Altered Methylation Levels in LINE-1 in Dental Pulp Stem Cell–Derived Osteoblasts

Abstract

Objectives

Long interspersed nuclear element-1 (LINE-1) and Alu elements are major targets of methylation, an epigenetic mechanism that is associated with several biological processes. Alterations of methylation of LINE-1 and Alu have been reported in cancers, diseases, and ageing. However, these alterations have not been studied in osteogenic differentiation of dental pulp stem cells (DPSCs), which are a promising source of tissue regeneration.

Method

This study was performed to investigate the methylation level of LINE-1 and Alu in dental pulp stem cell–derived osteoblasts (DPSC-DOs). By using the combined bisulfite restriction analysis, the levels of total methylation and 4 patterns of methylated cytosine-phosphate-guanine (CpG) dinucleotides of LINE-1 and Alu were compared between DPSC-DOs and DPSCs.

Result

The levels of total methylation and hypermethylated CpG dinucleotides of LINE-1 were significantly lower (P = .015 and .021, respectively), whilst levels of one pattern of partial methylated CpG dinucleotides were significantly higher in DPSC-DOs than DPSCs (P = .021). The methylation of Alu was not significantly different between DPSCs and DPSC-DOs.

Conclusions

Methylation alterations of LINE-1 but not Alu were found in osteogenic differentiation of DPSCs. The results of this study offer foundational insights into osteoblast differentiation from an epigenetic perspective and may contribute to advancements in bone regeneration therapy in the future.

Introduction

Human dental pulp stem cells (DPSCs) have become an interesting resource in the fields of tissue engineering and regenerative medicine owing to their special characteristics such as ability to self-renew and capability to develop into various cell types.¹ They could differentiate into osteoblasts and provide osteoinductive bone factors.^2,3 Moreover, they are easily harvested from the healthy tooth extracted according to the dental treatment plan, including wisdom tooth or orthodontic treatment, and can be cryopreserved for long-term storage.⁴ Therefore, DPSCs are an interesting tool for bone regeneration.

Stem cell differentiation is regulated by gene expressions that are under the influence of both genetic and epigenetic mechanisms. The genetic mechanism of osteogenic differentiation in DPSCs is similar to that of bone marrow mesenchymal stem cells, which is associated with specific growth factors and genes.^2,3 When activated by osteoblast-specific transcription factors such as Runt-related transcription factor 2, DPSCs express bone matrix proteins such as collagen type i, osteopontin, and osteoclacin. The proper expression of these genes was also controlled by the epigenetic mechanism that alters chromatin structure without modifying the underlying DNA sequence. This process facilitates the accessibility of genes to transcription factors and other regulatory elements.^5,6

Methylation is an important epigenetic mechanism that is associated with several biological processes, such as proper development,⁷ long-term gene silencing,^8,9 genomic imprinting^10,11 and X chromosome inactivation.¹² This mechanism involves the covalent addition of a methyl group to the fifth position of cytosine within cytosine-phosphate-guanine (CpG) dinucleotides present in the genome. DNA methylation represses the corresponding gene by tightly packing the chromatin structure, which impedes the binding of transcription factors to their targets. In osteogenic differentiation, the decreased methylation of bone-specific gene promotors such as osteocalcin resulted in increased expression of these genes.^13,14 However, many targets of methylation have never been studied.

The major targets of methylation reside in intersperse repetitive sequences, including long interspersed nuclear element-1 (LINE-1) and Alu. LINE-1 elements are autonomous, non-LTR retrotransposons that have more than 500,000 copies spread throughout the genome, some of them are located inside a gene body; these are known as intragenic LINE-1.¹⁵ The role of intragenic LINE-1 as cis-regulatory elements is important in cell differentiation and the maintenance of normal cellular function. Hypomethylation of LINE-1 is found in not only many kinds of cancer^5,16, 17, 18, 19, 20 but also autoimmune diseases such as systemic lupus erythematosus^21,22 and psoriasis vulgaris.²³

Alu elements are non-autonomous, non-LTR retrotransposons with more than 1,000,000 copies are inserted throughout the genome.²⁴ The aberrant Alu methylation can cause genomic instability, as seen in many types of cancer.^5,19,25 Alu hypomethylation is found in ageing and associated diseases, such as osteoporosis and type 2 diabetes mellitus.26, 27, 28 Increased Alu methylation levels could reduce endogenous DNA damage, which is a cause of genomic instability.²⁹

