Selenomethionine inhibits the proliferation of hypoxia-induced pulmonary artery smooth muscle cells by inhibiting ROS and HIF-1α-ACE-AngII axis

Abstract

Recent studies have shown that patients with pulmonary arterial hypertension (PAH) are deficient in nutrients, especially vitamins and minerals. Selenium is a strong antioxidant and there is a correlation between selenium and quality of life in patients with PAH. The purpose of this study was to research whether Selenomethionine (SeMet) can reduce the oxidative damage of pulmonary artery smooth muscle cells (PASMCs) and inhibit the proliferation of PASMCs in hypoxia, and the protective mechanism of SeMet on hypoxia-induced PASMCs. PASMCs were cultured and divided into 5 groups, normoxia group, hypoxia group, and hypoxia + SeMet group (10,20 and 40 µg/ml). It was found that cell activity was elevated and hyperproliferation was observed in the hypoxia group compared to the normoxia control group. Meanwhile, the antioxidant indexes SOD and CAT activities were reduced, T-AOC was decreased, and ROS and MDA contents were elevated in the hypoxia group. The expressions of HIF-1α, ACE, Ang II, VEGF genes and proteins in PASMCs were increased under hypoxia. And SeMet reversed the above changes in antioxidant indicators and proteins, thereby inhibiting the proliferation of PASMCs and promoting apoptosis. Our study found that SeMet may inhibit hypoxia-induced oxidative stress and proliferation in PASMCs by the ROS and HIF-1α-ACE-AngII axis.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-025-95793-2.

Introduction

Pulmonary arterial hypertension (PAH) is a progressive disease caused by functional and structural changes in the pulmonary vasculature, which lead to increased pulmonary vascular resistance, and eventually right ventricular failure and death¹. Hypoxic pulmonary hypertension (HPH) is a type of PAH². Pulmonary vascular remodeling (PVR) is characterized by unbalanced proliferation and apoptosis of pulmonary artery smooth muscle cells (PASMCs), which is considered to be the major cause for the development of HPH³. PASMCs are both the effector cells of pulmonary vasoconstriction and the cellular basis for structural remodelling^4,5. Therefore, to reverse PVR by inhibiting the abnormal proliferation of PASMCs is expected to be another breakthrough for the treatment of HPH.

Hypoxia-inducible factor − 1α (HIF-1α) is an important transcriptional regulator factor of HPH⁶. It has been found that oxidative stress may be involved in the formation of PAH by promoting the proliferation of PASMCs through upregulation of HIF-1α transcription and translation^7,8. Recent studies have demonstrated that HIF-1α small interfering RNA (siRNA) effectively inhibits hypoxia-induced expression of angiotensin-converting enzyme (ACE) in human pulmonary artery fibroblasts⁹. Vascular endothelial growth factor (VEGF) belongs to the platelet-derived growth factor superfamily, and VEGF is a growth factor closely related to angiogenesis and hematopoiesis. HIF-1α regulates the expression of its downstream target gene VEGF, which triggers vascular remodeling and leads to HPH¹⁰. Research indicates that angiotensin II (AngII) pretreatment, as a trigger, activated the angiotensin II type 1 receptor (AT1R)/HIF-1α/ACE signaling axis that then mediated Ang II-induced VEGF synthesis in mesenchymal stem cells (MSCs). Additionally, ACE and HIF-1α activation are involved in AngII-induced upregulation of VEGF in MSCs¹¹. ACE plays a significant role in the conversion of angiotensin I (AngI) to AngII, thus serving as a vital enzyme that facilitates VEGF production. Notably, ACE inhibitors can significantly inhibit VEGF secretion and neovascularization in tumor models¹². HIF-1α acts as an essential transcriptional regulator of VEGF expression in hypoxia, and HIF-1α is involved in the expression of AngII-induced VEGF¹³. Studies have shown that selenium supplementation to hypoxic neuroblastoma cells does not cause DNA damage, suggesting that selenium has a protective effect under hypoxic stress conditions¹⁴. Serum selenium levels in neonates with hypoxic-ischemic encephalopathy (HIE) were negatively correlated with HIE severity¹⁵. Additionally, selenium supplementation protect aged cardiomyocytes from hypoxia/reoxygenation damage^16,17. Previous studies have found that selenium supplementation can reduce the expression of VEGF and HIF-1α, and it could reverse damage of mitochondrial structure in hypoxia¹⁸. The purpose of this study was to investigate the possible effects of SeMet on the proliferation of hypoxia-induced PASMCs and its mechanism.

Numerous studies have established that oxidative stress plays a pivotal role in the pathophysiology of PAH¹⁹, involving alterations in the signaling pathways of reactive oxygen species (ROS), reactive nitrogen species (RNS), and nitric oxide (NO)²⁰. Disruption of these ROS and NO signaling pathways contributes to the proliferation of pulmonary artery endothelial cells and PASMCs, which in turn leads to DNA damage, metabolic dysregulation, and vascular remodelling. Antioxidant treatment has emerged as a significant focus of research in the treatment of PAH²¹.

