al. 1997). Meanwhile, abnormalities in FGFR signaling such as gene amplification, activating mutations, and oncogenic fusions have been identified in a variety of cancers (Kikuchi et al. 2017; Jin et al. 2020). Specific abnormal high expression of FGFR3 exists in primary hepatocellular carcinoma, and its degree of expression is closely related to the malignancy of hepatocellular carcinoma (Fearon et al. 2021). Generally, overexpression of FGFR3 may promote cell growth and inhibit apoptosis (L’Hôte and Knowles 2005). Therefore, silencing FGFR3 may relieve this inhibition, allowing Ellipticine to induce apoptosis more effectively. In addition, under normal conditions, intracellular ROS levels are in a balanced state and are involved in physiological processes such as cellular signal transduction and gene expression regulation (Aredia et al. 2016). However, when ROS are overproduced or their removal ability is reduced, they can lead to oxidative stress, damage cellular components, trigger inflammatory responses, and even induce apoptosis or necrosis (Choi 2021). Ellipticine induces the production of ROS and cell apoptosis. The increase of ROS means the destruction of mitochondria, which is also a sign of apoptosis (Redza-Dutordoir and Averill-Bates 2016). Previous studies have also shown that alkaloid compounds can induce apoptosis in liver cancer cells involving mitochondrial destruction (Lai et al. 2022). In Hepg2 cells, the expression level of FGFR3 is the highest, so Hepg2 was selected as the research object. The experimental results showed that the IC50 values of Ellipticine after 24 h and 48 h of treatment were 5.15 ± 0.25 μM and 4.56 ± 0.38 μM, respectively, indicating that the inhibitory effect of Ellipticine on Hepg2 cells increased with time. Further studies found that Ellipticine induces DNA chain breaks by inducing the generation of ROS, thereby inducing cell apoptosis. Using the apoptosis inhibitor Zvad, it was found that cell death caused by Ellipticine was mainly through the apoptotic mechanism. In addition, by silencing the FGFR3 gene, it was found that the apoptosis-inducing effect of Ellipticine was further enhanced, indicating that FGFR3 plays an important role in the apoptosis process induced by Ellipticine.

The RAS/MAPK signaling pathway is a key pathway for regulating cell proliferation, survival, and migration (Bahar et al. 2023). Through FGFR3, Ellipticine also exerts its effects through the RAS/MAPK-P38 signaling pathway. Activated Ras can also enhance the motility and invasiveness of tumor cells by affecting cytoskeleton reorganization and the expression of intercellular adhesion molecules, which plays an important role in the distant metastasis of liver cancer (Murugan et al. 2019). Previous studies showed that the mechanisms of ellipticine antitumor, mutagenic and cytotoxic activities were suggested to be intercalation into DNA and inhibition of DNA topoisomerase II activity (Stiborova et al. 2006). In terms of inhibiting cell apoptosis, the continuous activation of the Ras signaling pathway can prevent the cell apoptosis process, allowing cells that should have undergone programmed cell death to survive, thereby promoting the formation and development of tumors (Feig and Buchsbaum 2002). Studies have shown that MAPK is highly expressed in a variety of tumors, including liver cancer. Excessive activation of the MAPK signaling pathway promotes tumor metastasis and is a key pathway for tumor treatment (Yao et al. 2021; Fu et al. 2022). Inhibiting the expression of the p38 protein or inhibiting its phosphorylation can enhance the adhesion between cancer cells and reduce their invasion and metastasis capabilities (Niu et al. 2022). After treatment with the RAS agonist ML-908, the proliferation inhibition effect of Ellipticine on liver cancer cells was weakened, while after treatment with the P38 inhibitor PD169316, the apoptosis-inducing effect of Ellipticine was enhanced. This suggests that the activation of the RAS/MAPK-P38 signaling pathway may be antagonistic. Further protein detection results showed that Ellipticine inhibited the expression of FGFR3, RAS, and p-P38 in a dose-dependent manner, but had no effect on the total P38 protein expression. This suggests that Ellipticine inhibits the activation of the RAS/MAPK-P38 signaling pathway by targeting FGFR3, thereby inducing apoptosis of liver cancer cells.

