Abstract
Brucellosis is a bacterial zoonosis caused by various Brucella species, affecting both animals and humans. The incidence is particularly high in tropical and subtropical regions that are known for higher tick density. Present study was designed to improve our knowledge regarding Brucella melitensis infection in Pakistani cattle. A total of 903 blood samples were collected. Three cattle breeds, Holstein Friesian (N = 298), Sahiwal (N = 299), and crossbred (N = 306), were enrolled along with epidemiological data during March 2022 till April 2023 from district Multan in Punjab province. A PCR-based approach targeting IS711 estimated an overall prevalence of 4% (39/903). Representative partial IS711 sequences of three Pakistani isolates revealed a single genotype that was similar to Brucella melitensis sequences reported from aborted fetus in China. All cattle breeds were equally susceptible to this infection. For Sahiwal breed, bacterial infection varied between sampling seasons. Epidemiological factor analysis revealed that farms where only cattle were reared and dogs at farm having tick load had higher Brucella melitensis infection rates. Red blood cells, lymphocyte (%), monocyte (%), mean cell volume, hematocrit, mean corpuscular hemoglobin concentration and platelet count were significantly disturbed in Brucella melitensis positive cattle of all three breeds. A longitudinal survey and phylogenetic positioning of Brucella melitensis is recommended for epidemiological correlation, diagnosis and treatment of brucellosis in Pakistan.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-025-94370-x.
Keywords: Brucella melitensis, Molecular prevalence, Risk factors, Phylogenetic analysis, Cattle breeds
Subject terms: Genetics, Microbiology, Molecular biology
Introduction
Livestock sector plays an important role in the growing economy of Pakistan. Punjab province has diverse genetic resources, as far as the domestic animals are concerned, as it is the territory tract of the famous Nili-Ravi buffalo and the Sahiwal cow that are commonly raised here to meet the growing demand for milk and meat1. Various parasitic and bacterial infections hinder the growth of the livestock sector in Pakistan2. A number of biotic and abiotic factors play their role in the transmission of these infections including contaminated food, water, soil or flies, mites and ticks that act as the vector for large number of pathogens3. Pakistan is located in warm climate zones of the world, with a hot and humid climate suitable for tick growth that has made Pakistan endemic for tick-borne diseases4. These tick-borne infections cause huge economic losses annually as they results in decreased milk, meat and skin production, body weight reduction, morbidity and mortality5.
Brucellosis is a bacterial disease that affects animals as well as humans and it is caused by a variety of Brucella species including Brucella melitensis, Brucella abortus, Brucella canis, Brucella suis6. Among Brucella species, Brucella melitensis is the most pathogenic and a primary cause of brucellosis in humans and animals7. Initially, Brucella melitensis was known to infect sheep and goats but it an established fact now that this bacterium can equally infect the large ruminants as well8. Ticks are known reservoirs of Brucella species but usually ruminants get this infection through their direct contact with vaginal discharges, aborted fetuses, placental membranes or by ingestion of contaminated water and food9. Brucellosis is associated with reproductive problems in ruminants and it is known to cause abortions, stillbirth and infertility in small and large domestic animals. It is also known to cause arthritis in cows and pigs, mastitis and lameness in goats and oozing skin lesions in horses10. There is no practical treatment available to treat brucellosis in animals and repeated testing and culling approach is usually used to eradicate the infection8.
Although serological testing is the most widely used technique for the detection of Brucella species, but these methods are known to generate false positive results as well11. PCR is not commonly used for detecting Brucella melitensis in large ruminants in Pakistan. Additionally, seasonal variations in Brucella melitensis prevalence has never been reported before which is essential for evaluating the impact of bovine brucellosis and their potential for spreading. Furthermore, the impact of Brucella melitensis on the complete blood count (CBC) of cattle remains unreported. Hence, the present investigation was designed to provide temporal data essential to estimate the risk of bovine brucellosis in Pakistan.
Materials and methods
Study area and experimental design
A seasonal epidemiological survey was conducted in district Multan in Punjab (Pakistan). This district is among the oldest civilization in South East Asia and lies between 29° 19′11′′ to 30° 28′16′′ latitude N and 70° 58′34′′ to 71° 43′25′′ longitude E (Fig. 1). It has a dry climate with an average rainfall of 127 mm. The temperature ranges between 4.5˚C in winters to 50˚C during summer12.
Fig. 1.
Map of Pakistan with Punjab province is highlighted in dark green while Multan district is highlighted in purple color. Cattle blood samples collection sites are marked in district Multan. Map was created by using the QGIS software (version 3.22.8-Białowieża https://qgis.org/). The entire shape file having the administrative, provincial and district bounders were downloaded from the website DIVA-GIS, under the tab free spatial Data.
Solvin’s formula was used to estimate the total sample size that was collected during present study and the calculated number was equally divided into four seasons (N = 225 each season) as described previously13. A total of 903 blood samples were randomly collected from three apparently healthy cattle breeds (Holstein Friesian = 298, Sahiwal breed = 299 and Crossbred = 306) at livestock farms in and around Multan district during March 2022 till April 2023 following the informed consent of livestock owners. May till July was considered as summer, August till October was autumn, November, December and January were winter while February till April were considered as and spring season.
Blood sample and data collection
All enrolled animals underwent thorough veterinary examination and 3–5 ml of blood was collected from Jugular vein of each animal in screw-capped labelled tubes containing EDTA as an anticoagulant. A predesigned questionnaire was filled for each animal with the help of their owners to collect epidemiological data in order to investigate their association with the prevalence of Brucella spp. in cattle during present study.
Complete blood count analysis and DNA extraction
Hematological parameters [white blood cell, lymphocytes (%), monocytes (%), red blood cell, hemoglobin, hematocrit, mean cell volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration and platelets count] were analyzed in all cattle blood samples by using automated hematological analyzer (Mythic™ 18 Vet, Orphee, Switzerland). DNA extraction from blood samples was performed by an inorganic method as previously described by Parveen et al.14. The quality of the extracted DNA was assessed by using submerged gel electrophoresis.
PCR-based amplification of Brucella spp
A multiplex PCR based approach was used for the detection of Brucella spp. (bcsp31 gene was target by using primers F 5′GCTCGGTTGCCAATATCAATGC3′ and R 5′GGGTAAAGCGTCGCCAGAAG3′), Brucella abortus (IS711 gene was target by using primers F 5′GCGGCTTTTCTATCACGGTATTC3′ and R 5′CATGCGCTATGATCTGGTTACG3′) and Brucella melitensis (IS711 gene was target by using primers F 5′AACAAGCGGCACCCCTAAAA3′ and R 5′CATGCGCTATGATCTGGTTACG3′) following Probert et al.15. A reaction mixture of 50 ul was created as described by Probert et al.15 containing 50ng of template DNA, 5 ul of 10X PCR buffer, 1.5 mM MgCl2, 0.125 mM of each dNTP, 0.6 mM of each primer, 1Ul of Taq DNA polymerase (AbClonal, USA) balanced by double distilled water.
