TGFBI regulates the TGF-β pathway to affect the malignant progression and cisplatin sensitivity in diffuse large B-cell lymphoma

Abstract

Despite the association between aberrant TGFBI expression and tumors development found in various cancer types, the role of TGFBI in diffuse large B-cell lymphoma (DLBCL) progression is not clear. This study attempted to reveal how TGFBI impacts malignant progression and cisplatin sensitivity in DLBCL. Bioinformatics and qRT-PCR were used to analyze expression of TGFBI. To investigate the effect of TGFBI on malignant progression and cisplatin sensitivity in DLBCL cells, cell viability and IC50 values were assessed by CCK-8. Cell proliferation ability was detected by colony formation assay. Cell apoptosis rate was detected by flow cytometry. The degree of DNA damage in cells from different treatment groups was detected by comet assay. Protein expression of TGF-β pathway-related proteins like TGF-β1, Smad2, and p-Smad2 was detected by western blot. Bioinformatics and molecular experiments results revealed substantial upregulation of TGFBI in DCBCL. Cell experiment results indicated that high TGFBI expression expedited DCBCL progression and reduced cisplatin sensitivity. Further rescue experiments revealed that SB525334, a TGF-β pathway inhibitor, could weaken the acceleration of DCBCL progression and restore reduced cisplatin sensitivity both induced by high TGFBI expression. TGFBI could promote malignant progression and inhibit the cisplatin sensitivity of DLBCL cells by regulating the TGF-β pathway. In brief, TGFBI has the potential to be a target in DLBCL treatment.

Supplementary Information

The online version contains supplementary material available at 10.1007/s00277-025-06208-1.

Introduction

As the most prevalent subtype of B-cell derived non-Hodgkin lymphoma (NHL), diffuse large B-cell lymphoma (DLBCL) accounts for around 24% of new NHL cases annually in the United States [1, 2]. This is an aggressive disease and patients usually present with rapidly enlarging lymphadenopathy and constitutional symptoms that require immediate treatment [2]. Although many patients achieve long-term remission with first-line treatment regimens such as rituximab, one-third of patients are refractory or relapse after initial remission [3]. Finding new therapeutic agents that enable better survival for patients suffering from refractory and relapsed DLBCL is of great significance. Initially approved by the Food and Drug Administration in testicular cancer treatment, cisplatin has since then been successfully applied in treatments of various cancers [4]. Currently, it is being used to treat patients with refractory and relapsed DLBCL. The 2-year progression-free and overall survival rates of refractory and relapsed DLBCL patients treated with gemcitabine, dexamethasone, and cisplatin were 21% and 28% respectively [5]. Although chemotherapy has greatly improved the survival rate of patients, the drug resistance caused by chemotherapy poses serious challenges in chemotherapeutic drugs application [4]. Hence, exploration of the molecular mechanism underlying cisplatin resistance in DLBCL emerged as necessary for better therapeutic effects.

TGFBI, also known as betaig-3, is an extracellular matrix protein induced by TGF-β [6]. Many reports have demonstrated the cancer-promoting role TGFBI plays in breast cancer [7] and non-small cell lung cancer [8] based on its known involvement in various physiological processes, including cell growth, morphogenesis, and differentiation [9]. As reported by Yeh et al. [10], niclosamide inhibits migration and invasion of human osteosarcoma cells by downregulating TGFBI through inhibition of ERK pathway. In colon cancer cells, Gao et al. [11]. found that miR-766-3p inhibit the malignant progression through TGFBI downregulation. As for ovarian cancer, the dual role of TGFBI has been revealed by Ween et al. [12]. On the one hand, low TGFBI expression in ovarian cancer cells promotes cancer cell apoptosis; on the other hand, its high expression in peritoneal cells promotes cancer cell migration. Insufficient acquired knowledge of TGFBI in DLBCL indicated that further studies are necessary for the sake of new diagnosis and treatment methods for DLBCL.

This study investigated the expression and biological function of TGFBI in DLBCL through bioinformatics and molecular experiments. Our study confirmed the significant upregulation of TGFBI in DLBCL. In addition, TGFBI could promote DLBCL cell proliferation and inhibit cisplatin sensitivity. It was also found that TGFBI promoted the malignant progression and inhibited the cisplatin sensitivity of DLBCL cells via the TGF-β pathway. TGFBI had the potential to be the target that facilitate DLBCL diagnosis and treatment.