Conclusions

Ellipticine, as a cytotoxic alkaloid, induces apoptosis in hepatocellular carcinoma by targeting FGFR3 and inhibiting the RAS/MAPK-P38 signaling pathway. This discovery provides a theoretical basis for Ellipticine as a potential therapeutic drug for liver cancer and a new research direction for future clinical applications. However, the specific clinical efficacy and safety of Ellipticine still need to be verified by further in vivo experiments and clinical studies.

Author contributions

All authors participated in the experiments and writing of this study.

Funding

The open research funds from the Qingyuan Affiliated Hospital of Guangzhou Medical University, Qingyuan People’s Hospital (202301_203).

Availability of data and materials

The datasets used or analyzed during the current study are available from the corresponding author upon reasonable request.

Declarations

Conflict of interest

The authors declare that they have no competing interests.

Informed consent

N/A.

Research involving human participants and/or animals

This study did not involve animal experiments or human tissue.

Contributor Information

Deng Ling, Email: dar918ling@163.com.

Niu Xiaohua, Email: 2016390008@gzhu.edu.cn.

References

  1. Anwanwan D, Singh SK, Singh S et al (2020) Challenges in liver cancer and possible treatment approaches. Biochim Biophys Acta 1873(1):188314 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aredia F, Czaplinski S, Fulda S et al (2016) Molecular features of the cytotoxicity of an NHE inhibitor: evidence of mitochondrial alterations, ROS overproduction and DNA damage. BMC Cancer 16(1):851 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Auclair C (1987) Multimodal action of antitumor agents on DNA: the ellipticine series. Arch Biochem Biophys 259(1):1–14 [DOI] [PubMed] [Google Scholar]
  4. Bahar ME, Kim HJ, Kim DR (2023) Targeting the RAS/RAF/MAPK pathway for cancer therapy: from mechanism to clinical studies. Signal Transduct Target Ther 8(1):455 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bray F, Laversanne M, Sung H et al (2024) Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 74(3):229–263 [DOI] [PubMed] [Google Scholar]
  6. Chen S, Cao Q, Wen W et al (2019) Targeted therapy for hepatocellular carcinoma: challenges and opportunities. Cancer Lett 460:1–9 [DOI] [PubMed] [Google Scholar]
  7. Chen J, Li LF, Hu XR et al (2021) Network pharmacology-based strategy for elucidating the molecular basis forthe pharmacologic effects of licorice (Glycyrrhiza spp.). Front Pharmacol 12:590477 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cheng AL, Kang YK, Chen Z et al (2009) Efficacy and safety of sorafenib in patients in the Asia-Pacific region with advanced hepatocellular carcinoma: a phase III randomised, double-blind, placebo-controlled trial. Lancet Oncol 10(1):25–34 [DOI] [PubMed] [Google Scholar]
  9. Choi YH (2021) Trans-cinnamaldehyde protects C2C12 myoblasts from DNA damage, mitochondrial dysfunction and apoptosis caused by oxidative stress through inhibiting ROS production. Genes Genomics 43(4):303–312 [DOI] [PubMed] [Google Scholar]
  10. Fearon AE, Slabber CF, Kuklin A et al (2021) Fibroblast growth factor receptor 3 in hepatocytes protects from toxin-induced liver injury and fibrosis. iScience 24(10):103143 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Feig LA, Buchsbaum RJ (2002) Cell signaling: life or death decisions of ras proteins. Curr Biol 2(7):R259–R261 [DOI] [PubMed] [Google Scholar]
  12. Fong YD, Chu JJH (2022) Natural products as Zika antivirals. Med Res Rev 42(5):1739–1780 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Fu J, Wang H (2018) Precision diagnosis and treatment of liver cancer in China. Cancer Lett 412:283–288 [DOI] [PubMed] [Google Scholar]