Changes in DNA methylation of intersperse repetitive sequences can be observed in levels and patterns. The measurement of methylation levels alone may not suffice to detect intersperse repetitive sequences of methylation changes in certain events. For example, there was no significant difference in the overall LINE-1 methylation level in the oral epithelium of smokers compared to nonsmokers, but differences in percentages of partially methylated patterns were discovered.³⁰ By using combined bisulfite restriction analysis (COBRA), we can differentiate intersperse repetitive sequences into the following 4 methylation patterns: hypermethylated, hypomethylated, and 2 forms of partially methylated loci.³¹ These patterns cannot be observed when using the pyrosequencing technique, which can only measure DNA methylation levels.¹⁷

To the best of our knowledge, methylation of LINE-1 and Alu in osteoblast derived from stem cells has never been reported. This study aimed to investigate the methylation levels and patterns of LINE-1 and Alu in dental pulp stem cell–derived osteoblasts (DPSC-DOs) by COBRA. The results of this study provide some basic information on osteoblast differentiation from the epigenetic perspective and may benefit bone regeneration therapy in the future.

Materials and methods

The protocol for this study was performed according to the Helsinki Declaration and approved by the Human Research Ethics Committee, Faculty of Dentistry, Chulalongkorn University (Approval No. 099 / 2017).

Dental pulp cell isolation and culture

Healthy adult patients (19–29 years), who had an impacted third molar removed as a part of their dental treatment plan, were asked whether they would voluntarily give their removed tooth for research purposes. Written consent was provided, and the removed teeth were obtained. The harvested dental pulp tissues from 9 nonpathologic impacted third molars were minced into small pieces (∼1–2 mm) and placed on 35-mm tissue culture dishes. Isolated cells were then cultured in Dulbecco's Modified Eagle Medium (Gibco BRL) supplemented with 10% foetal bovine serum, 2 mM L-glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, and 250 ng/mL amphotericin B. The cultures were maintained at 37 °C in a humidified 5% carbon dioxide atmosphere. The medium was refreshed every 48 hours. Once the cells reached confluence, they underwent a standard passaging procedure until the fourth passage was reached.

Osteogenic differentiation

The fourth passage of DPSCs from each participants was replicated into 6 tissue culture dishes that were equally allocated into 2 groups. The control group continued culture in Dulbecco's Modified Eagle Medium. The osteogenic differentiation group was cultured in osteogenic medium, which consisted of growth medium supplemented with 50 μg/mL ascorbic acid, 250 nM dexamethasone, and 5 mM β-glycerophosphate (Sigma-Aldrich Chemical) for 2 weeks. The medium was refreshed every 48 hours.

Characterisation

Stem cell verification

Flow cytometry was used to assess the expression of surface markers. DPSCs were stained with FITC conjugated anti-CD73 antibody, APC conjugated anti-CD90 antibody, PE-conjugated anti-CD105 antibody, and PerCP-conjugated anti-CD45 antibody (BD Biosciences Pharmingen). FACSCalibur (BD Bioscience Pharmingen) was used to analyse the expression values. Results were illustrated as mean fluorescence intensity.

Confirmation of osteogenic differentiation

Analysis of osteogenesis and mineralisation modulating genes, specifically Runt-related transcription factor 2, osterix, and alkaline phosphatase, was performed using real-time quantitative polymerase chain reaction (PCR) at day 3 after inducing osteogenic differentiation. Total cellular RNA was extracted using Trizol reagent (Roche Diagnostics). An amount of 1 µg of RNA samples was transformed into complementary DNA using the ImProm-II kit (Promega). Real-time PCR analysis was conducted using a SYBR Green I Master kit in a LightCycler Nano (Roche) on a MiniOpticon real-time PCR detection system (Bio-Rad). The PCR protocol was as follows: denaturation at 95 °C for 1 minute, followed by 40 cycles of amplification consisting of 95 °C for 10 seconds, 60 °C for 10 seconds, and 72 °C for 20 minutes and a melting curve analysis cycle. The reaction products were quantified using GAPDH as the reference gene. The primer sequences used are provided in Table I.

Table 1.

Primer sequences.