Materials and methods

Bioinformatics analysis

The mRNA selected for study was determined through literature references and validated for gene differential expression on the Oncomine (https://www.oncomine.org/resource/login.html) and GEPIA (http://gepia.cancer-pku.cn/detail.php) websites. mRNA expression data for DLBC (normal: 33, tumor: 55) were downloaded from the Gene Expression Omnibus (GEO) database (accession number GSE56315). Differential analysis of mRNA between normal and tumor groups (logFC > 2, padjust < 0.05) was conducted using the ‘limma’ package to identify DEmRNAs, and the significance of mRNA differences between groups was confirmed using the “wilcox.test” test. mRNA data (FPKM) for DLBC (tumor: 48) were downloaded from The Cancer Genome Atlas (TCGA) database and standardized using the ‘limma’ package. Finally, Gene Set Enrichment Analysis (GSEA) software was used to perform Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis based on the median expression of target mRNA in TCGA and GEO datasets to explore the impact mechanism of the gene on DLBC.

Cell culture

DLBCL cell lines (U2932, TMD8, OCl-Ly3) were purchased from Otwo Biotech (China). Human B lymphocyte GM12878 was purchased from Yubo Bio (China). All cell lines were cultured in RPMI-1640 medium containing 10% fetal bovine serum (FBS) and 100 µg/L pen-strep at 37 ℃ and 5% CO₂[13].

Cell transfection

DLBCL cells were seeded in 6-well plates at 2 × 10⁵ cells per well and cultured for 24 h. DMSO and SB525334 (TGF-β signaling pathway inhibitor) were obtained from MCE (USA). si-TGFBI, oe-TGFBI, and negative controls purchased from Tolo Biotech (China) were transfected into DLBCL cells using Lipofectamine 3000 reagent according to the manuals. DLBCL cells were treated with 10 µmol/L SB525334.

qRT-PCR

Total RNA was extracted using the Ultrapure RNA kit (CwBio, China) according to the manuals. cDNA was formed by reverse transcription using HiFiScript cDNA Synthesis Kit (CwBio, China). qRT-PCR was performed on an ABI 7500 system (Applied Biosystems, USA) using the TB Green Premix Ex Taq II kit (TAKARA, Japan). TGFBI expression was normalized to GAPDH by the 2^−ΔΔCt method. The primer sequences (5’→3’) are as follows: TGFBI F: GTGCGGCTAAAGTCTCTCCA, R: AAGCCCTGGAAAACGCTGAT. GAPDH: F: CGAGCCACATCGCTCAGACA, R: GTGGTGAAGACGCCAGTGGA.

Western blot (WB)

The phosphorylation degree of TGF-β signaling pathway-related proteins in DLBCL cells was determined by WB. Briefly, total protein from cells was extracted using lysis buffer. Protein concentration in cells was determined with the bicinchoninic acid assay. The SDS-PAGE gel concentration was determined by the molecular weight of the protein of interest. Proteins were transferred onto PVDF membranes and incubated overnight at 4 ℃ with primary antibodies, followed by incubation with corresponding secondary antibody for 2 h at 37 ℃. Primary antibodies were rabbit anti-human TGF-β1 (ab215715, Abcam, UK), p-Smad2 (#3108, Cell signaling technology, USA), Smad2 (ab300079, Abcam, UK), and GAPDH (ab181602, Abcam, UK), and secondary antibody was horseradish peroxidase-labeled goat anti-rabbit IgG (ab7090, Abcam, UK). WB was performed by using enhanced chemiluminescence detection kits and analyzed using ImageJ [14].

CCK-8

DLBCL cells (1 × 10⁴) transfected with different vectors were seeded and cultured in 96-well plates for 0, 24, 48, 72 and 96 h. After adding CCK-8 reagent (10 µL/well) to the plate and 2 h of culture, optical density (OD) values were measured at 450 nm.

DLBCL cells in 96-well plates were treated with different concentrations of cisplatin (0, 1, 5, 10, 15, 20 µmol/L) and cultured for 48 h at 37 ℃ in a constant temperature incubator. RPMI-1640 medium containing 10 µl CCK-8 solution was added in the dark. OD values were measured and finally, IC50 values were calculated in each group using GraphPad Prism 8.0 (USA) [15].

Colony formation assay

U2932 and TMD8 cells transfected for 24 h were re-seeded in 6-well plates (500 cells/well). After 14 days, colonies were fixed with methanol and stained with crystal violet. The number of colonies was counted using the microscope [16].