HPH is caused by multiple factors such as heredity and environment^22–24. It has been demonstrated that low prognostic nutritional indices correlate with an increased risk of mortality in patients with PAH²⁵. Additionally, studies have shown that there are micronutrient deficiencies in PAH patients^26,27. Selenium is an important micronutrient. It scavenges intracellular free radicals and protects cells from damage caused by oxidative stress as an antioxidant involved in the synthesis and activation of the antioxidant enzyme glutathione peroxidase in the human body²⁸. Notably, The cause of altitude sickness in cattle is due to selenium deficiency²⁹. Adding nano-selenium to the diet could help broiler chickens prevent PAH syndrome³⁰. A prospective study revealed that 40% of PAH patients had selenium levels below < 100 µg/L, and that low selenium levels were associated with decreased viability in these PAH patients³¹. Therefore, this study aims to research the effect of selenium on hypoxia-induced damage in PASMCs and its mechanism in vitro.

Materials and methods

Isolation and cell culture of PASMCs

The experimental animals used in the study were male Sprague-Dawley (SD) rats, specific pathogen free (SPF) grade, 5 weeks of age. The weight was (130 ± 10) g, which was purchased from Beijing Huafu Biotechnology Company (Certificate of Conformity No. 110322220100347884). Animals were housed in IVC cages (2 rats/cage) in our laboratory before use and maintained a 12-hour light/dark cycle. Animals had free access to food and water. SD rats were euthanized by cervical dislocation after being anesthetized by intraperitoneal injection of 2% sodium pentobarbital and were sterilized in 75% ethanol for 5 min. The heart and lungs were removed and the pulmonary vessels were dissected in PBS buffer (Boster, Wuhan, China). After removing the inner and outer membranes under a dissecting microscope, the arterial segments were cut into small pieces and digested with 0.2% type II collagenase (Solebol, Beijing, China) at 37℃ for digestion for about 1 h. The supernatant was discarded after centrifugation at 800 r/min for 5 min, and the cell pellet was resuspended in high glucose DMEM medium (VivaCell, Shanghai, China) containing 20% FBS (VivaCell, Shanghai, China). The resuspension solution was added into the culture flasks and placed in a humidified incubator (Thermo HERAcell150i, Thermo Fisher Scientific, America) for culture at 37 °C with 5% CO₂. When the cells grew to about 70% confluence, the cells were purified by differential wall affixation. Generation 3–5 cells were used for subsequent experimental studies. All experiments were repeated at least 3 times.

Cell culture and treatment

PASMCs derived from pulmonary arteries were cultured with DMEM supplemented with 100 µg/ml streptomycin, 100 IU/ml penicillin, and 10% FBS as previously described. Then, the cells were divided into five groups, normoxia group (Nor), hypoxia group (Hyp), hypoxia + SeMet (10 µg/ml) group, hypoxia + SeMet (20 µg/ml) group, and hypoxia + SeMet (40 µg/ml) group. SeMet dissolved in high glucose DMEM medium, configured it into 1 mg/ml stock solution, filtration sterilization (0.22 μm filter membrane), and then gradient dilution was used for subsequent experiment. All hypoxia groups were cultured in a hypoxic incubator (CB53, BINDER, Germany) at 37 °C, 1% O_2, 5% CO₂ and 94% N₂ for 48 h, while the normoxia group was cultured in a normal incubator at 37 °C, 21% O₂, 5% CO₂ and 74% N₂ for 48 h.

Material and reagents

L-selenomethionine was purchased from Shanghai McLean Biochemical Technology Co., Ltd (3211-76−5). DMEM and FBS were from VivaCell Biosciences (Shanghai, China). Trypsin, penicillin, PBS, and CCK8 cell assay kits were purchased from Boster Biological Technology Co., Ltd (Wuhan, China). The apoptosis detection kit and cell cycle kit were purchased from Elabscience (Wuhan, China). BeyoClick™ EdU-488 Cell Proliferation Detection Kit was purchased from Beyotime (Shanghai, China). RNA simple Total RNA Extraction Kit (DP419), FastKing One Step De-genomic cDNA First Strand Synthesis Premix Reagent (KR118), SuperReal Colour Fluorescence Quantification Premix Reagent (FP215) were purchased from Tiangen Biochemistry Technology Co., Ltd (Beijing, China). Rabbit antibodies against Cell cycle protein D1 (CyclinD1), Proliferating Cell Nuclear Antigen (PCNA), HIF-1α, VEGF, ACE, and CollagenI were obtained from Abcam (Cambridge, UK), and mouse antibody against Ang II was obtained from Bio-Techne Company (Shanghai, China).