The thermo-profile consisted of an initial denaturation at 94ºC for 10 min followed by 35 cycles of denaturation at 94˚C for 1 min, annealing at 60ºC for 30 s and extension at 72ºC for 45 s. A final elongation was carried out at 72˚C for 5 min15. Brucella abortus positive (Kindly donated by Dr. Shahzad Ali, UVAS Lahore, Pakistan) and negative samples were also used during each PCR reaction as positive and negative controls, respectively.
DNA sequencing and phylogenetic analysis
Three partial IS711 gene sequences of Brucella melitensis were confirmed via DNA sequencing and submitted to GenBank and accession numbers PP484552, PP484553 and PP484554 were assigned to them. The generated sequences were screened in FinchTV (version 1.4.0) to remove the low-quality nucleotide at both ends of the sequence. The remaining clean sequences were saved in FASTA format and used in BLAST analysis. Similar sequences were downloaded from BLAST output to be used in the phylogenetic analysis. Theses sequences were first aligned by using ClustalW multiple sequence alignment tool followed by substitution model selection using BIC and AIC values of the MEGA’s integrated model selection tool. Finally, the phylogenetic tree was inferred using Maximum Likelihood method with 1000 bootstrap. The final version of the inferred tree was generated using the iTOL server. 18 S rRNA gene of Rickettsia raoultii (DQ365812) served as an out group for this study.
Statistical analysis
Statistical package Minitab (Minitab, Pennsylvania, USA) was used for the statistical analysis of data. Data was expressed as mean values ± standard error of mean and probability levels of P < 0.05 were considered significant. PCR based bacterial prevalence between various cattle breeds and sampling seasons was calculated by using one way ANOVA. Association between the presence of Brucella melitensis and studied epidemiological factors was assessed by contingency table analysis using the Fisher’s exact test (for 2 × 2 tables). Two sample t-test was calculated to compare complete blood count parameters between pathogen positive and negative animals.
Results
Prevalence of Brucella spp. In cattle blood
PCR amplification of the bcsp31 gene detected Brucella spp. in 39 of 903 (4%) cattle blood samples that were collected during present investigation from Multan district. The DNA samples that were positive for Brucella genus specific bcsp31 gene was also positive for Brucella melitensis when the species-specific primers were used that were targeting the IS711 gene of the bacterium. None of the DNA samples was positive for Brucella abortus. All three breeds (Holstein Friesian, Sahiwal and Crossbred) screened in this investigation had this bacterial infection with slightly higher rate in crossbred than the other two breeds. One-way ANOVA indicated no significant difference in Brucella melitensis prevalence across cattle breeds enrolled in this study (P = 0.7) (Supplementary Table 1).
Sequence confirmation and genetic diversity of Brucella melitensis
DNA sequencing confirmed the bacterial presence as the subsequent BLAST analysis of the amplified sequences indicated that cattle were infected with Brucella melitensis. Analysis of the partial IS711 gene sequence of Brucella melitensis revealed that the amplified haplotypes were genetically similar as they resided in the same cluster as shown in Fig. 2. Amplified haplotypes (PP484552, PP484553 and PP484554) grouped with the Brucella melitensis sequence reported from China (MK913897 and MK913898). Our sequences showed similarity with the Brucella abortus sequences deposited from Italy (CP098043, CP098045 and CP098047) indicating that the genetic composition of IS711 is very similar in these two bacterial species (Fig. 2).
Fig. 2.
Phylogenetic tree of Brucella melitensis based on the partial IS711 gene sequences available in GenBank. The three haplotypes (PP484552, PP484553 and PP484554) generated in this study are highlighted in yellow.
Molecular epidemiology of Brucella melitensis in Holstein Friesian cattle
Overall 11 out of 298 (04%) Holstein Friesian cattle that were of screened from Multan district during were found infected with Brucella melitensis. This bacterium was detected during all four seasons. One-way ANOVA results revealed that prevalence of melitensis was not restricted to a particular season (P = 0.9) (Table 1). Fischer exact test analysis revealed that none of the studied epidemiological factors was found associated with the prevalence of Brucella melitensis in Holstein Friesian cattle that were enrolled during spring, summer and autumn (for all parameters P > 0.05). For winter season, it was observed that that farms where only cattle were kept had higher Brucella melitensis infection than the farms where cattle were raised along with other animals (P = 0.03) (Table 2).
Table 1.
Seasonal prevalence of Brucella melitensis among the blood samples of the Holstein Friesian, Sahiwal and crossbred cattle that were screened during present study. % prevalence is given in the parenthesis. P value represents the output of one-way ANOVA.
| Sampling seasons | Brucella melitensis positive Holstein Friesian | P-value | Brucella melitensis positive Sahiwal | P-value | Brucella melitensis positive Crossbred | P-value |
|---|---|---|---|---|---|---|
| Spring | 02/74 (03%) | 11/75 (15%) | 04/75 (05%) | |||
| Summer | 03/75 (04%) | 02/75 (3%) | 02/75 (03%) | |||
| Autumn | 03/75 (04%) | 0.9 | 0/74 (0%) | 0.008** | 02/76 (03%) | 0.2 |
| Winter | 03/74 (04%) | 0/75 (0%) | 07/80 (09%) | |||
| Total | 11/298 (04%) | 13/299 (04%) | 15/306 (05%) |
P > 0.05 = Non-significant; P < 0.01 = Significant (**).
Table 2.
Association of studied epidemiological parameters with the prevalence of Brucella melitensis in Holstein Friesian cattle enrolled from Multan district during four seasons.
| Parameters | Brucella melitensis + ive samples from Spring |
P value | Brucella melitensis + ive samples from Summer | P- value | Brucella melitensis + ive samples from Autumn | P-value | Brucella melitensis + ive samples from Winter |
P-value | |
|---|---|---|---|---|---|---|---|---|---|
| Tick load | Yes | 00/25 (0%) | 0.5 | 01/30 (3%) | 01 | 01/20 (5%) | 1 | 03/55 (5%) | 0.5 |
| No | 02/49 (4%) | 02/45 (04%) | 02/55 (4%) | 00/19 (0%) | |||||
| Other dairy animals at farm | Yes | 00/6 (0%) | 01 | 03/58 (05%) | 01 | 02/28 (7%) | 0.5 | 00/51 (0%) | 0.03* |
| No | 02/68 (3%) | 00/17 (0%) | 01/47 (2%) | 03/23 (13%) | |||||
| Dogs at farm | Yes | 02/30 (07%) | 0.2 | 03/51 (6%) | 0.5 | 01/46 (2%) | 0.5 | 02/66 (3%) | 0.3 |
| No | 00/44 (0%) | 00/24 (0%) | 02/29 (7%) | 01/08 (12%) | |||||
| Tick load on dogs | Yes | 01/11 (09%) | 0.3 | 03/51 (6%) | 0.5 | 01/29 (3%) | 01 | 02/58 (3%) | 0.5 |
| No | 01/63 (6%) | 00/24 (0%) | 02/46 (4%) | 01/16 (6%) | |||||
Prevalence of Brucella melitensis is given in parenthesis. P-values indicate the results of Fischer exact test calculated for each studied parameter.