Gene	Primer sequence
Runt-related transcription factor 2 Alkaline phosphatase Osterix	Forward: 5’ ATGATGACACTGCCACCTCTGA 3’ Reverse: 5’ GGCTGGATAGTGCATTCGTG 3’ Forward: 5’ CGAGATACAAGCACTCCCACTTC 3’ Reverse: 5’ CTGTTCAGCTCGTACTGCATGTC 3’ Forward: 5’ GCCAGAAGCTGTGAAACCTC 3’ Reverse: 5’ GCTGCAAGCTCTCCATAACC 3’
GAPDH	Forward: 5’ CACTGCCAACGTGTCAGTGGTG 3’ Reverse: 5’ GTAGCCCAGGATGCCCTTGAG 3’

At week 2, the induced DPSCs were evaluated for matrix mineralisation using Alizarin red and Von Kossa staining. Cells were fixed with ice-cold methanol for 10 minutes and subsequently washed with deionised water. For Alizarin red staining, cells were incubated with 1% Alizarin red S solution (Sigma) for 3 minutes at room temperature and then washed extensively with deionised water to remove unbound stain. For Von Kossa staining, cells were fixed with 4% formalin in phosphate-buffered saline; then added to 3% AgNO3 solution and incubated under 100 W UV light for 60 minutes to develop colour.

DNA preparation for COBRA

DNA was extracted from the 2-week-cultured fourth-passage DPSCs and DPSC-DOs by using phenol-chloroform extraction. The DNA underwent bisulfite conversion using the EZ DNA Methylation Kit (Zymo Research) following the manufacturer's instructions.

Detection of LINE-1 methylation

The COBRA of LINE-1 was designed to detect 2 sites of CpG dinucleotide. Bisulfited DNA was amplified by using primers with the following sequences: LINE-1 forward 5’-GTTAAAGAAAGGGGTGA YGGT-3’ and LINE-1 reverse 5’-AATACRCCRTTTCTTAAACC RATCTA-3’. The PCR procedure consisted of an initial denaturation step at 95 °C for 15 minutes, followed by 35 cycles of annealing at 50 °C, and ending with a final extension at 72 °C for 7 minutes. The PCR products for LINE-1 (92 bp in length) were digested at 65 °C overnight with 2 units of TaqI (Thermo Fisher Scientific) and 2 units of TasI (Thermo Fisher Scientific) restriction enzymes. The DNA fragments were separated on 8% polyacrylamide gels and stained with the SYBR green (Gelstar), resulting in 5 separated bands of DNA. The intensity of these DNA fragments was assessed using a Phosphor Imager with ImageQuant software (Molecular Dynamics, GE Healthcare). To normalise interassay variation between experiments, DNA templates from the HeLa cell line were utilised as a control. Three replicates were performed in each experiment.

Detection of Alu methylation

The COBRA of Alu was used to detect 2 sites of CpG dinucleotide. Bisulfited DNA was amplified by using primers with the following sequences: Alu forward 5’-GGYGYGGTGGTTTAYGTTTGTAA -3’ and Alu reverse 5’-CTAACTTTTTATATTTTTAATAAAAACRAAATTTCACCA-3’. The PCR process was performed start by initial denaturation at 95 °C for 15 minutes, followed by 45 cycles of denaturation at 95 °C for another 45 seconds, annealing at 63 °C for 45 seconds, extension at 72 °C for 45 seconds, and ending with the final extension at 72 °C for 7 minutes. After amplification, the Alu PCR products (133 bp in length) were digested overnight at 65 °C with 2 units of TaqI restriction enzyme. The digested Alu amplicons were separated and stained with the same technique as COBRA of LINE-1 mentioned above. Three replicates were performed in each experiment.

LINE-1 methylation analysis

Amplicons from COBRA analysis of LINE-1 can be classified into 4 types based on the methylation status of the 2 CpG dinucleotides: methylated CpGs (mCmC), unmethylated CpGs (uCuC), 5’-methylated and 3’-unmethylated CpGs (mCuC), and 5’-unmethylated and 3’-methylated CpGs (uCmC). The TaqI and TasI digestion products were 92, 60, 50, 42, and 32 bp, according to the methylation status (Figure 1A). The percentages of methylation were calculated into 5 patterns according to the previous methods.³² Briefly, percentage of total LINE-1 methylation (%mC) = ((A + 2C + F) × 100) / (2A + 2B + 2C + 2F); percentage of methylated LINE-1 (%mCmC) = ((C / 2) × 100) / ((C / 2) + A + B + F); percentage of unmethylated LINE-1 (%uCuC) = (B × 100) / ((C / 2) + A + B + F); percentage of 5’ methylated LINE-1 (%mCuC) = (A × 100) / ((C / 2) + A + B + F); and percentage of 3’ methylated LINE-1 (%uCmC) = (F × 100) / ((C / 2) + A + B + F). A indicates the intensity of the 92-bp fragment divided by 92; B indicates the intensity of the 60-bp fragment divided by 56; C is the intensity of the 50-bp fragment divided by 48; D is the intensity of the 42-bp fragment divided by 40; E is the intensity of the 32-bp fragment divided by 28; and F = ((D + E) − (B + C)) / 2.