Viability assay

Cell viability was determined by the CCK-8 assay (Boster, Wuhan, China). WST-8 is an MTT-like compound. In the presence of electronically coupled reagents, WST-8 can be reduced to an orange-colored formamide by dehydrogenases in the mitochondria. The color is linearly related to the number of cells. PASMCs were inoculated in 96-well plates at a concentration of 8 × 10³ cells/well. After laying for 12–16 h, the medium was changed before starting the treatment with SeMet in different concentrations (0, 10, 20, 40, 80, 160, 320, and 640 µg/ml). PASMCs were incubated in normoxic (21% O₂, 5% CO₂) and hypoxic (1% O₂, 5% CO₂) incubators for 48 h. 10 µL of CCK-8 solution was added to each well, and the absorbance was measured at 450 nm after incubation at 37 °C for 1 h.

Measurement of antioxidant indicators

PASMCs were inoculated in T25 cell culture flasks at 1 × 10⁶ cells according to above cell culture method. The intracellular superoxide dismutase (SOD) activity was detected by SOD assay kit (Nanjing, China), the intracellular catalase (CAT) activity was detected by ammonium molybdate method (Nanjing, China), the malondialdehyde (MDA) level was determined by lipid peroxidation assay kit (Nanjing, China), and the cellular total antioxidant capacity (T-AOC) of all the groups was determined by 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) method  (Nanjing, China). The fluorescence intensity of ROS was detected using the ROS assay kit (Nanjing, China).

5-Ethynyl-2′-deoxyuridine (EdU) staining

EdU staining was performed using the BeyoClick™ EdU cell proliferation detection kit (BeyoClick, C0071S, Shanghai, China). PASMCs were inoculated in 24-well plates at a concentration of 1 × 10⁴ cells/well. EdU, an analog of thymine, was incorporated into the DNA synthesis of the cells. The DNA of PASMCs was labeled with a fluorescent probe after fluorescent labeling of EdU catalyzed by copper ions, which could be observed under a fluorescence microscope, and the number of cells in each group was counted to calculate the proliferation rate.

Cell cycle analysis

PASMCs were inoculated in T25 cell culture flasks at 1 × 10⁶ cells according to above cell culture method. Cell cycle assays were performed using a cell cycle assay kit (Elabscience, E-CK-A351, Wuhan, China). Briefly, PASMCs were cultured in groups as described above for 48 h. Cell precipitates were collected by trypsin digestion and washed with PBS. Cells were fixed with pre-cooled anhydrous ethanol at −20 °C for 1 h, centrifuged at 300 × g for 5 min, and the cell precipitate was retained. 100 µL of RNase A Reagent was added and the cells were well suspended in a water bath at 37 °C for 30 min, then 400 µL of PI Reagent (50 µg/mL) was added and well mixed, and the cells were incubated for 30 min at 2–8 °C, protected from light. The cell cycle was detected by flow cytometry at 488 nm. The data were further analyzed using FlowJo software (version 10.8.1).

Annexin V-FITC assay

PASMCs were inoculated in T25 cell culture flasks at 1 × 10⁶ cells according to above cell culture method. Cells were treated with an apoptosis kit (Elabscience, E-CK-A211, Wuhan, China). After PASMCs were cultured in groups as described above for 48 h, PASMCs (cells not less than 1 × 10⁶) were collected, cells were washed once with PBS buffer, and then 500 µL of 1 × Annexin V binding buffer was added to resuspend the cells. 5 µL of Annexin V-FITC reagent and 5 µL of PI reagent (50 µg/mL) were added to the cell suspension and incubated for 15–20 min at room temperature away from light for flow cytometry (BD FACSCelesta, BD, USA). The data were further analyzed using FlowJo software (version 10.8.1).

Quantitative real‑time PCR

PASMCs were inoculated in T25 cell culture flasks at 1 × 10⁶ cells according to above cell culture method. Total RNA from PASMCs was extracted using the Total RNA Extraction Kit (TIANGEN, Beijing, China) according to the manufacturer’s instructions. cDNA was synthesized using the Reverse Transcription Reagent (TIANGEN, Beijing, China). cDNA was extracted from PASMCs using SuperReal PreMix Color (SYBR Green) (TIANGEN, Beijing, China) to determine the gene expression levels in an ABI Q5 equipment (Applied Biosystems, Foster City, USA). The relative expression of each group was analyzed using the 2^^−ΔΔCt method. β-Actin was used as the internal control. The primers were synthesized by Sangon Corporation (Shanghai, China), and the oligonucleotide sequences of the primers were listed in Table 1.

Table 1.

Primers sequences and species.