P > 0.05 = Non significant; P < 0.05 = Least significant (*).
Complete blood count analysis revealed that Brucella melitensis infected Holstein Friesian cattle enrolled during spring season had significantly reduced lymphocytes (P = 0.04), monocytes (P = 0.03) and increased platelets (P < 0.0001) counts than uninfected cattle. From the data generated during summer season, it was observed that Brucella melitensis infected cattle had significantly reduced lymphocytes (P = 0.05) and mean corpuscular hemoglobin concentration (P = 0.04) than bacterium uninfected cattle. All other studied parameters varied non-significantly (P > 0.05) during four sampling seasons upon comparison between Brucella melitensis positive and negative Holstein Friesian cattle (P > 0.05) (Table 3).
Table 3.
Comparison of studied complete blood count parameters between Brucella melitensis positive and negative Holstein Friesian cattle enrolled from district Multan during four seasons. Data is expressed as mean ± standard error of mean. P-value indicates the result of two sample t–test calculated for each studied parameter.
| Parameters | Spring | Summer | Autumn | Winter | ||||
|---|---|---|---|---|---|---|---|---|
| B. melitensis (+ ive) (n = 02) |
B. melitensis (-ive) (n = 72) |
B. melitensis (+ ive) (n = 03) |
B. melitensis (-ive) (n = 72) |
B. melitensis (+ ive) (n = 03) |
B. melitensis (-ive) (n = 72) |
B. melitensis (+ ive) (n = 03) |
B. melitensis (-ive) (n = 71) |
|
| White blood cell | 09.9 ± 1.0 | 09.6 ± 0.3 | 8.1 ± 0.2 | 8.4 ± 0.2 | 10.5 ± 0.6 | 10.7 ± 0.3 | 08.3 ± 0.6 | 08.1 ± 0.1 |
| Lymphocytes (%) | 38.8 ± 1.7 | 46.5 ± 1.6* | 49.0 ± 1.5 | 53.4 ± 1.3* | 47.4 ± 13 | 44.3 ± 2.3 | 40.3 ± 5.5 | 33.5 ± 1.5 |
| Monocytes (%) | 02.6 ± 0.3 | 04.8 ± 0.2* | 02.9 ± 0.7 | 04.8 ± 0.24 | 03.4 ± 0.7 | 02.5 ± 0.2 | 10.0 ± 2.9 | 05.8 ± 0.7 |
| Red blood cells (x 106 µ/L) | 05.4 ± 0.4 | 05.8 ± 0.1 | 05.4 ± 0.4 | 05.1 ± 0.1 | 05.0 ± 0.6 | 04.9 ± 0.1 | 04.8 ± 0.5 | 04.6 ± 0.1 |
| Haemoglobin (gd/L) | 09.2 ± 1.2 | 09.6 ± 0.2 | 08.2 ± 1.1 | 07.9 ± 0.1 | 09.1 ± 0.4 | 08.7 ± 0.1 | 08.8 ± 0.5 | 08.7 ± 0.1 |
| Hematocrit (%) | 24.2 ± 3.4 | 26.1 ± 0.4 | 25.3 ± 3.3 | 23.8 ± 0.5 | 26.5 ± 0.8 | 26.2 ± 0.6 | 38.0 ± 2.7 | 39.6 ± 1.0 |
| Mean cell volume (fL) | 44.9 ± 2.5 | 45.2 ± 0.5 | 47.0 ± 2.3 | 46.6 ± 0.8 | 56.0 ± 10 | 56.7 ± 2.2 | 77.6 ± 1.8 | 76.7 ± 1.0 |
| Mean corpuscular haemoglobin (pg) | 16.9 ± 0.8 | 16.6 ± 0.2 | 14.7 ± 0.9 | 14.6 ± 0.1 | 19.3 ± 3.9 | 19.1 ± 0.7 | 29.5 ± 1.4 | 30.3 ± 0.5 |
| Mean corpuscular haemoglobin concentration (g/dL) | 37.9 ± 0.3 | 36.9 ± 0.4 | 31.6 ± 0.3 | 32.9 ± 0.5* | 32.4 ± 1.3 | 34.7 ± 0.5 | 35.1 ± 1.3 | 34.5 ± 0.5 |
| Platelets ( x 103 µ/L) | 418.0 ± 9.0 | 309 ± 14*** | 364.3 ± 44 | 300 ± 14 | 269 ± 26 | 255 ± 14 | 292.3 ± 8.8 | 272.4 ± 6.4 |
P > 0.05 = Non significant; P < 0.05 = Least significant (*); P < 0.001 = Highly significant (***).
Molecular epidemiology of Brucella melitensis in Sahiwal cattle
Overall 13 out of 299 (04%) screened Sahiwal cattle blood samples were found infected with Brucella melitensis. Infection was only detected in samples collected during spring and summer seasons. One-way ANOVA results revealed that prevalence of Brucella melitensis varied significantly between the sampling seasons (P = 0.008). Highest infection rate was observed during spring season (15%) followed by summer (03%). None of the enrolled animals during autumn and winter were found infected with Brucella melitensis (Table 1). During the spring season screening, data analysis revealed that cattle kept at the farm where dogs were present having tick load were more susceptible to develop Brucella melitensis infection than the farms having dogs without tick load (P = 0.05). While none of the other studied risk factor was found associated with the prevalence of Brucella melitensis in Sahiwal cattle that were enrolled during spring or summer season (for all parameters P > 0.05) (Table 4). This analysis was not possible for the cattle enrolled during autumn and winter seasons as none of the screened Sahiwal cattle was infected with Brucella melitensis.
Table 4.
Association of studied epidemiological parameters with the prevalence of Brucella melitensis in Sahiwal cattle breed enrolled from Multan district during four seasons. Prevalence of Brucella melitensis is given in parenthesis. P-values indicate the results of Fischer exact test calculated for each studied parameter.
| Parameters | Brucella melitensis + ive samples from Spring |
P value | Brucella melitensis + ive samples from Summer | P- value | |
|---|---|---|---|---|---|
| Tick load | Yes | 06/32 (19%) | 0.5 | 01/24 (04%) | 0.5 |
| No | 05/43 (12%) | 01/51 (02%) | |||
| Other dairy animals at farm | Yes | 10/68 (15%) | 01 | 02/68 (03%) | 01 |
| No | 01/07 (14%) | 00/07 (00%) | |||
| Dogs at farm | Yes | 09/44 (20%) | 0.1 | 02/62 (03%) | 01 |
| No | 02/31 (06%) | 00/13 (00%) | |||
| Tick load on dogs | Yes | 08/34 (24%) | 0.05* | 02/62 (03%) | 01 |
| No | 03/41 (07%) | 00/13 (00%) | |||
P > 0.05 = Non significant; P < 0.05 = Least significant.