Apoptosis

To detect the level of apoptosis, we used Annexin V-FITC/PI Apoptosis Kit (Liankebio, China). Briefly, cells collected from different groups were inoculated in 6-well plates at a density of 10⁶ cells/mL and incubated in a constant temperature incubator at 37℃ for 24 h. After incubation, cells were washed three times with PBS, and 5 µl of Annexin V-FITC or 10 µl of PI was added, and the cells were incubated for 15 min at room temperature away from light. Finally, the apoptosis level was detected by NovoCyte flow cytometry system (Agilent, USA), in which Annexin V-FITC was green fluorescence and PI was red fluorescence.

Comet assay

We used the comet assay to detect the level of cellular DNA damage. Briefly, cells after different transfections were immobilized on comet slides using low melting point agarose, lysed at 4℃ for 2 h, and then electrophoresed in alkaline electrophoresis buffer (1 mmol/L EDTA, 300 mmol/L NaOH) at 25 V for 30 min. Finally, the gels were neutralized with Tris-HCl buffer (0.4 mmol/L, PH = 7.5, 3 times, 10 Finally, the gel was neutralized with Tris-HCl buffer (0.4 mmol/L, pH = 7.5, 3 times, 10 min) and stained with PI. Cells were photographed using an Olympus BX51 fluorescence microscope (Olympus, Japan) and comet tails were analyzed by CASP software [17].

Construction of xenograft tumor model

Twenty female BALB/c nude mice (20–22 g, 3–5 weeks old) were purchased from Hangzhou Ziyuan Experimental Animal Technology Co., Ltd. They were raised in a germ-free environment and provided with normal food and water. Cell suspensions were prepared from U2932 cells transfected with oe-NC and oe-TGFBI. A volume of 100 µl (1 × 10⁷ cells) of cell suspension was injected subcutaneously into the right side of the nude mice to establish a xenograft tumor mouse model. When the tumor volume reached approximately 100 mm³, cisplatin (5 mg/kg body weight) or DMSO was intraperitoneally injected once a week for three weeks. The longest diameter (L) and the longest perpendicular diameter (W) of the tumor were measured every 3 days using calipers, and the tumor volume was calculated using the formula volume=(L×W²)/2. The mice were euthanized on the 21st day, and the tumor tissues were harvested for weighing and subsequent experiments. All animal experiments were conducted strictly in accordance with the requirements of the The Lab of Animal Experimental Ethical Inspection of Dr.CanBiotechnology(Zhejiang) Co.,Ltd Animal Ethics Committee.

Immunohistochemistry (IHC)

Tumor tissues from different treatment groups of mice were collected and embedded in paraffin to prepare sections. The sections were deparaffinized, hydrated, and subjected to antigen retrieval. Subsequently, they were treated with peroxidase enzyme at room temperature for 10 min, followed by blocking with 5% skim milk at 37 °C for 30 min. After washing with PBS, the sections were incubated overnight at 4 °C with the primary antibody solution containing anti-Ki67 (ab92742, Abcam, UK), and then incubated at 37 °C for 30 min with the secondary antibody solution containing goat anti-rabbit IgG H&L (HRP) (ab7090, Abcam, UK). Following PBS washing, Diaminobenzene (DAB) was used as the chromogen, and the experimental results were captured and recorded under a microscope (Leica, Germany).

Data analysis

All data are presented as mean ± standard deviation. Comparisons between two groups were performed using the t-test. One-way analysis of variance was used to determine the statistical significance of differences between two and more than three groups. Data were analyzed using SPSS 22.0 software (IBM, USA). P < 0.05 was considered statistically significant.

Results

TGFBI is significantly highly expressed in DLBCL

Reportedly, TGFBI overexpression as well as its association with cancer progression have been found across many cancer types [18–20]. TGFBI may play a potential role in the development of Burkitt lymphoma (BL) as a cancer-associated gene [21]. TGFBI has been identified as a gene associated with B-cell exhaustion (BEX) [22] and is upregulated in DLBCL [23]. Therefore, it was reasonable to speculate that TGFBI might be a pro-oncogene in DLBCL. We first learned that TGFBI was significantly highly expressed in DLBCL by oncomine website Compagno Lymphoma combined with Basso Lymphoma dataset analysis (Fig. 1A and B). The analytic results of data from the GEPIA website TCGA dataset combined with the GTEx dataset revealed upregulation of TGFBI in tumors (Fig. 1C). Subsequently, differential analysis using the Limma package in the GSE56315 dataset was performed, obtaining a total of 1556 DEmRNAs. Wilcox test showed that TGFBI was significantly highly expressed in tumors (Fig. 1D). Therefore, we examined TGFBI expression levels in DLBCL cell lines (U2932, TMD8, OCl-Ly3) and human B lymphocytes GM12878 by qRT-PCR and found significantly higher TGFBI expression in DLBCL cells than in human B lymphocytes (Fig. 1E). WB results showed that the protein expression level of TGFBI was significantly higher in DLBCL cells compared with human B lymphocytes (Fig. 1F). TMD8 and U2932 cell lines with relatively high and low TGFBI expression were selected for subsequent experiments. In brief, all these observations serve as compelling evidence for the significant upregulation of TGFB in DLBCL.