Gene symbol	Species	Prime	Primer Sequences (5’ to 3’)	Product length(bp)
VEGF	Rat	Forward	GCACTGGACCCTGGCTTTACTG	22
		Reverse	GGCACACAGGACGGCTTGAAG	21
AngII	Rat	Forward	AACCTTTGAGCCTGTGCCCATTC	23
		Reverse	TGCCGATCCTCAGCCTCTAGC	21
ACE	Rat	Forward	TTCGTGCTACAGTTCCAGTTCCATC	25
		Reverse	GACCTCGCCATTCCGCTGATTC	22
HIF-1α	Rat	Forward	ACCGCCACCACCACTGATG	19
		Reverse	GTACCACTGTATGCTGATGCCTTAG	25
ACTB	Rat	Forward	TGTCACCAACTGGGACGATA	20
		Reverse	GGGGTGTTGAAGGTCTCAAA	20

Immunofluorescence

PASMCs were inoculated in confocal dish at 8 × 10⁴ cells according to above cell culture method. Immunofluorescence was used to identify the distribution and expression levels of HIF-1a, ACE, and AngII in PASMCs. Cells were fixed with ice-cold 4% paraformaldehyde, permeabilized with 0.2% Triton X-100, then blocked with 3% BSA solution for 30 min, and incubated with antibodies against HIF-1a, ACE, and AngII for 20 h at 4°C. Then, the cells were incubated with fluorescent secondary antibodies in the dark for 2 h, and the nuclei were stained with DAPI for 10 min. After rinsing with PBS, the dishes were observed and imaged using a laser confocal microscope (ZEISS LSM880, Germany). Laser confocal microscopy was used to detect the intensity of each fluorescence channel and the results were analyzed using ZEN 3.10 software (Zeiss).

Western blot analysis

PASMCs were inoculated in T25 cell culture flasks at 1 × 10⁶ cells according to above cell culture method. PASMCs were lysed with RIPA buffer at 4 °C for 30 min and protein concentration was detected by the BCA (No. 23227, Thermo Fisher Scientific) method. Total protein (20 µg) was separated by electrophoresis on an 8–10% sodium dodecyl sulfate-polyacrylamide gel and then transferred to a PVDF membrane. The membranes were closed with a 5% skimmed milk shaker for 1 h at room temperature. To reduce the number of primary antibodies used, we cut the membranes to the appropriate size based on the marker corresponding to the molecular weight of the protein before incubating the membranes with the following primary antibody. The membranes were incubated with CyclinD1 (1:200, No.ab16663, Abcam), PCNA (1:5000, No.ab92552, Abcam), HIF-1α (1:1000, No.ab179483, Abcam), VEGF (1:1000, No.ab214424, Abcam), ACE (1:1000, No.ab254222, Abcam) and CollagenI (1:1000, No.ab270993, Abcam), AngII (1:1000, NB100-62346, Bio-Techne) were incubated overnight at 4 °C in the refrigerator. The membrane was washed three times with TBST on the following day and then added with anti-mouse HRP secondary antibody (1:5000, No.SA00001-1, Proteintech) or anti-rabbit HRP secondary antibody (1:5000, No.ab205718, Abcam) and incubated at room temperature for 1 h. After washing, the chemiluminescence method from Millipore Corporation was used to display the protein bands of the western blot. The protein bands were visualized using an Amersham Imager 600 (GE, USA) and were quantified using densitometry analysis (Image J x64 software, NIH).

Statistical analysis

Statistical analyses were performed using IBM SPSS Statistics 28.0 and GraphPad Prism 9.0 software. All data were tested for normality before analysis. All data are expressed as mean ± standard deviation (SD) and all experiments were repeated at least 3 times. The statistical analysis method of T-test was used between the two groups. Analysis of variance (ANOVA) was used between multiple groups. LSD test was used for homogeneity of variances and Tamhane’s T2 method was used for heterogeneity of variances. P < 0.05 was considered statistically significant.

Declaration of ethics

This study conformed to the stipulations set forth in the ARRIVE guidelines for experimental animals research. The protocols governing animal care and experimental utilization were rigorously aligned with the Chinese Guidelines for the Care and Use of Laboratory Animals. According to the animal management regulations of the Ministry of Health of China, the Committee of Animal Protection and Utilization of Qinghai University approved our animal experiments (LOT NO, 2022-48). All animal experiments were performed in accordance with relevant ethical regulations.