Two sample t-test results revealed that Brucella melitensis infected Sahiwal cattle that were enrolled during spring season had significantly elevated white blood cells (P = 0.05) and hemoglobin (P = 0.05) concentration than uninfected animals. While the bacterium infected Sahiwal cattle enrolled during spring season had significantly reduced lymphocytes (P = 0.04) and mean cell volume (P = 0.05) than uninfected cattle (Table 5). All other studied parameters for both spring and summer seasons varied non-significantly (P > 0.05) when compared between Brucella melitensis infected and uninfected Sahiwal cattle.
Table 5.
Comparison of studied complete blood count parameters between Brucella melitensis positive and negative Sahiwal cattle blood samples collected from district Multan during four seasons.
| Parameters | Spring | Summer | ||
|---|---|---|---|---|
| B. melitensis (+ ive) (n = 11) |
B. melitensis (-ive) (n = 64) |
B. melitensis (+ ive) (n = 02) |
B. melitensis (-ive) (n = 73) |
|
| White blood cell | 09.9 ± 0.8 | 08.4 ± 0.2* | 09.3 ± 0.3 | 07.3 ± 0.2 |
| Lymphocytes (%) | 39.8 ± 5.0 | 37.2 ± 1.9 | 83.0 ± 1.0 | 76.9 ± 0.7* |
| Monocytes (%) | 04.7 ± 0.5 | 04.9 ± 0.2 | 03.0 ± 1.0 | 03.3 ± 0.1 |
| Red blood cells (x 106 µ/L) | 08.6 ± 2.9 | 05.8 ± 0.1 | 04.4 ± 0.5 | 04.2 ± 0.1 |
| Haemoglobin (gd/L) | 09.7 ± 0.3 | 09.0 ± 0.1* | 09.8 ± 1.4 | 09.3 ± 0.1 |
| Hematocrit (%) | 28.3 ± 1.7 | 25.5 ± 0.5 | 34.0 ± 1.0 | 31.6 ± 0.8 |
| Mean cell volume (fL) | 45.2 ± 1.3 | 43.7 ± 0.9 | 62.5 ± 2.5 | 82.8 ± 1.2* |
| Mean corpuscular haemoglobin (pg) | 15.4 ± 0.5 | 17.8 ± 1.7 | 25.0 ± 1.0 | 19.9 ± 0.5 |
| Mean corpuscular haemoglobin concentration (g/dL) | 34.8 ± 2.1 | 34.7 ± 0.7 | 31.0 ± 5.0 | 29.9 ± 0.4 |
| Platelets ( x 103 µ/L) | 258.8 ± 24 | 265 ± 15 | 102.5 ± 57 | 269 ± 32 |
Data is expressed as mean ± standard error of mean. P-value indicates the result of two sample t–test calculated for each studied parameter.
P > 0.05 = Non-significant; P < 0.05 = Least significant (*).
Molecular epidemiology of Brucella melitensis in crossbred cattle
Overall 15 out of 306 (05%) screened crossbred cattle were found infected with Brucella melitensis. Bacterium was detected during all four sampling seasons in crossbred cattle. One-way ANOVA results revealed that prevalence of this pathogen was not restricted to a particular season (P = 0.2) (Table 1). Fischer exact test-based analysis revealed that none of the studied epidemiological factors was found associated with the prevalence of Brucella melitensis in crossbred cattle enrolled during four sampling seasons during present investigation (for all parameters P > 0.05) (Table 6).
Table 6.
Association of studied epidemiological parameters with the prevalence of Brucella melitensis in crossbred cattle enrolled from Multan district during four seasons.
| Parameters | Brucella melitensis + ive samples from Spring |
P value | Brucella melitensis + ive samples from Summer | P- value | Brucella melitensis + ive samples from Autumn | P-value | Brucella melitensis + ive samples from Winter |
P-value | |
|---|---|---|---|---|---|---|---|---|---|
| Tick load | Yes | 02/40 (05%) | 01 | 01/64 (02%) | 0.3 | 02/63 (03%) | 1 | 04/64 (06%) | 0.1 |
| No | 02/35 (06%) | 01/11 (09%) | 00/13 (0%) | 03/16 (19%) | |||||
| Other dairy animals at farm | Yes | 01/32 (03%) | 0.6 | 02/43 (05%) | 0.5 | 02/57 (04%) | 01 | 03/38 (08%) | 01 |
| No | 03/43 (07%) | 00/32 (00%) | 0/19 (0%) | 04/42 (10%) | |||||
| Dogs at farm | Yes | 03/49 (06%) | 01 | 02/60 (03%) | 01 | 02/44 (05%) | 0.5 | 05/67 (07%) | 0.3 |
| No | 01/26 (04%) | 00/15 (00%) | 0/32 (0%) | 02/13 (15%) | |||||
| Tick load on dogs | Yes | 01/10 (10%) | 0.4 | 02/60 (03%) | 01 | 01/35 (03%) | 01 | 05/69 (07%) | 0.2 |
| No | 03/65 (05%) | 00/15 (00%) | 01/41 (02%) | 02/11 (18%) | |||||
Prevalence of Brucella melitensis is given in parenthesis. P-values indicate the results of Fischer exact test calculated for each studied parameter.
P > 0.05 = Non significant.
Analysis of the studied complete blood count parameters indicated that Brucella melitensis infected crossbred cattle that were enrolled during spring season had significantly reduced monocytes (P = 0.02) and increased red blood cell count (P = 0.05) than uninfected animals. While animals enrolled during summer had significantly elevated lymphocytes (P = 0.05) and mean cell volume (P < 0.0001) than uninfected cattle. While bacterium infected crossbred cattle enrolled during winter season had significantly reduced monocytes (P = 0.05), red blood cells (P = 0.008) and hematocrit (P = 0.04) than uninfected animals. None of the studied parameters varied significantly (P > 0.05) when compared between Brucella melitensis infected and uninfected crossbred cattle enrolled during autumn season (Table 7).
Table 7.
Comparison of studied complete blood count parameters between Brucella melitensis positive and negative blood samples of crossbred cattle enrolled from district Multan during four seasons.
| Parameters | Spring | Summer | Autumn | Winter | ||||
|---|---|---|---|---|---|---|---|---|
| B. melitensis (+ ive) (n = 04) |
B. melitensis (-ive) (n = 71) |
B. melitensis (+ ive) (n = 02) |
B. melitensis (-ive) (n = 73) |
B. melitensis (+ ive) (n = 02) |
B. melitensis (-ive) (n = 74) |
B. melitensis (+ ive) (n = 07) |
B. melitensis (-ive) (n = 73) |
|
| White blood cell | 12.0 ± 2.3 | 09.9 ± 0.4 | 07.4 ± 1.8 | 08.2 ± 0.8 | 09.9 ± 1.3 | 11.2 ± 1.3 | 09.1 ± 1.3 | 08.4 ± 0.3 |
| Lymphocytes (%) | 63.5 ± 11 | 55.0 ± 2.6 | 81.0 ± 1.0 | 77.1 ± 0.7* | 27.5 ± 2.5 | 23.4 ± 1.4 | 39.7 ± 6.0 | 35.6 ± 1.3 |
| Monocytes (%) | 02.8 ± 0.5 | 04.8 ± 0.2* | 05.0 ± 1.0 | 04.0 ± 0.1 | 03.5 ± 0.5 | 03.1 ± 0.05 | 04.7 ± 0.4 | 05.9 ± 0.5* |
| Red blood cells (x 106 µ/L) | 06.7 ± 0.4 | 05.7 ± 0.1* | 04.4 ± 0.1 | 04.5 ± 0.1 | 04.1 ± 0.2 | 04.4 ± 0.09 | 04.0 ± 0.2 | 04.7 ± 0.08** |
| Haemoglobin (gd/L) | 10.4 ± 1.4 | 08.9 ± 0.2 | 11.3 ± 1.0 | 09.1 ± 0.1 | 10.1 ± 1.1 | 11.1 ± 0.2 | 08.5 ± 0.2 | 08.7 ± 0.1 |
| Hematocrit (%) | 31.1 ± 2.7 | 25.6 ± 0.5 | 36.5 ± 5.5 | 32.6 ± 0.9 | 30.5 ± 4.5 | 35.5 ± 0.8 | 32.3 ± 2.7 | 39.4 ± 0.9* |
| Mean cell volume (fL) | 46.3 ± 1.4 | 44.1 ± 0.5 | 86.5 ± 0.5 | 76.4 ± 1.8*** | 76.5 ± 7.5 | 81.7 ± 0.7 | 76.6 ± 4.1 | 76.6 ± 0.9 |
| Mean corpuscular haemoglobin (pg) | 15.1 ± 1.2 | 14.9 ± 0.2 | 25.0 ± 7.0 | 20.1 ± 0.6 | 19.0 ± 3.0 | 26.1 ± 0.7 | 27.7 ± 1.6 | 30.2 ± 0.5 |
| Mean corpuscular haemoglobin concentration (g/dL) | 32.6 ± 1.6 | 34.3 ± 0.5 | 34.0 ± 2.0 | 29.1 ± 0.5 | 33.5 ± 1.5 | 33.7 ± 0.2 | 33.6 ± 0.7 | 32.9 ± 0.3 |
| Platelets ( x 103 µ/L) | 202.3 ± 48 | 251 ± 18 | 344.0 ± 68 | 213.8 ± 11 | 262 ± 92 | 239.5 ± 11 | 270.0 ± 17 | 286.8 ± 8.9 |
Data is expressed as mean ± standard error of mean. P-value indicates the result of two sample t–test calculated for each studied parameter.
P > 0.05 = Non significant; P < 0.05 = Least significant (*); P < 0.01 = Significant (**) P < 0.001 = Highly significant (***).
Discussion
Bovine brucellosis is among the prevalent diseases of not only the local cattle but this disease has also been reported in exotic cattle as well as in their crossbred with local animals8. The prevalence of the infectious agents causing this disease and the risk factors associated with them has not been explored in great detail from various parts of Pakistan in general and in Punjab province specifically. Hence, in the present investigation, we are reporting the molecular and seasonal prevalence of Brucella melitensis in the blood samples of apparently healthy cattle collected from Multan district in Southern Punjab (Pakistan) with a note on the risk factors that were found associated with this infection.
Infection with Brucella spp. results in abortion in the last stage of pregnancy in female cattle and leads to orchitic and bursitis in male cattle16. Earlier, Rose Bengal (serum agglutination) test was considered to be a gold standard for the detection of Brucella species among small and large ruminants but recently it has been recommended that Rose Bengal test should be excluded due to a high incidence of false positives11. Since then, PCR based testing of the blood and serum samples have been implemented that has resulted in significant reduction in the percentage of Brucella spp. positive tests in suspected cases17. In order to report the incidence of Brucella spp. among apparently healthy cattle, we had screened these bacteria in 903 apparently healthy cattle that were enrolled from Multan district in Punjab (Pakistan) and found that 04% of them were Brucella spp. infected (Table 1). DNA sequencing confirmed the presence of Brucella melitensis among the screened cattle. There are few reports available in literature from Pakistan documenting the prevalence of Brucella spp. in local cattle but of them have used serological tools for bacterial detection. In a recent report, Awais et al.18 had reported that 11.22% cattle that were enrolled from peri-urban and rural areas of district Multan were Brucella spp. infected cattle. We have observed lower bacterial prevalence among our enrolled cattle as the sampling district was same. The probable reason for relatively higher bacterial prevalence in the study conducted by Awais et al.18was the use of ELISA technique for bacterial detection that is known to generate false positive results as compared to PCR that we had used and it is known to be highly sensitive and specific for bacterial detection19(Khan et al., 2021). Our results are in close agreement with another recent study conducted in Khyber Pakhtunkhwa in which Ullah et al.8 used PCR and Sanger sequencing approach for the bacterial screening in cattle and humans and they confirmed the presence of Brucella melitensis in 3.1% of screened cattle and 9% in human blood samples. Hussain et al.16 reported PCR based 9.64% prevalence of Brucella spp. in cattle breeds that were reared under tropical-desert conditions in Pakistan. Khan et al.19 documented that 12.66% cattle from the peri-urban production system in Punjab were seropositive for Brucella infection and all seropositive samples were confirmed by Brucella genus specific RT-PCR. Prevalence of Brucella spp. has been reported from various parts of the world ranging between 84 and 4% by using a variety of diagnostic methods. Lounes et al.20 had found that 83.5% of cattle that were enrolled from across the Algeria were infected with Brucella abortus, 15.3% with Brucella melitensis and 1.2% were infected with unidentified Brucella stains. Mitterran et al.21 found 20.9% cattle in southern Cameroon, central Africa while Hassan et al.22 documented that 10% cattle in different areas of Lebanon were Brucella spp. positive. Abdel-Hamid et al.23 reported that 6.2% cattle in Fayoum governorate in Upper Egypt were Brucella spp. infected. Alamian et al.24 reported the prevalence of Brucella spp. to be 5.6%, 3.9% and 4.9% screened by RBT (Rose Bengal plate test), SAT (Serum agglutination test) and i-ELISA respectively in cattle from four Iranian provinces; Brucella abortus biovars were identified by bio-typing experiments and multiplex PCR in all 44 tested samples. These differences observed in the bacterial prevalence between the reviewed studies are due to different geographical locations, availability of vector, climatic conditions of the sampling area, herd management systems and the primary health care system that is available to the large ruminants of different study sites10.
Phylogenetic trees are constructed to reflect evolutionary relationships among organisms and for this purpose conserved genes are targeted. The insertion sequence 711 (IS711) has been reported in all Brucella species known to date and that is one of the reason that this gene is targeted for the phylogenetic analysis8. Interestingly, the copy number of this gene varies between the species and biovar. Generally, Brucella abortus and Brucella canis has 5–8 copies of this gene, Brucella melitensis has 7–10 copies while Brucella suis has 6–13 copies of IS711 gene17. The genetic diversity of Brucella species has been documented in human and animals worldwide but there is just one recent report available in literature from Pakistan in which genetic diversity of Brucella melitensis has been reported in local cattle and human. Therefore, we used the partial IS711 gene sequences of the three IS711 isolates amplified in this study for the phylogenetic analysis. Phylogenetic analysis revealed high conservation of IS711 sequences and resembled closely with the Brucella melitensis sequences that were isolated from aborted fetus in China (unpublished data). The Brucella melitensis generated in this study were clearly distinct from other Brucella species including Brucella ovis, Brucella sp., Brucella suis, Brucella cetaceae and Brucella microti that were deposited from various countries in variety of hosts including humans. The sequences generated in this study were even different from Brucella melitensis detected in humans indicating host specific genetic variations among this bacterium. This observation is contrary to the recent phylogenetic analysis of Brucella melitensis in Pakistan where Ullah et al.8 has reported the presence of multiple strains of Brucella melitensis some of which were shared between humans and cattle underscoring the zoonotic potential of the pathogen. This limited but contrasting data regarding the genetic diversity of Brucella melitensis from Pakistan emphases the screening of large and small ruminants as well as associated humans from remote and unexplored regions of Pakistan to gain new insights into bacterial diversity.
Risk factor analysis showed no breed-specific susceptibility to Brucella melitensis infection during present study as all three enrolled breeds were equally susceptible to this parasitic infection (Supplementary Table 1). A number of researchers have disagreement over whether a particular breed was more prone to Brucella infection than others. Muma et al.25 had reported a higher sero-prevalence of Brucella spp. among crossbred than among local cattle breed. Mai et al.26 had reported higher seroprevalence of Brucella spp. in indigenous cattle than in crossbred cattle. While Tsegaye et al.27 had indicated no association of this bacterial infection in cattle breeds that were enrolled from Ethiopia.
During present investigation, we observed no association of season with Brucella melitensis infection among screened Holstein Friesian and crossbred cattle. While the prevalence of Brucella melitensis in screened Sahiwal cattle varied significantly with the sampling seasons and the highest Brucella spp. infection rate was observed during spring season followed by summer (Table 1). Our results are in line with Warioba et al.28 who had reported that chances of Brucella spp. infection were higher during the wet season than in dry season. For Holstein Friesian cattle that were enrolled during winter, it was observed that farms where only cattle were kept had higher Brucella melitensis infection than the farms where cattle were raised along with other animals (Table 2). During the spring season screening of Sahiwal cattle breed, data analysis revealed that cattle kept at the farm where dogs were present having tick load were more suspected to develop Brucella melitensis infection than the farms having dogs without tick load indicating that dogs are acting as tick carrier and bring the infection to the herd (Table 4). A number of studies have reported risk factors that were associated with Brucella spp. infection during their investigation and several of them had contrasting observations with each other. Warioba et al.28 had reported that the chances of having Brucella spp. infection were significantly higher in females and in young animals than in males and adults due to the fact that they were kept longer for breeding and milk production purpose and supplied with insufficient feed against their high demand. Hussain et al.16 reported that brucellosis was not found associated with the age and sex of enrolled cattle and we observed the same during present investigation. Age has been related to Brucella infection. Borba et al.29 reported a higher prevalence of Brucella spp. in adult cattle than in young. Sexually mature and pregnant cattle are also known to be more prone to Brucella spp. infection than sexually immature cattle. This is because of the fact that the Brucella spp. confers a response in the reproductive tract owing to the concentration of erythritol sugar that are generated within the fetal tissues of cattle that stimulates the growth of Brucella organisms30(Matope et al., 2011). Aguiar et al.31 had documented that the size of the herd (more than 25 cows) and the presence of pigs at the farms were significant factors associated with the Brucella spp. infection. It was also observed that the presence of infected cows within the herd that had repeat breeders and the birth of weak calves was another significant variable associated with this infection. Robi et al.32 reported that improper disposal of aborted materials and birth products, use of communal bulls, sharing communal grazing areas and water sources were factors associated with the disease transmission. Similarly, Khan et al.19 had also reported the association of history of abortion, repeat breeding and lactating stage with the Brucella infection among cattle. Ukita et al.33reported that introduction of cattle from other herds was the risk factor for high prevalence of infection within a farm. Yanti et al.34 added to the exisiting knowledge that the history of placental retention, endometritis, stillbirth, abortion age at 7–8 months and the history of pregnancy abortion at the age of 4–6 months were significant factors associated with Brucella spp. infection in large ruminants.
During present investigation, complete blood count analysis revealed that Brucella melitensis infected Holstein Friesian cattle had disturbed lymphocytes, monocytes and platelets than uninfected animals (Table 3).While Brucella melitensis infected Sahiwal cattle had significantly elevated white blood cells and hemoglobin while reduced mean cell volume than uninfected cattle (Table 5). Infected crossbred cattle had disturbed monocytes and red blood cells (Table 7). The change in white blood cells is a sign of developing infection where the immune system is trying to cope with the infection. Following infection, Brucella spp. invades the lymph nodes and from here the move on to the blood and causes systemic infection. There is an increase in the number of leukocytes and neutrophils during infection35. Increased red blood cells and associated parameters during early infection is also considered as a part of immune response as body tend to carry more oxygen to promote oxidative phosphorylation for energy generation to cope with the infection36. While during acute infection, red blood cell count, hemoglobin, and hematocrit levels are usually decreased resulting in anemia37. Increased platelet consumption among the infected animals is probably attributed to an immune mediated process or result from intravascular disseminated coagulation38. Our results are in accordance with Hussain et al.16 who had reported that erythrocyte counts, hemoglobin quantity, hematocrit, lymphocytes and monocytes values in infected cases were significantly low while the total leukocyte cell counts were significantly increased than uninfected animals.
We are recommending the use of acaricides at the dairy farms to control the tick population in order to prevent tick borne diseases like brucellosis among cattle. Ticks live and hide in vegetation and their population can be controlled by removing leaf litter, tall grass and brush around animal areas. Improved hygienic conditions at farms will significantly reduce the incidence of tick-borne diseases. Diagnostic testing for Brucella infection should be frequently carried out in endemic areas. Treatment of brucellosis in cattle is ineffective as the bacteria persist and multiply in the cells and these animals become the source of infection for other animals10. Hence, Brucella melitensis Infected animals should be culled to prevent the infection. We strongly recommend the immunization of calves or heifers in the endemic areas. Newly introduced cattle in a farm must be free from Brucella spp. infection and should also be brought from disease-free areas in order to reduce the economic losses associated with animal morbidity and mortality.
Conclusion
This study reports a moderate molecular prevalence of Brucella melitensis in three cattle breeds from Punjab, Pakistan. No specific cattle breed was found susceptible for Brucella melitensis infection during this investigation. Prevalence of Brucella melitensis did not vary with the sampling season and the infection with this bacterium had significantly disturbed the complete blood count of all enrolled cattle breeds. The findings of this study contribute to the control strategies for bovine brucellosis in Pakistan. Similar studies are recommended to be conducted in all those areas of Pakistan that are still unexplored for the presence of Brucella spp. among cattle. These findings will assist in planning and implementing control measures for tick-borne diseases that will significantly improve the output of livestock sector in Pakistan.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
The authors extend their appreciation to the Researchers Supporting Project number (RSP2025R197) King Saud University, Riyadh, Saud Arabia.
Author contributions
FI, MD, and AA had designed and supervised this study. BA, MA, HM, NM, and MN collected the cattle blood samples and epidemiological data. BA, MN, and AK performed the wet lab experiments. AK and SU performed the phylogenetic analysis. MB, MD, and TMD performed the statistical analysis. All authors contributed to the writing of manuscript and approved the final version for submission.
Data availability
The datasets generated and/or analyzed during the current study are available in the GenBank repository, with Accession numbers PP484552, PP484553 and PP484554. https://www.ncbi.nlm.nih.gov/nuccore/PP484552 https://www.ncbi.nlm.nih.gov/nuccore/PP484553 https://www.ncbi.nlm.nih.gov/nuccore/PP484554.
Declarations
Competing interests
The authors declare no competing interests.
Ethics approval and consent to participate
Ethical Research Committee of the department of Zoology, Islamia University Bahawalpur (Pakistan) approved all the experimental procedures and protocols applied in this study via letter number IUB/Ethics/2022-14.
ARRIVE guidelines
The experimentation was conducted in accordance with applicable laws, and ARRIVE guidelines.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Babar Ali and Muhammad Naeem have contributed equally towards the manuscript.
Contributor Information
Musaab Dauelbait, Email: musaabelnaim@gmail.com.
Adil Khan, Email: dradilkhan@bkuc.edu.pk.
Furhan Iqbal, Email: furhan.iqbal@bzu.edu.pk.
References
- 1.Khan, A. et al. Tick-borne haemoparasitic diseases in small ruminants in Pakistan: Current knowledge and future perspectives. Saudi J. Biol. Sci.29 (4), 2014–2025. 10.1016/j.sjbs.2021.12.046 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Khan, M. H. et al. Epidemiological survey, molecular characterization and subtyping of BoHV-1 from healthy and sick, cattle and Buffalo from Okara. Pak. Pak Vet. J.44 (1), 111–116. 10.29261/pakvetj/2024.140 (2024). [Google Scholar]
- 3.Khan, S. et al. Epidemiology of bovine hydatidosis: urbanization, dogs, animal care and proximity to slaughterhouses are important risk factors for cattle. Pak. Vet. J.43 (3), 507–514. 10.29261/pakvetj/2023.055 (2023). [Google Scholar]
- 4.Atif, F. A., Nazir, M. U., Roheen, T., Mehnaz, S. & Hussain, I. Antitheilerial efficacy of juglone, Buparvaquone and Oxytetracycline against tropical theileriosis in naturally infected crossbred cattle. Pak. Vet. J.44 (1), 129–134. 10.29261/pakvetj/2023.116 (2024). [Google Scholar]
- 5.Abbas, R. Z., Ali, A. M., Mares, M. M., Mohsin, M. & Adulticidal Larvicidal, and repellent potential of Ethyl acetate extract of Moringa Oleifera against rhipicephalus Microplus cattle ticks. Kafkas Univ. Vet. Fak Derg. 30 (5), 719–727. 10.9775/kvfd.2024.32438 (2024). [Google Scholar]
- 6.Zhang, G. et al. Strain-level identification of Brucella melitensis reference strain 63/9 using multiplex PCR method by targeting BMEA_B0162 and BMEA_A1238. Pak. Vet. J.44 (1), 183–189. 10.29261/pakvetj/2024.135 (2024). [Google Scholar]
- 7.Głowacka, P., Żakowska, D., Naylor, K., Niemcewicz, M. & Bielawska-Drózd, A. Brucella—virulence factors, pathogenesis and treatment. Pol. J. Microbiol.67, 151–161 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Ullah, I. et al. Molecular prevalence, phylogenetic analysis, and PCR-based detection of Brucella melitensis in humans and cattle in Southern Khyber Pakhtunkhwa, Pakistan. Comp. Immunol. Microbiol.115, 10226 (2024). [DOI] [PubMed] [Google Scholar]
- 9.Ma, R. et al. Evidence-practice gap analysis in the role of tick in brucellosis transmission: A scoping review. Infect. Dis. Povert. 13 (1), 3. 10.1186/s40249-023-01170-4 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Tulu, D. & Bovine Brucellosis Epidemiology, public health implications, and status of brucellosis in Ethiopia. Vet. Med.13, 21–30. 10.2147/VMRR.S347337 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Tuon, F. F., Gondolfo, R. B. & Cerchiari, N. Human-to-human transmission of Brucella–a systematic review. Trop. Med. Int. Health. 22 (5), 539–546. 10.1111/tmi.12856 (2017). [DOI] [PubMed] [Google Scholar]
- 12.Janjua, A. A., Aslam, M. & Batool, Z. Identification of climate induced optimal rice yield and vulnerable districts rankings of the Punjab, Pakistan. Sci. Rep.11, 23393 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Asif, M. et al. Seasonal survey, risk factor’s analysis and genotyping of theileria annulata infecting cattle in Punjab Province, Pakistan. Acta Trop.234, 106587. 10.1016/j.actatropica.2022.106587 (2022). [DOI] [PubMed] [Google Scholar]
- 14.Parveen, A., Ashraf, S., Aktas, M., Ozubek, S. & Iqbal, F. Molecular epidemiology of Theileria annulata infection of cattle in Layyah district, Pakistan. Exp. Appl. Acarol. 83 (3), 461–473 (2021). [DOI] [PubMed] [Google Scholar]
- 15.Probert, W. S., Schrader, K. N., Khuong, N. Y., Bystrom, S. L. & Graves, M. H. Real-time multiplex PCR assay for detection of Brucella spp., B. abortus, and B. melitensis. J. Clin. Microbiol.42 (3), 1290–1293 (2004). [DOI] [PMC free article] [PubMed]
- 16.Hussain, R., Khan, I., Jamal, A., Mohamed, B. B. & Khan, A. Evaluation of hematological, oxidative stress, and antioxidant profile in cattle infected with Brucellosis in Southern Punjab, Pakistan. BioMed. Res. Int.2022 (1), 7140909 10.1155/2022/7140909 (2022). [DOI] [PMC free article] [PubMed] [Retracted]
- 17.Becker, G. N. & Tuon, F. F. Comparative study of IS711 and bcsp31-based polymerase chain reaction (PCR) for the diagnosis of human brucellosis in whole blood and serum samples. J. Microbiol. Met.183, 106182. 10.1016/j.mimet.2021.106182 (2021). [DOI] [PubMed] [Google Scholar]
- 18.Awais, M. M. et al. A study on the epidemiology of brucellosis in bovine population of peri-urban and rural areas of district Multan, Southern Punjab, Pakistan. BMC Vet. Res.20 (1), 39. https://doi.org/10.1186 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Khan, I. et al. Serosurvey and potential risk factors of brucellosis in dairy cattle in peri-urban production system in Punjab, Pakistan. Pak Vet. J.41 (3), 459–462. 10.29261/pakvetj/2021.028 (2021). [Google Scholar]
- 20.Lounes, N. et al. Identification, geographic distribution and risk factors of Brucella abortus and Brucella melitensis infection in cattle in Algeria. Vet. Microbiol.254, 109004. https://doi.org/10.1016 (2021). [DOI] [PubMed] [Google Scholar]
- 21.Mitterran, K. N. R., Barberine, S. A., Oumarou, F. & Simo, G. Detection of Brucella abortus and Brucellla melitensis in cattle and sheep from southern Cameroon. (2020). 10.21203/rs.3.rs-21575/v2
- 22.Hassan, H. et al. Prevalence and prevention of brucellosis in cattle in Lebanon. Vet. World. 13 (2), 364–371. 10.14202/vetworld.2020.364-371 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Abdel-Hamid, N. H. et al. Risk factors and molecular genotyping of Brucella melitensis strains recovered from humans and their owned cattle in upper Egypt. One Health. 13, 100281. 10.1016/j.onehlt.2021.100281 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Alamian, S. et al. Brucella species circulating in rural and periurban dairy cattle farms: A comparative study in an endemic area. Trop. Anim. Health Prod. 53, 1–9 (2021). [DOI] [PubMed]
- 25.Muma, J. B., Samui, K. L., Oloya, J., Munyeme, M. & Skjerve, E. Risk factors for brucellosis in Indigenous cattle reared in livestock–wildlife interface areas of Zambia. Prevent Vet. Med.80 (4), 306–317 (2007). [DOI] [PubMed] [Google Scholar]
- 26.Mai, H. M., Irons, P. C., Kabir, J. & Thompson, P. N. A large Seroprevalence survey of brucellosis in cattle herds under diverse production systems in Northern Nigeria. BMC Vet. Res.8, 1–14 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Tsegaye, Y., Kyule, M. & Lobago, F. Seroprevalence and risk factors of bovine brucellosis in Arsi zone, oromia regional state. Ethiopia Amr Acad. Sci. Res. J. Eng. Technol. Sci.24 (1), 16–25 (2016). [Google Scholar]
- 28.Warioba, J. P. et al. Occurrence and risk factors of brucellosis in commercial cattle farms from selected districts of the Eastern Coast zone, Tanzania. Vet. Med. Int. 904931. 10.1155/2023/4904931 (2023). [DOI] [PMC free article] [PubMed]
- 29.Borba, M. R. et al. Prevalence and risk-mapping of bovine brucellosis in Maranhão State, Brazil. Prevent Vet. Med.110 (2), 169–176 (2013). [DOI] [PubMed] [Google Scholar]
- 30.Matope, G. et al. Seroprevalence of brucellosis and its associated risk factors in cattle from smallholder dairy farms in Zimbabwe. Trop. Anim. Health Prod.43, 975–982 (2011). [DOI] [PubMed] [Google Scholar]
- 31.31Aguiar, D. M. et al. Risk factors and Seroprevalence of Brucella spp. In cattle from Western Amazon, Brazil. Arquivos Do Instituto Biológico 74, 301–305 (2022).
- 32.Robi, D. T., Gelalcha, B. D. & Deresa, F. B. Knowledge and perception of community about causes of cattle abortion and case-control study of brucellosis as cause of abortion in Jimma zone. Ethiopia Vet. Med. Sci.7 (6), 2240–2249 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Ukita, M. et al. Quantitative evaluation of the infection dynamics of bovine brucellosis in Tanzania. Prevent. Vet. Med.194, 105425. 10.1016/j.prevetmed.2021.105425 (2021). [DOI] [PubMed] [Google Scholar]
- 34.Yanti, Y., Sumiarto, B., Kusumastuti, T. A., Panus, A. & Sodirun, S. Seroprevalence and risk factors of brucellosis and the brucellosis model at the individual level of dairy cattle in the West Bandung district. Indonesia Vet. World. 14 (1), 1–10. 10.14202/vetworld.2021.1-10 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Akya, A. et al. Usefulness of blood parameters for preliminary diagnosis of brucellosis. J. Blood Med.11, 107–113. 10.2147/JBM.S245513 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Markanday, A. Acute phase reactants in infections: Evidence-based review and a guide for clinicians. Open. Forum Infect. Dis.2 (3), ofv098. 10.1093/ofid/ofv098 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Roland, L., Drillich, M. & Iwersen, M. Hematology as a diagnostic tool in bovine medicine. J. Vet. Diag Invest.26 (5), 592–598 (2014). [DOI] [PubMed] [Google Scholar]
- 38.Popescu, N. I., Lupu, C. & Lupu, F. Disseminated intravascular coagulation and its immune mechanisms. Blood139 (13), 1973–1986. 10.1182/blood.2020007208 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets generated and/or analyzed during the current study are available in the GenBank repository, with Accession numbers PP484552, PP484553 and PP484554. https://www.ncbi.nlm.nih.gov/nuccore/PP484552 https://www.ncbi.nlm.nih.gov/nuccore/PP484553 https://www.ncbi.nlm.nih.gov/nuccore/PP484554.