Fig. 1.

TGFBI is up-regulated in DLBCL. A: TGFBI expression in DLBCL group retrieved from Compagno Lymphoma dataset; B: TGFBI expression in DLBCL group obtained from Basso Lymphoma dataset; C: TGFBI expression in DLBCL obtained from GEPIA website; D: TGFBI expression obtained from GSE56315 dataset; E: TGFBI expression in DLBCL cell lines (U2932, TMD8, OCl-Ly3) and human B lymphocytes GM12878; F: Expression of the TGFBI. * P < 0.05

TGFBI promotes the malignant progression of DLBCL cells and inhibits DLBCL cisplatin sensitivity

Groups based on TMD8 and U2932 cells (si-NC/si-TGFBI and oe-NC/oe-TGFBI) were constructed to investigate how TGFBI impacts DLBCL progression. Firstly, we examined the transfection efficiency of TGFBI by qRT-PCR. Substantially reduced TGFBI expression in TMD8 after the knockdown of TGFBI and increased TGFBI expression in U2932 after up-regulation of TGFBI (Fig. 2A) were observed. WB results showed that the protein expression of TGFBI in TMD8 cells was significantly reduced after knockdown of TGFBI, whereas the protein expression of TGFBI in U2932 cells was significantly increased after upregulation of TGFBI (Fig. 2B-C). According to CCK-8 and colony formation assay results, TMD8 cell viability and proliferation ability were reduced after TGFBI knockdown, while TGFBI overexpression significantly promoted U2932 cell viability and proliferation ability (Fig. 2D and E). Flow cytometry assay results showed that knockdown of TGFBI significantly increased the apoptosis rate of TMD8, while overexpression of TGFBI significantly decreased the apoptosis rate of U2932 cells (Fig. 2F). TGFBI has previously been documented to be involved in cisplatin resistance in nasopharyngeal carcinoma [24]. We, therefore, hypothesized that TGFBI was a player influencing cisplatin sensitivity of DLBCL cells. Subsequently, IC50 values in DLBCL cells from each group treated with gradient concentrations of cisplatin (0, 1, 5, 15 and 20 µmol/L) were assessed by CCK-8. The results found significantly decreased IC50 values in TMD8 cells with TGFBI knockdown and significantly increased IC50 values in U2932 cells with TGFBI overexpression (Fig. 2G). It has been shown that tumor cell cisplatin resistance is closely related to DNA damage [25]. In this study, to investigate the relationship between DNA damage and cisplatin sensitivity in DLBCL cells, we treated TMD8 and U2932 cells with 5 µmol/L and 15 µmol/L of cisplatin, respectively. The results of the comet assay to detect cellular DNA damage showed that knockdown of TGFBI in cisplatin-treated TMD8 cells induced significantly stronger DNA damage than that in the control group, whereas overexpression of TGFBI in cisplatin-treated U2932 cells induced significantly lower DNA damage than that in the control group (Fig. 2H). These observations led us to conclude that TGFBI promoted the malignant progression and inhibited the sensitivity of DLBCL cells to cisplatin.

Fig. 2.