Results

SeMet inhibits hypoxia-induced proliferation in PASMCs

CCK-8 assay was carried out on PASMCs under normoxic, and the results indicated that SeMet showed no cytotoxicity (cell viability > 75%) below 40 µg/ml. The cell viability was 66% in 40 µg/ml SeMet (Fig. 1a, b). The IC50-value was 61.9 µg/ml in hypoxia (Fig. 1c). Therefore, 40 µg/ml was used as the highest dose to set the concentration in this experiment. CCK-8 results showed that the SeMet-added could effectively inhibit the proliferation of PASMCs compared with the control group in hypoxia, and the difference was statistically significant from 10 µg/ml (P < 0.05, Fig. 1c, d). Furthermore, in the EdU assay, proliferating cells were identified as positive (Fig. 1e). Our findings demonstrated that the Hyp group can promote the proliferation of PASMCs compared with the Nor group, the difference was statistically significant(P < 0.05). SeMet group can inhibit the proliferation of PASMCs in hypoxia compared with the Hyp group, the difference was statistically significant (P < 0.05, Fig. 1e, f).

Fig. 1.

SeMet blocks the growth of PASMCs (a) IC50 value of PASMCs in normoxia for 48 h. (b) Inhibition rate of PASMCs by different concentrations of SeMet in normoxia. Data are presented as mean ± SD (n = 3). *p < 0.05 vs. Control group. (c) IC50 value of PASMCs in hypoxia for 48 h. (d) Inhibition rate of PASMCs by different concentrations of SeMet in hypoxia. Data are expressed as means ± SD (n = 3). *p < 0.05 vs. Control group. (e) Statistical graph showing the proportion of EdU-positive cells, shown as mean ± SD (n = 3). ^#p < 0.05 Hyp vs. Nor, *p < 0.05 Hyp + SeMet (10,20 and 40 µg/ml) vs. Hyp. (f) EdU staining of PASMCs showing changes in cell proliferation (scale bar: 50 μm).

Effects of SeMet on apoptosis and cell cycle

As shown in Fig. 2, the total apoptosis rate of PASMCs in the Hyp group showed a decrease compared to the Nor group, although this difference did not reach statistical significance(P > 0.05, Fig. 2a, b). The total apoptosis rate of PASMCs in the SeMet groups was increased compared with the Hyp group(P < 0.05, Fig. 2a, b). From the flow cytometry diagram, it can be seen that there are more late apoptotic cells and fewer early apoptotic cells in the SeMet groups. Overall, the early apoptosis and late apoptosis in the SeMet groups were increased compared with the Hyp group, and the difference was statistically significant(P < 0.05, Fig. 2a, b). Flow cytometry analysis was conducted to investigate the cell cycle distribution. The Hyp group was a decrease in the number of cells in the G1 phase and an increase in the proportion of cells in the S phase and G2/M phase compared to Nor group, but without statistical difference(P > 0.05, Fig. 2c, d). Additionally, our research found that the percentage of G1 phase was increased and the percentage of S phase and G2/M phase were decreased in the 20 µg/ml and 40 µg/ml SeMet groups compared to Hyp group, but the difference was not statistically significant (P > 0.05, Fig. 2c, d).

Fig. 2.

(a) Flow cytometry analysis of apoptosis. (b) Distribution of apoptosis rate in different groups and expressed as mean ± SD (n = 3). (c) Flow cytometry analysis of cell cycle. To calculate the percentage of cells in each phase, each group of cells was grown in the appropriate environment for 48 h and then stained with PI. Data are presented as mean ± SD (n = 4). (d) Distribution plot of cell cycle dispersion based on flow cytometry analysis. PASMC from all groups were cultured in a normoxia (5% CO₂ and 21% O₂) or hypoxia (5% CO₂ and 1% O₂) environment for 48 h. ^#p < 0.05 Hyp vs. Nor, *p < 0.05 Hyp + SeMet (10,20 and 40 µg/ml) vs. Hyp.

Effect of SeMet on PCNA, CyclinD1, and CollagenI protein expression in PASMCs

The expressions of PCNA and CollagenI protein in Hyp group were increased compared with the Nor group, but the differences were not statistically significant (P > 0.05, Fig. 3). And the expressions of CyclinD1 protein in Hyp group was increased compared with the Nor group, and the difference was statistically significant(P < 0.05, Fig. 3). The PCNA and CollagenI protein expression were decreased in the SeMet groups compared with the Hyp group, and the difference was statistically significant(P < 0.05, Fig. 3). The CyclinD1 protein expression was decreased in the 20 µg/ml and 40 µg/ml SeMet groups compared with the Hyp group, and the difference was statistically significant(P < 0.05, Fig. 3).

Fig. 3.

SeMet inhibited the expression of PCNA, CyclinD1, and CollagenI proteins in PASMCs. Data are presented as mean ± SD (n = 3). ^#p < 0.05 Hyp vs. Nor, *p < 0.05 Hyp + SeMet (10,20 and 40 µg/ml) vs. Hyp.

SeMet attenuates hypoxia-induced oxidative damage in PASMCs

The activities of SOD and CAT decreased, T-AOC decreased, and the content of MDA and ROS increased in the Hyp group, compared with the Nor group, the difference was statistically significant(P < 0.05, Fig. 4a-e). The content of ROS was reduced in the SeMet groups compared with the Hyp group, and the difference was statistically significant(P < 0.05, Fig. 4a). Compared with the Hyp group, the CAT enzyme activity and T-AOC increased in 10 µg/ml and 20 µg/ml SeMet groups, and decreased in 40 µg/ml SeMet group, and the difference was statistically significant(P < 0.05, Fig. 4b, e). Compared with the Hyp group, the contents of MDA decreased in 10 µg/ml SeMet group, and increased in 20 µg/ml and 40 µg/ml SeMet groups, and the difference was statistically significant(P < 0.05, Fig. 4d). The SOD enzyme activity increased in 10 µg/ml SeMet group compared with the Hyp group, and the difference was statistically significant(P < 0.05, Fig. 4c).

Fig. 4.

SeMet has antioxidant properties and reduces hypoxia-induced oxidative damage in PASMCs. (a) Effect of SeMet on cellular ROS content, shown as mean ± SD (n = 4). (b) Effect of SeMet on CAT activity in cells, shown as mean ± SD (n = 4). (c) Effect of SeMet on SOD activity in cells. Data are presented as mean ± SD (n = 3). (d) Effect of SeMet on MDA content in cells. Data are presented as mean ± SD (n = 3). (e) Effect of SeMet on T-AOC in cells of different groups. Data are presented as mean ± SD (n = 3). ^#p < 0.05 Hyp vs. Nor, *p < 0.05 Hyp + SeMet (10,20 and 40 µg/ml) vs. Hyp.

The regulatory effect of SeMet on HIF-1α-ACE-AngII axis in PASMCs

HIF-1α was expressed in both the cytoplasm and nucleus of PASMCs. The results showed that the fluorescence intensity of HIF-1α was increased, and HIF-1α mRNA and protein expression were increased in the Hyp group compared with the Nor group (P < 0.05, Figs. 5a and c and 6a and b). Compared with the Hyp group, the fluorescence intensity of HIF-1α in the 10 µg/ml, 20 µg/ml, and 40 µg/ml SeMet groups were both decreased (P < 0.05, Fig. 5a, c). The HIF-1α mRNA and protein expression were decreased in the 10 µg/ml SeMet groups compared with the Hyp group(P < 0.05, Fig. 6a, b). The results showed that the fluorescence intensity of ACE and AngII were increased in the Hyp group compared with the Nor group, and the difference was statistically significant(P < 0.05, Fig. 5b, d,e). The fluorescence intensity of ACE and AngII were decreased in 20 µg/ml and 40 µg/ml SeMet groups compared with the Hyp group, and the difference was statistically significant(P < 0.05, Fig. 5b, d,e). The mRNA and protein expression of AngII was increased in the Hyp group compared with the Nor group(P < 0.05, Fig. 6a, b). The mRNA and protein expression of AngII was decreased in 10 µg/ml and 20 µg/ml SeMet groups compared with the Hyp group(P < 0.05, Fig. 6a, b). The ACE protein expression was increased in the Hyp group compared with the Nor group(P < 0.05, Fig. 6b), and the ACE mRNA expression was increased in the Hyp group compared with the Nor group (P > 0.05, Fig. 6a). And the mRNA and protein expression of ACE was decreased in 10 µg/ml and 20 µg/ml SeMet groups compared with the Hyp group(P < 0.05, Fig. 6a, b). The mRNA expression of VEGF was increased in the Hyp group compared to the Nor group (P < 0.05, Fig. 6a). The mRNA expression of VEGF the 10 µg/ml SeMet group was decreased compared with the Hyp group (P < 0.05, Fig. 6a). The same trend was observed for the VEGF protein expression (P < 0.05, Fig. 6b). SeMet inhibits the expression of HIF-1α, ACE, AngII, and VEGF proteins. These findings suggest that hypoxia activates the HIF-1α-ACE-AngII axis and SeMet inhibits the HIF-1α-ACE-AngII axis (Fig. 7).

Fig. 5.

Quantitative expression of HIF-1α, ACE, and AngII proteins in PASMCs. (a, b) Immunofluorescence (scale bar: 50 μm) showing the fluorescence expression intensity of HIF-1α, ACE, and AngII in PASMCs. (c-e) Quantification of HIF-1α, ACE, and AngII immunofluorescence. PASMCs from all groups were cultured in a normoxia (5% CO₂ and 21% O₂) or hypoxia (5% CO₂ and 1% O₂) environment for 48 h. Data are presented as mean ± SD (n = 3). ^#p < 0.05 Hyp vs. Nor, *p < 0.05 Hyp + SeMet (10,20 and 40 µg/ml) vs. Hyp.

Fig. 6.

SeMet inhibited the expression of HIF-1α, ACE, VEGF, and AngII in PASMCs. (a) Relative expression of HIF-1α, ACE, VEGF, and AngII mRNA in PASMCs. Data are presented as mean ± SD (n = 3). (b) Relative expression of HIF-1α, ACE, VEGF, and AngII proteins was analyzed by WB in Nor, Hyp, Hyp + 10 µg/ml SeMet, Hyp + 20 µg/ml SeMet, Hyp + 40 µg/ml SeMet groups. Data are presented as mean ± SD (n ≥ 3). ^#p < 0.05 Hyp vs. Nor, *p < 0.05 Hyp + SeMet (10,20 and 40 µg/ml) vs. Hyp.

Fig. 7.

Schematic representation of antioxidant indices and changes in HIF-1α, ACE, AngII and VEGF proteins in hypoxia exposed PASMCs. HIF-1α expression was elevated in hypoxia-exposed cells. Meanwhile, oxidative stress occurred with increased ROS production, elevated MDA levels and reduced antioxidant enzyme activities of the cells in hypoxia. This further stimulated elevated HIF-1α expression, and HIF-1α regulated the expression of ACE, AngII and VEGF. Whereas treatment of PASMCs with SeMet reversed the changes brought by hypoxic, and eventually inhibited PASMCs proliferation.

Discussion

Selenium, an essential micronutrient, primarily exists in two forms: inorganic selenium and organic selenium³². Selenium plays a biological role in the body mainly in the form of selenoproteins. Organic selenium exists mainly in the form of selenocysteine and selenomethionine in the peptide chain of proteins, and the proteins doped into the polypeptide chain in the form of selenocysteine are generally called selenoproteins³³. Recent studies have demonstrated multiple biological effects of selenium, including its antioxidant properties, anticancer activity, cardiovascular protection, and its regulatory role in energy metabolism.

Studies have shown that inhibiting or reversing PASMCs proliferation is crucial for preventing pulmonary artery remodeling and for the effective treatment of PAH. Pharmacological interventions that regulate the cell cycle can inhibit the proliferation of PASMCs and prevent PVR³⁴. Therefore, inhibition of PASMCs cycle progression is considered to be an effective strategy for controlling PASMCs proliferation. Cyclin D1 induces progression from phase G1 to S via activation of cyclin-dependent kinase-4 (Cdk4)³⁵. PCNA is required for cell DNA synthesis and is a promoter and marker of the mitosis S-phase^36,37. Many pharmacological agents, such as anti-proliferative agents and anti-thrombotic agents, can alter one or more regulatory events in the cell cycle to block cell cycle progression and thereby suppress cell proliferation³⁸. In our study, we found that expression of PCNA and CyclinD1 of PASMCs in hypoxia was increased and SeMet reduced the expression. Under hypoxic condition, the proportion of G0/G1 phase decreased, and the proportion of S phase and G2 phase increased, which accelerated the cell cycle, and enhanced the activity of PASMCs cells, and enhanced the anti-apoptosis ability. After the addition of SeMet in hypoxia, cell activity was decreased, and apoptosis was increased, the expression of PCNA and CyclinD1 protein were down-regulated in PASMCs. The SeMet (20 and 40 µg/ml) groups had increased percentages of cells in the G0/G1 phase and decreased percentages of cells in the G2/M and S phases. Overall, these data suggest that SeMet may contribute to PASMCs proliferation inhibition via cell cycle arrest at the G0/G1 phase, which further supports the anti-proliferative effects of SeMet. If the balance between cell proliferation and apoptosis is broken in hypoxia, such as excessive cell proliferation and insufficient apoptosis, it may lead to the occurrence of vascular wall hypertrophy, aggravates PVR in hypoxia. The expression of CollagenI protein was increased in hypoxia, and SeMet could decrease the expression of CollagenI. Inhibition of PASMCs proliferation by SeMet can inhibit vascular remodeling and slow down the progression of HPH.

Hypoxia stimulates cells to produce a large amount of ROS³⁹. More and more evidence shown that ROS-mediated oxidative damage plays an important role in the pathogenesis of PAH. A variety of compounds with antioxidant properties have been shown to significantly attenuate pulmonary vasoconstriction due to hypoxia and have beneficial therapeutic effects in PAH⁴⁰. Moreover, ROS serve as important intracellular and intercellular messengers to promote PASMCs proliferation and inhibit apoptosis. Thus, targeting of ROS appears as a potential approach in PAH treatment⁴¹. Additionally, ROS can regulate the release of various vasoactive factors such as endothelin-1, thromboxane A₂, and prostacyclin, which can acutely affect vascular tension and lead to vascular remodeling in PAH^42,43. A substantial body of research suggests that excessive ROS production is involved in regulating hypoxia-induced PASMCs proliferation and PVR, and that the inhibition of ROS production can reverse this proliferation^44,45. ROS is the product of the cell metabolic process. The increase in ROS level will cause oxidative damage to DNA and protein⁴⁶. As a crucial end product of lipid oxidation, MDA is a vital index for evaluating oxidative damage. SOD is a crucial antioxidant enzyme that over clears ROS⁴⁷. Furthermore, it has been reported recently that the increase of lipid peroxidation is a medium for the pathogenesis and development of PAH, and anti-lipid peroxidation therapy is effective for the treatment of pulmonary artery pressure and pulmonary resistance in PAH⁴⁸. To explore whether the protective effects of SeMet are associated with its antioxidant effect, we measured the levels of antioxidant enzyme SOD and lipid peroxidation marker MDA in PASMCs. Our findings indicated that SeMet could reduce hypoxia-induced oxidative stress in cells, play an antioxidant role. Compared to the Hyp group, the levels of CAT, SOD, and T-AOC increased, and the levels of MDA and ROS decreased in the 10 µg/ml SeMet group. Conversely, the levels of MDA increased, the activities of CAT antioxidant enzymes decreased, and T-AOC decreased in the 40 µg/ml SeMet group. This phenomenon may be related to the toxic effect of high concentration of selenium on cells, that is, selenium has a narrow safety range^49,50. In this experiment, we also found that the cell activity was 66% under normoxic at 40 µg/ml, which showed low cytotoxicity⁵¹. A large amount of evidence has shown that ROS in PASMCs increases in hypoxia⁵². Our data showed that chronic hypoxia significantly increased the level of ROS in PASMCs. SeMet can significantly inhibit the production of ROS, and low concentrations of SeMet can increase the activity of CAT, SOD and increase T-AOC. These results suggest that SeMet attenuates hypoxia-induced oxidative stress in PASMCs and prevent the occurrence of HPH.

ROS can act as a signal molecule to activate HIF-1α⁵³. VEGF is a growth factor closely related to angiogenesis. The production of VEGF is mainly regulated by HIF-1α⁵⁴. Additionally, HIF-1α also regulates the downstream target gene ACE. Ang I to the active peptide hormone AngII by ACE⁵⁵. Studies have shown that inhibition of ACE can reduce the development of HPH and PVR⁵⁶. Additionally, AngII increased VEGF gene expression and promoter activation, and AngII induces HIF-1α protein production and increases HIF-1 DNA-binding activity⁵⁷. It has been found that HIF-1α and redox mechanism are involved in AngII-induced VEGF regulation in the kidney⁵⁷. Serum HIF-1α levels in children with HPH were found to be positively correlated with pulmonary systolic pressure⁵⁸. Deletion of the HIF-1α gene has previously been reported to downregulate VEGF signalling and abrogate haemodynamic changes in a murine model of HPH⁵⁹. Our results show that the expression of HIF-1α, AngII, and ACE of PASMCs is increased in hypoxia and the high expression is decreased by SeMet.

SeMet exhibited anti-proliferation, pro-apoptosis, and anti-oxidation effects on hypoxia-induced PASMCs. Our study found that SeMet may inhibit hypoxia-induced oxidative stress and proliferation in PASMCs by the ROS and the HIF-1α-ACE-AngII axis. SeMet provides a new idea for the study of HPH, and we also need to conduct animal experiments and clinical studies for further verification. Additionally, there are some limitations in our study such as the best experiment for cytotoxicity is LSD, and we also need further research to confirm the effect of selenium on cell migration and cell phenotype transformation.

Conclusion

In summary, SeMet inhibited cell proliferation, promoted cell apoptosis and prevented the remodeling of the pulmonary artery smooth muscle layer in hypoxia, by inhibiting the expression of PCNA, CyclinD1, and CollagenI proteins. Additionally, SeMet has an antioxidant effect, which can remove intracellular ROS and reduce HIF-1α activity, thereby regulating the HIF-1α-ACE-AngII axis and preventing the occurrence of HPH. This study can provide a basic reference for the prevention and treatment of PAH, and provide new ideas for the dietary treatment of HPH.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Author contributions

T.H.:Acquisition, analysis, and drafting of the manuscript. Z.C.D.：Project design. L. M.：Experimental guidance. S. L, Z.C.D.：Critical revision of the manuscript for important intellectual content. Y.T.M.：Statistical analysis. All authors contributed to the article and approved the submitted version.

Funding

The present study was supported by the Natural Science Foundation of China (grant no. 82260333), the basic research project of Qinghai province (grant no. 2023‑ZJ‑769), and the Kunlun Talents High‑end Innovation and Entrepreneurial Talents project in Qinghai province.

Data availability

All data presented in this study are available on request from the corresponding authors. The data are not uploaded to a publicly accessible database.

Declarations

Competing interests

The authors declare no competing interests.