  14. Fu D, Hu Z, Xu X et al (2022) Key signal transduction pathways and crosstalk in cancer: biological and therapeutic opportunities. Transl Oncol 26:101510 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gocho Y, Liu J, Hu J et al (2021) Network-based systems pharmacology reveals heterogeneity in LCK and BCL2 signaling and therapeutic sensitivity of T-cell acute lymphoblastic leukemia. Nat Cancer 2(3):284–299 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gu Y, Du Y, Jiang L et al (2022) αvβ3 integrin-specific exosomes engineered with cyclopeptide for targeted delivery of triptolide against malignant melanoma. J Nanobiotechnol 20(1):384 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hopkins AL (2007) Network pharmacology. Nat Biotechnol 25(10):1110–1111 [DOI] [PubMed] [Google Scholar]
  18. Isah T (2016) Anticancer alkaloids from trees: development into drugs. Pharmacogn Rev 10(20):90–99 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jin Z, Feng H, Liang J et al (2020) FGFR3(△7-9) promotes tumor progression via the phosphorylation and destabilization of ten-eleven translocation-2 in human hepatocellular carcinoma. Cell Death Dis 11(10):903 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kanai M, Göke M, Tsunekawa S et al (1997) Signal transduction pathway of human fibroblast growth factor receptor 3. Identification of a novel 66-kDa phosphoprotein. J Biol Chem 272(10):6621–6628 [DOI] [PubMed] [Google Scholar]
  21. Kikuchi A, Suzuki T, Nakazawa T et al (2017) ASP5878, a selective FGFR inhibitor, to treat FGFR3-dependent urothelial cancer with or without chemoresistance. Cancer Sci 108(2):236–242 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kouadio K, Chenieux JC, Rideau M et al (1984) Antitumor alkaloids in callus cultures of ochrosia elliptica. J Nat Prod 47(5):872–874 [DOI] [PubMed] [Google Scholar]
  23. Kuo YC, Kuo PL, Hsu YL et al (2006) Ellipticine induces apoptosis through p53-dependent pathway in human hepatocellular carcinoma HepG2 cells. Life Sci 78(22):2550–2557 [DOI] [PubMed] [Google Scholar]
  24. L’Hôte CG, Knowles MA (2005) Cell responses to FGFR3 signalling: growth, differentiation and apoptosis. Exp Cell Res 304(2):417–431 [DOI] [PubMed] [Google Scholar]
  25. Lai Q, Yang CJ, Zhang Q et al (2022) Alkaloid from Alstonia yunnanensis diels root against gastrointestinal cancer: acetoxytabernosine inhibits apoptosis in hepatocellular carcinoma cells. Front Pharmacol 13:1085309 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Li T, Baochen Z, Yue Z et al (2019) Network pharmacology-based identification of pharmacological mechanism of SQFZ injection in combination with Docetaxel on lung cancer. Sci Rep 9(1):4533 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lim JKM, Leprivier G (2019) The impact of oncogenic RAS on redox balance and implications for cancer development. Cell Death Dis 10(12):955 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Liu J, Liu Y, Meng L et al (2017) Synergistic antitumor effect of sorafenib in combination with ATM inhibitor in hepatocellular carcinoma cells. Int J Med Sci 14(6):523–529 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lu C, Wang W, El-Deiry WS (2008) Non-genotoxic anti-neoplastic effects of ellipticine derivative NSC176327 in p53-deficient human colon carcinoma cells involve stimulation of p73. Cancer Biol Ther 7(12):2039–2046 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Maroufi NF, Vahedian V, Akbarzadeh M et al (2020) The apatinib inhibits breast cancer cell line MDA-MB-231 in vitro by inducing apoptosis, cell cycle arrest, and regulating nuclear factor-κB (NF-κB) and mitogen-activated protein kinase (MAPK) signaling pathways. Breast Cancer (Tokyo, Japan) 27(4):613–620 [DOI] [PubMed] [Google Scholar]
  31. Martinkova E, Dontenwill M, Frei E et al (2009) Cytotoxicity of and DNA adduct formation by ellipticine in human U87MG glioblastoma cancer cells. Neuro Endocrinol Lett 30(Suppl 1):60–66 [PubMed] [Google Scholar]
  32. Martinkova E, Maglott A, Leger DY et al (2010) alpha5beta1 integrin antagonists reduce chemotherapy-induced premature senescence and facilitate apoptosis in human glioblastoma cells. Int J Cancer 127(5):1240–1248 [DOI] [PubMed] [Google Scholar]