Fig. 1.

The patterns of long interspersed nuclear element-1 (LINE-1) and Alu methylation were detected from the combined bisulfite restriction analysis (COBRA) technique. LINE-1 (A) and Alu polymerase chain reaction products (B) were digested by the enzyme. The LINE-1 amplicons were 92, 60, 50, 42, and 32 bp. The Alu amplicons were 133, 90, 75, 58, 43, and 32 bp. These amplicons were classified into 4 DNA methylation patterns: mCmC, uCuC, uCmC, and mCuC, respectively.

Alu methylation analysis

Amplicons from COBRA analysis of Alu can be classified into 4 types based on the methylation status of 2 CpG dinucleotides: methylated CpGs (mCmC), unmethylated CpGs (uCuC), 5’-methylated and 3’-unmethylated CpGs (mCuC), and 5’-unmethylated and 3’-methylated CpGs (uCmC). The DNA fragments derived from TaqI digestion were 133, 90, 75, 58, 43, and 32 bp, according to the methylation status (Figure 1B). The percentages of methylation were calculated into 5 patterns using the following formula: percentage of total Alu methylation (%mC) = (100 × (E + B)) / (2A + E + B + C + D); percentage of methylated Alu (%mCmC) = (100 × F) / (A + C + D + F); percentage of unmethylated Alu (%uCuC) = (100 × A) / (A + C + D + F); percentage of 5’ methylated Alu (%mCuC) = (100 × D) / (A + C + D + F); and percentage of 3’ methylated Alu (%uCmC) = (100 × C) / (A + C + D + F). A indicates the intensity of the 133-bp fragment divided by 133; B indicates the intensity of the 58-bp fragment divided by 58; C is the intensity of the 75-bp fragment divided by 75; D is the intensity of the 90-bp fragment divided by 90; E is the intensity of the 43-bp fragment divided by 43; and F = (E + B) − (C + D).³³

Statistical analysis

The statistical analysis was performed using SPSS software for Windows version 28.0 (SPSS Inc.). Wilcoxon signed rank test was performed to test the difference of LINE-1 and Alu methylation levels between DPSC-DOs and DPSCs. A P value < .05 was considered statistically significant.

Results

Mesenchymal stem cell characterisation of DPSCs

The cells isolated from dental pulp tissue expressed the mesenchymal stem cell markers CD73 (mean [SD], 98.12% [0.51]), CD90 (mean [SD], 97.98% [1.89]), and CD105 (mean [SD], 99.10% [0.95]), whilst they did not express haematopoietic surface marker CD45 (0%) (Figure 2).

Fig. 2.

Flow cytometry analysis of expression of dental pulp stem cell mesenchymal stem cell markers CD73 (A), CD90 (B), and CD105 (C) and haematopoietic surface marker CD45 (D). Results showed that these cells expressed the mesenchymal stem cell markers, whilst not expressing haematopoietic surface markers.

Confirmation of osteogenic differentiation

From real-time PCR, Runt-related transcription factor 2, osterix, and alkaline phosphatase mRNA expression of DPSC-DOs were higher than DPSCs (Figure 3). Alizarin red and Von Kossa staining findings were positive in DPSC-DOs, whilst results were negative in DPSCs (Figure 4).

Fig. 3.

For osteoblast marker gene expression, the mRNA expression of Runt-related transcription factor 2, osterix, and alkaline phosphatase were evaluated using real-time quantitative polymerase chain reaction on day 3 of osteogenic induction. Upregulation of this gene in dental pulp stem cell–derived osteoblasts (error bars represent the standard error) was observed.

Fig. 4.

At 2 weeks, Alizarin red and Von Kossa staining results were positive in dental pulp stem cell–derived osteoblasts (DPSC-DOs). A, The mineral deposition of osteoblasts observed using Alizarin red staining was visualised as deep red colour, and Von Kossa staining was metallic silver. B, Microscopic images of dental pulp stem cells and DPSC-DOs after being stained with Alizarin red and Von Kossa (original magnification, 40×).

Methylation level of LINE-1

The average LINE-1 methylation level of each pattern is shown in Table 2. Using Wilcoxon signed rank test, %mC and %mCmC were significantly lower in DPSC-DOs than in DPSCs (P = .015 and .021, respectively). The %uCmC level was significantly higher in DPSC-DOs than in DPSCs (P = .021). There were no statistically significant differences of %uCuC and %mCuC between the groups (P = .173 and .515, respectively).

Table 2.

Percentage of LINE-1 and Alu methylation of DPSCs and DPSC-DOs in each methylation pattern.

Pattern	% LINE-1 methylation			% Alu methylation
	DPSC	DPSC-DO	P	DPSC	DPSC-DO	P
mC	65.48 ± 1.34	63.93 ± 1.53	.015*	52.24 ± 1.55	50.43 ± 1.36	.374
mCmC	48.30 ± 1.91	45.63 ± 1.79	.021*	28.70 ± 2.28	25.51 ± 1.97	.441
uCuC	16.72 ± 1.06	17.88 ± 1.54	.173	24.06 ± 0.76	25.62 ± 0.86	.214
uCmC	18.65 ± 1.29	21.27 ± 0.96	.021*	27.26 ± 1.03	27.26 ± 1.01	.214
mCuC	16.04 ± 0.60	16.35 ± 0.84	.515	19.85 ± 0.61	20.94 ± 0.68	.260

Values are presented as mean ± standard error. Wilcoxon signed rank test was used to compare the methylation percentage between DPSCs and DPSC-DOs. Asterisks represent statistical significance at P < .05.

DPSCs, dental pulp stem cell–derived; DPSC-DOs, dental pulp stem cell–derived osteoblasts; LINE-1, long interspersed nuclear element-1.

Methylation level of Alu

The average Alu methylation level of each pattern is shown in Table 2. By using Wilcoxon signed rank test, there were no statistically significant differences in %mC, %mCmC, %uCuC, %uCmC, and %mCuC between the groups (P = .374, .441, .214, .214, and .260, respectively).

Discussion

The human genome consists of both coding and noncoding regions of DNA, each with its own important functions in maintaining cellular processes. In this study, we focused on two major targets of methylation in specific noncoding regions called LINE-1 and Alu, which may act as regulators within the DNA. We aimed to understand how these regions might be involved in osteogenic differentiation in DPSCs. Our research provided valuable insights into the changes in methylation in LINE-1 and Alu during this process. Moreover, this study is the first report of methylation status of intersperse repetitive sequences in DPSC-DOs. LINE-1 and Alu are conserved sequences that contribute approximately 45% of the human genome and are randomly scattered throughout the genome.^12,34 Methylation of LINE-1 and Alu sequences has been shown to play a crucial role as a mechanism linked to cellular processes throughout development, ageing, and the initiation of tumours. The levels and patterns of LINE-1 methylation vary depending on the type of tissue, which may be due to the processes of cellular differentiation.^17,35,36 An association between intragenic LINE-1s and numerous genes that regulate biological processes including cell differentiation, cell proliferation, and genomic stability was reported.³⁷

This study revealed that DPSC-DOs possessed different LINE-1 methylation than DPSCs. The decrease in %mC of LINE-1 in osteogenic differentiation was in the same direction as those found in many diseases, such as cancers^19,31,38, 39, 40, 41 and autoimmune diseases.21, 22, 23 Whilst the decrease in %mCmC found in the osteogenic differentiation was in the same direction as autoimmune diseases,²² it increased in most cancers.^16,30,42 The alterations of %uCmC and %uCuC were also inconsistent between the osteogenic differentiation (increase %uCmC, unchanged %uCuC) and cancers (decrease %uCmC, increase %uCuC).^16,19,21, 22, 23^,30,31,38, 39, 40, 41, 42 The lower %mC might generally suggest that some changes were happening in the cells; however, it might be possible that LINE-1 methylation regulates diseases and osteogenic differentiation via different mechanisms. These findings confirm that DPSC-DOs can be used safely in the clinical application of tissue engineering and regenerative medicine.

The lower %mC of LINE-1 methylation in osteogenic differentiation might result from %mCmC turned into %uCmC. These less obvious alterations can cause DPSCs to differentiate into DPSO-DOs. Osteogenic differentiation is a multifaceted process characterized by the coordinated interaction of numerous transcription factors and signaling pathways.⁴³ We assumed that the partial methylation in the uCmC pattern of intragenic LINE-1, as cis-regulatory elements, may play a crucial role in osteogenic differentiation of DPSCs by facilitating the unpacking of chromatin structure in key genes involved in osteogenic differentiation. This finding suggests that methylation changes, not only at bone-specific gene promoters but also within non-coding regions of DNA, particularly LINE-1, may play a significant regulatory role in the osteogenic differentiation process. This study provided useful information for future work on developing stem cell-based therapies in osteogenic regeneration by using DPSCs. However, further studies are needed to evaluate which gene and which mechanism intragenic LINE-1 uses to regulate the osteogenic differentiation of DPSCs.

The alteration of Alu methylation in osteogenic differentiation could not be found in this study. Alu methylation was reported to be related to the ageing process. The level of Alu methylation decreased in ageing,²⁶ whilst it positively correlated with growth rate in young individuals.⁴⁴ Furthermore, Alu methylation is involved with some age-related conditions such as osteoporosis²⁷ and diabetes mellitus.²⁸ Our study used DPSCs from young individuals (19–29 years). This might be the reason that the difference in Alu methylation between DPSCs and DPSC-DOs in our study was not statistically significant.

The cells isolated from dental pulp tissue were cultured until reaching the fourth passage to obtain enough cells to perform the experiments. They were confirmed to be mesenchymal stem cells that expressed CD73, CD90, and CD105, but not the haematopoietic surface marker CD45.⁴⁵ DPSCs underwent osteogenic induction for 2 weeks, based on previous studies indicating that DPSC differentiation into osteoblasts can occur within this period.^46,47 Moreover, the alteration of Alu methylation was found in ageing,⁴⁸ so we avoided prolonged culturing of the DPSCs. The osteogenic differentiation of the induced DPSCs was confirmed by the expression of osteoblast-specific transcription factors including Runt-related transcription factor 2 and osterix. Additionally, the combined evidence of increased alkaline phosphatase mRNA, positive Alizarin red, and Von Kossa staining strongly suggests that DPSCs possess osteogenic potential, making them promising candidates for bone regeneration and tissue engineering.^2,3 Many studies used DPSCs in bone tissue engineering by combined with biomaterial templates, and the results showed that the group of biomaterials with DPSCs has more potential in bone tissue regeneration than the control group.^49,50 However, these studies are limited to only animal studies. An accumulation of basic and clinical data concerning DPSCs is still needed before wide clinical application.

GAPDH is one of the most commonly used housekeeping genes. Studies have indicated that within-tissue variation of GAPDH mRNA expression levels is generally small.⁵¹ This study compared gene expression between DPSCs and DPSC-DOs that were from the same tissue type and the same participant, we consider GAPDH to be a suitable control housekeeping gene.

COBRA of repetitive elements, such as Alu and LINE-1, serves as an effective surrogate marker for assessing genome-wide DNA methylation. This method offers distinct advantages over other techniques like chromatography and pyrosequencing, particularly in terms of requiring less DNA, reduced processing time, and lower costs.³⁵ Additionally, COBRA of LINE-1 is capable of detecting specific methylation pattern changes that occur under certain conditions, such as smoking and cancer, where other techniques may fall short.^30,31 This ability to identify condition-specific methylation changes makes COBRA a valuable tool in both research and clinical diagnostics.

Our findings could not compare the alteration of intersperse repetitive sequences methylation in human osteoblasts since this has not been reported yet. Therefore, further study is recommended to compare the methylation level and patterns of intersperse repetitive sequences between DPSC-DOs and human osteoblasts. Moreover, to gain a deeper understanding of how LINE-1 influences osteogenic change, the specific mechanisms and outcomes related to these methylation changes need to be clarified in future studies.

Conclusions

In summary, %mC and %mCmC methylation patterns of LINE-1 in DPSC-DOs were significantly lower, whilst %uCmC was significantly higher when compared to DPSCs; however, Alu methylation did not show any changes. The epigenetic mechanism may play a role in the osteogenic differentiation process of DPSC.

Conflict of interest

None disclosed.