TGFBI impacts malignant progression and cisplatin sensitivity in DLBCL. A: Transfection efficiency of TGFBI; B-C: Expression of the TGFBI; D: Cell viability; E: Cell proliferation ability; F: Cell apoptosis rate; G: IC50 value; H: DNA damage. * P < 0.05

TGFBI positively regulates the TGF-β pathway in DLBCL

In the TCGA and GSE56315 datasets, TGFBI was significantly enriched in the TGF-β signaling pathway as assessed by GSEA analysis (Fig. 3A). It has been documented that TGFBI can regulate the TGF-β signaling pathway [24]. Therefore, we constructed si-NC/si-TGFBI and oe-NC/oe-TGFBI groups using TMD8 and U2932 cells to further explore their relationship in DLBCL cells. Subsequently, TGF-β pathway-related proteins (TGF-β1, Smad2, and p-Smad2) expression was detected by WB. According to the results, the knockdown of TGFBI significantly inhibited TGF-β1 and p-Smad2 expression in TMD8 cells, whereas overexpressed TGFBI significantly promoted TGF-β1 and phosphorylated Smad2 expression in U2932 cells (Fig. 3B). The above results revealed the positive regulation of TGFBI on the TGF-β signaling pathway in DLBCL cells.

Fig. 3.

TGFBI positively regulates the TGF-β signaling pathway. A: KEGG biological pathway analysis of TGFBI in TCGA and GSE56315 datasets; B: Expression of TGF-β signaling pathway-related proteins: TGF-β1, Smad2, and p-Smad2. * P < 0.05

TGFBI impacts DLBCL malignant progression and cisplatin sensitivity by regulating the TGF-β signaling pathway

To deepen existing knowledge of the molecular mechanism by which TGFBI affects DLBCL progression, we constructed oe-NC + DMSO, oe-TGFBI + DMSO, oe-TGFBI + SB525334 (TGF-β pathway inhibitor) groups based on U2932 cells. After conducting CCK-8 and colony formation assay, overexpressed TGFBI was discovered to significantly promote the viability and proliferation ability of U2932 cells, a promotion effect that could be attenuated by the addition of SB525334 (Fig. 4A-C). The results of flow cytometry assay showed that TGFBI overexpression significantly decreased the apoptosis rate of U2932 cells, while the addition of SB525334 improved the effect of TGFBI overexpression on the apoptosis rate of DLBCL cells (Fig. 4D). WB results showed that TGFBI overexpression significantly promoted the expression of TGF-β1 and p-Smad2 in U2932 cells, which could be restored by the addition of SB525334 (Fig. 4E). Finally, we examined IC50 values in each group of DLBCL cells by CCK-8. The results detected increases in IC50 values of TGFBI-overexpressing U2932 cells, whereas the addition of SB525334 attenuated the promoting effect of TGFBI overexpression on IC50 values in DLBCL cells (Fig. 4F). We treated U2932 cells with 15 µmol/L cisplatin. The results of the comet assay to detect cellular DNA damage showed that DNA damage caused by overexpression of TGFBI in cisplatin-treated U2932 cells was significantly lower than that in the control group, while the addition of SB525334 increased the effect of TGFBI overexpression on DNA damage (Fig. 4G). TGFBI promotes DLBCL malignant progression and inhibits DLBCL sensitivity to cisplatin via the TGF-β signaling pathway.

Fig. 4.

TGFBI impacts DLBCL malignant progression and cisplatin sensitivity by regulating TGF-β signaling pathway. A: Cell viability; B-C: Cell proliferation ability; D: Cell apoptosis rate; E: Expression of the TGF-β signaling pathway-related proteins TGF-β1, Smad2, and p-Smad2; F: IC50 value; G: DNA damage. * P < 0.05

TGFBI affects DLBCL malignant progression and sensitivity to cisplatin in mice in vivo

To investigate the impact of TGFBI on the progression of DLBCL in mice, we constructed a xenograft mouse model: oe-NC + DMSO, oe-TGFBI + DMSO, oe-NC + cisplatin, and oe-TGFBI + cisplatin. After 21 days, compared to the oe-NC + DMSO group, the mice in the oe-TGFBI + DMSO group showed a significant increase in tumor volume and mass, while the mice in the oe-NC + cisplatin group exhibited a significant decrease in volume and mass. The addition of oe-TGFBI weakened the inhibitory effect of cisplatin on mass and volume (Fig. 5A-B). IHC results indicated that in comparison to the oe-NC + DMSO group, the expression of the tumor cell proliferation marker Ki67 was significantly increased in the oe-TGFBI + DMSO group and significantly decreased in the oe-NC + cisplatin group. The addition of oe-TGFBI attenuated the inhibitory effect of cisplatin on Ki67 expression (Fig. 5C). WB results revealed that compared to the oe-NC + DMSO group, the protein expression of TGF-β1 and p-Smad2 was significantly increased in the oe-TGFBI + DMSO group, while protein expression was significantly decreased in the oe-NC + cisplatin group. The addition of oe-TGFBI weakened the inhibitory effect of cisplatin on the expression of these proteins (Fig. 5D). TGFBI promotes DLBCL malignant progression and inhibits DLBCL sensitivity to cisplatin in mice in vivo.

Fig. 5.

TGFBI affects malignant progression and sensitivity to cisplatin in DLBCL in mice. A: Tumor volume; B: Tumor mass; C: Ki-67 expression; D: Expression of TGF-β signaling pathway-related proteins: TGF-β1, Smad2, and p-Smad2. * P < 0.05

Discussion

As a highly proliferative disease in the lymphatic system, DLBCL is mainly treated with chemotherapy. However, limited by so developed resistance that leads to relapse, the effect of therapy isreduced [3, 26]. Therefore, exploring the mechanism of chemoresistance in DLBCL is of greater significance to realize better therapeutic effects. The mechanism of DLBCL resistance has been partly investigated by previous studies. For example, Feng et al. [27] found that, in DLBCL, NFYB activates the Hedgehog pathway by promoting SYK33 transcription and hence promotes cisplatin resistance in DLBCL. Yang et al. [28] showed that Sirt6 promotes doxorubicin resistance in DLBCL by mediating the PI3K/Akt signaling. According to what we observed in this study, significantly upregulated TGFBI in DCBCL could inhibit the cisplatin sensitivity of DCBCL cells. First identified in a cDNA library of human A549 lung ADC cells, TGFBI is a secreted protein induced by TGF-β that mediates cellular anchoring to the extracellular matrix [6]. TGFBI contributes substantially to the progression of multiple tumors. As for glioma cells high TGFBI expression promotes cell proliferation and migration [6]. Another study completed by Wang et al. [20] found TGFBI overexpression promotes malignant progression and bears some relationship with poor prognosis in oral squamous cell carcinoma. Similarly, our findings suggested that TGFBI promoted malignant progression in DLBCL cells and might be an effective target for DLBCL treatment.

As one of the important cellular pathways, TGF-β is crucial in regulating cell growth, apoptosis and differentiation [29]. Activation of the TGF-β signaling pathway can lead to phosphorylation of TGF-β1, Smad2, and Smad3. Subsequently, phosphorylated Smad2/3 forms a complex with Smad4 that translocates to the nucleus to regulate the transcription of target genes, including Smad7 [30]. In addition, by activating TGF-β pathway, the malignant progression of various cancers such as DLBCL, glioma, and colorectal cancer were promoted [31–33]. For example, in lung adenocarcinoma, Dong et al. [34] found that PTBP3 can promote epithelial-mesenchymal transition and metastasis via TGF-β signaling pathway. Shan et al. [35] found that exosomal miR-423-5p inhibits GREM2 through TGF-β pathway, thereby promoting taxane resistance in prostate cancer. According to bioinformatics analysis in this study, TGFBI was enriched in the TGF-β signaling pathway. Subsequent rescue experiments found TGFBI could promote the malignant progression of DLBCL and inhibit DLBCL sensitivity to cisplatin by regulating the TGF-β pathway.

In summary, this study found that TGFBI could promote the malignant progression of DLBCL and inhibit the sensitivity of DLBCL to cisplatin by regulating the TGF-β signaling pathway. These findings highlight the importance of TGFBI and TGF-β signaling pathways in DLBCL progression and therapeutic efficacy. However, the absence of in vivo experiments in this study entails future animal experiments to offer a systematic analysis of how TGFBI affects DLBCL progression and cisplatin sensitivity. In conclusion, it was found that TGFBI regulation of the TGF-β pathway affected the malignant progression and cisplatin sensitivity in DLBCL. What we observed and concluded in this study can provide direction for the development of more therapeutic agents for DLBCL.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Author contributions

LL W conceived of the study, and participated in its design and interpretation and helped to draft the manuscript. L J, WE Z and YL Z participated in the design and interpretation of the data and drafting/revising the manuscript. AM F and HF G performed the statistical analysis and revised the manuscript critically. All the authors read and approved the final manuscript.

Funding

This research received no specific grant from any funding agency in the public, commercial, or not for profit sectors.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

All animal experiments were conducted strictly in accordance with the requirements of the The Lab of Animal Experimental Ethical Inspection of Dr.CanBiotechnology(Zhejiang) Co.,Ltd Animal Ethics Committee. Reference Number: DRK202409202.

Consent to participate

Patient consent were not required in accordance with local or national guidelines.

Competing interests

The authors declare no competing interests.