  33. Mishra D, Mishra A, Rai SN et al (2023a) Identification of prognostic biomarkers for suppressing tumorigenesis and metastasis of hepatocellular carcinoma through transcriptome analysis. Diagnostics (Basel, Switzerland) 13(5):965 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Mishra D, Mishra A, Rai SN et al (2023b) In silico insight to identify potential inhibitors of BUB1B from mushroom bioactive compounds to prevent breast cancer metastasis. Front Biosci (Landmark Edition) 28(7):151 [DOI] [PubMed] [Google Scholar]
  35. Mishra D, Mishra A, Nand Rai S et al (2023c) Demystifying the role of prognostic biomarkers in breast cancer through integrated transcriptome and pathway enrichment analyses. Diagnostics (Basel, Switzerland) 13(6):1142 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Murugan AK, Grieco M, Tsuchida N (2019) RAS mutations in human cancers: roles in precision medicine. Semin Cancer Biol 59:23–35 [DOI] [PubMed] [Google Scholar]
  37. Nam HH, Kim JS, Lee J et al (2020) Pharmacological effects of agastache rugosa against gastritis using a network pharmacology approach. Biomolecules 10(9):1298 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Niu F, Yu Y, Li Z et al (2022) Arginase: an emerging and promising therapeutic target for cancer treatment. Biomed Pharmacother 149:112840 [DOI] [PubMed] [Google Scholar]
  39. Redza-Dutordoir M, Averill-Bates DA (2016) Activation of apoptosis signalling pathways by reactive oxygen species. Biochem Biophys Acta 1863(12):2977–2992 [DOI] [PubMed] [Google Scholar]
  40. Rezatabar S, Karimian A, Rameshknia V et al (2019) RAS/MAPK signaling functions in oxidative stress, DNA damage response and cancer progression. J Cell Physiol 234(9):14951–14965 [DOI] [PubMed] [Google Scholar]
  41. Rouëssé J, Spielmann M, Turpin F et al (1993) Phase II study of elliptinium acetate salvage treatment of advanced breast cancer. Eur J Cancer 29(6):856–859 [DOI] [PubMed] [Google Scholar]
  42. Sappati S, Hassanali A, Gebauer R et al (2016) Nuclear quantum effects in a HIV/cancer inhibitor: the case of ellipticine. J Chem Phys 145(20):205102 [DOI] [PubMed] [Google Scholar]
  43. Shi DM, Li LX, Bian XY et al (2018) miR-296-5p suppresses EMT of hepatocellular carcinoma via attenuating NRG1/ERBB2/ERBB3 signaling. J Exp Clin Cancer Res CR 37(1):294 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Stiborova M, Rupertova M, Schmeiser HH et al (2006) Molecular mechanisms of antineoplastic action of an anticancer drug ellipticine. Biomed Pap Med Facu Univ Palacky Olomouc Czechoslovakia 150(1):13–23 [DOI] [PubMed] [Google Scholar]
  45. Sun L, Xi S, Zhou Z et al (2022) Elevated expression of RIT1 hyperactivates RAS/MAPK signal and sensitizes hepatocellular carcinoma to combined treatment with sorafenib and AKT inhibitor. Oncogene 41(5):732–744 [DOI] [PubMed] [Google Scholar]
  46. Thumpati P, Rai SN, Prajapati C et al (2025) Targeting c-MYC G-quadruplexes for cancer treatment with small molecules. Sci Pharm. 93(1):6. 10.3390/scipharm93010006 [Google Scholar]
  47. Wang J, Liu Y, Guo Y et al (2024) Function and inhibition of P38 MAP kinase signaling: targeting multiple inflammation diseases. Biochem Pharmacol 220:115973 [DOI] [PubMed] [Google Scholar]
  48. Wen HL, Yang G, Dong QR (2017) Ellipticine inhibits the proliferation and induces apoptosis in rheumatoid arthritis fibroblast-like synoviocytes via the STAT3 pathway. Immunopharmacol Immunotoxicol 39(4):219–224 [DOI] [PubMed] [Google Scholar]
  49. Yao C, Kong F, Zhang S et al (2021) Long non-coding RNA BANCR promotes proliferation and migration in oral squamous cell carcinoma via MAPK signaling pathway. J Oral Pathol Med 50(3):308–315 [DOI] [PubMed] [Google Scholar]
  50. Yau T, Kang YK, Kim TY et al (2020) Efficacy and safety of nivolumab plus ipilimumab in patients with advanced hepatocellular carcinoma previously treated with sorafenib: the CheckMate 040 randomized clinical trial. JAMA Oncol 6(11):e204564 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zhao L, Zhang H, Li N et al (2023) Network pharmacology, a promising approach to reveal the pharmacology mechanism of Chinese medicine formula. J Ethnopharmacol 309:116306 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets used or analyzed during the current study are available from the corresponding author upon reasonable request.

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES