Skip to main content
NCBI home page
Springer logoLink to Springer
. 2024 Oct 17;398(4):4111–4122. doi: 10.1007/s00210-024-03450-8

RETRACTED ARTICLE: Diacerein ameliorates amiodarone-induced pulmonary fibrosis via targeting the TGFβ1/α-SMA/Smad3 pathway

Hadir Farouk 1, Passant E Moustafa 1, Marwa S Khattab 2, Salma A El-Marasy 1,✉
PMCID: PMC11978552  PMID: 39417843

Abstract

This study is aimed at investigating the possible protective effect of diacerein (DIA) against AMD-induced pulmonary fibrosis in rats. Rats were classified into 4 groups: a normal group that received distilled water, control group that received AMD (100 mg/kg, p.o.) for 21 days to induce pulmonary fibrosis, and 2 treatment groups that received diacerein, in 2 dose levels (50 and 100 mg/kg, p.o., respectively) in addition to AMD (100 mg/kg, p.o.), for 21 days. Lung function test was assessed using a spirometer; serum and tissue were collected. Biochemical, real-time PCR, histopathological, and immunohistopathological analyses were carried out. AMD reduced tidal volume (TV), peripheral expiratory rate (PER), forced vital capacity (FVC), serum reduced glutathione (GSH) levels, Beclin, and LCII, while it elevated transform growth factor (TGF-β1) gene expression, serum malondialdehyde (MDA) level, alpha-smooth muscle actin (α-SMA), Smad3, phosphorylated signal transducer and activator of transcription (p-STAT3), and p62 lung content. Also, AMD elevated tumor necrosis factor-alpha (TNF-α) and caspase-3 protein expression. DIA elevated TV, PER, FVC, serum GSH level, Beclin, and LCII, while it reduced TGF-β1 gene expression, serum MDA level, α-SMA, Smad3, p-STAT-3, and p62 lung content. Moreover, DIA reduced TNF-α and caspase-3 protein expression. DIA attenuated AMD-induced pulmonary fibrosis via alleviating the TGF1/α-SMA/Smad3 pathway, reducing STAT-3 activation, and combating oxidative stress and inflammation in addition to promoting autophagy and abrogating apoptosis.

Keywords: Diacerein, Amiodarone, Pulmonary fibrosis, TGF1/α-SMA/Smad3 pathway, P-STAT3, Autophagy

Introduction

Pulmonary fibrosis is a common chronic disease that causes lung remodeling and respiratory failure due to uncontrolled collagen and extracellular matrix (ECM) deposition (Zhou et al. 2024). Patients with pulmonary fibrosis endure shortness of breath, hypoxia, cough, and fatigue, finally resulting in lung cancer, respiratory insufficiency, and death (Mathai and Schwartz 2019). It is a serious respiratory illness that poses a serious risk to human health, with a 5-year survival rate of about 20–25% after diagnosis (Lederer and Martinez 2018). Due to aging populations, changes in lifestyle, and environmental variables, the incidence and mortality rates of pulmonary fibrosis have increased recently (Li et al. 2024). It was ranked second by the WHO in terms of mortality, epidemiology, and management costs (WHO 2019).

Amiodarone (AMD) is a popular anti-arrhythmic medication that is prescribed to treat both ventricular and supraventricular arrhythmias (Jia et al. 2024). To achieve AMD efficacy, a prolonged oral dosage load may be required, which might lead to significant side effects such as pulmonary toxicity and fibrosis. AMD is an iodine-containing chemical. It is lipophilic, has a high distribution volume and a long half-life, and tends to accumulate in the lungs leading to pulmonary fibrosis (Mamizu et al. 2024; McCall et al. 2024). AMD promotes the pulmonary production of transform growth factor-β1 (TGF-β1) and deposition of extracellular protein leading to pulmonary fibrosis (Harb et al. 2023).

The signaling pathway involving TGF-β1/Smad family member 3 (Smad3) plays a significant role in the development of pulmonary fibrosis (Mohamed et al. 2022). TGF-β1 is a key regulator of pulmonary fibrosis. It converts fibroblasts to myofibroblasts and epithelial cells to mesenchymal cells and enhances the deposition of collagen, filamentous actin, and alpha-smooth muscle actin (α-SMA). The activation of TGF-β1 increases the Smad2 and Smad3 complexes, which cause tissue fibrosis. Furthermore, activating Smad signaling leads to increased expression of pro-fibrotic genes (Xu et al. 2018; Ye and Hu 2021). STAT3 (signal transducer and activator of transcription 3), a member of the STATs family, promotes the differentiation of fibroblast into myofibroblast, resulting in ECM accumulation and pulmonary fibrosis (Li et al. 2022).

Numerous anti-inflammatory drugs, such as corticosteroids and immunosuppressive drugs, are used to treat pulmonary fibrosis, although there is yet no proven treatment (Glass et al. 2022). Diacerein (DIA), an anthraquinone derivative derived from rhubarb, has recently been utilized in clinical trials to treat osteoarthritis (Zeng et al. 2023). The key molecular mechanism by which it functions is the inhibition of interleukin-1 β (IL-β) secretion, binding to its receptor and subsequently inhibiting inflammatory signaling pathways. Moreover, DIA exerts a suppressive effect on the production and function of several cytokines, nitric oxide, tumor necrosis factor-alpha (TNF-α), and the phagocytic activity of neutrophils (Ali et al. 2023). Previous experimental and clinical investigations have provided evidence supporting the anti-inflammatory properties of DIA (Shi et al. 2020; Ibrahim et al. 2022).

DIA has shown anti-oxidant and anti-apoptotic activities in diabetes mellitus, renal injury, and therapeutic effect in testicular injury, ulcerative colitis, and cancer (Almezgagi et al. 2020). DIA also showed a protective role against lipopolysaccharide-induced lung injury in rats via alleviating inflammatory and apoptotic pathways (Youssef et al. 2022). It has been shown that rhein, the active metabolite of DIA, induces a number of pharmacological actions, including anti-oxidant, anti-cancer, and anti-inflammatory effects (Almezgagi et al. 2020).

Although DIA has shown a protective effect against bleomycin-induced pulmonary fibrosis (Abdel-Aziz et al. 2023), according to our knowledge, there is still no specific evidence that DIA protects rats from AMD-induced pulmonary fibrosis. Therefore, this study is aimed at evaluating the potential efficacy of DIA in mitigating AMD-induced pulmonary fibrosis in rats. Furthermore, the role of the TGFβ1/α-SMA/Smad3 pathway, oxidative stress, autophagy, and apoptosis was investigated.

Material and methods

Animals

Adult female rats (180–210 g) used in this study were obtained from the National Research Centre in Cairo, Egypt. Rats were subjected to a 1-week acclimatization period in the animal facility of the National Research Centre, where they were exposed to standard settings. These conditions included a relative humidity of 60 ± 10%, a temperature of 23 ± 2 °C, and a light/dark cycle of 12 h. The rats were provided with food on an ad libitum basis throughout this period.

Chemicals and drugs

AMD and DIA were acquired from Sanofi Aventis, Egypt, and EVA Pharma, Egypt, respectively. Both drugs were freshly solubilized in distilled water at 32 °C and allowed to cool to room temperature before use in the experimental study. All remaining chemicals used were of molecular or analytical grade.

Experimental design

A total of 24 female rats, each aged 6 weeks, were assigned randomly to four groups, each consisting of 10 rats. In group I, rats were administered distilled water for 21 days. Group II, which served as the control group, received AMD (100 mg/kg, p.o.) for 21 days to induce lung damage (Ahmed et al. 2020). Group III underwent concurrent treatment with AMD (100 mg/kg) and DIA (50 mg/kg, p.o.) for 3 weeks (Barakat et al. 2021). Group IV was subjected to a regimen of AMD (100 mg/kg) combined with DIA (100 mg/kg, p.o.) for a duration of 3 weeks.

Assessment of pulmonary function using spirometer

Non-anesthetized rats were placed in the main chamber of the whole-body plethysmograph (AD Instruments spirometer, ML140, England) to measure tidal volume (TV), forced vital capacity (FVC), and peak expiration flow rate (PER). Rat heads were inserted into a chamber and connected to a spirometer using a latex neck collar, as previously indicated (Gad et al. 2020).

Collection of samples

Blood samples were obtained from the rats in each experimental group using retro-orbital vein puncture. This procedure was conducted while the rats were under light ether anesthesia. After allowing the blood to coagulate, it was centrifuged for 15 min at 3000 rpm. Upon completion of the experiment, all rats were sacrificed by decapitation under light anesthesia. To prepare lung homogenate, lung tissues were washed with saline and placed in ice-cold phosphate buffer (pH 7.4) using a tissue homogenizer (MPW-120, BitLab Medical Equipment, Poland). A cooling centrifuge (Laboratory Centrifuge, 2 K15, Sigma Co., Germany) was used to centrifuge homogenized tissues for 10 min at 40 C, at 4000 rpm/min. The supernatant was extracted, kept at − 80 °C, and utilized to measure the levels of inflammatory and biochemical cytokines in lung tissue.

Determination of serum biomarkers

Serum GSH was measured using biodiagnostic kits (Biodiagnostic Co., Dokki, Egypt, catalog no. GR 2511) according to a prior study of Elsayed et al. (2021). Lipid peroxides were quantified by assessing thiobarbituric acid reactive compounds, specifically assessed as malondialdehyde (MDA), using biodiagnostic kits (Biodiagnostic Co., Dokki, Egypt, catalog no. MD 2529), a previously established methodology of Abdelazeim et al. (2020).

Enzyme-linked immunosorbent assay

Following the manufacturer’s instructions, we employed rat-specific enzyme-linked immunosorbent assay (ELISA) kits with the catalog numbers MBS2516123, MBS266620, PEL-Stat3-Y705, MBS901662, CBA-5116, and MBS7210079, which were sourced from MyBioSource Co., Ltd., Cell BioLabs, Origene, and RayBioTech located in the USA. These ELISA kits were utilized for the quantification of the following biomarkers within lung tissue homogenate: Smad3, α-SMA, phosphorylated STAT3 (p-STAT3), Beclin1, LC3II, and p62.

Quantitative real-time PCR

Total RNA was extracted from lung tissue by Direct-zol RNA Miniprep Plus Kit (ZYMO Research Corp., USA) according to manufacturer’s protocol. SuperScript™ IV One-Step RT-PCR kit (Thermo Fisher Scientific, Waltham, MA, USA) was used for reverse transcription of extracted RNA followed by PCR in one step. Primer’s sequence was used for TGFβ gene expression analysis as follows: For: GTGTGGAGCAACATGTGGAACTCTA and Rev: TTGGTTCAGCCACTGCCGTA (Kumagai et al. 2015). Real-time PCR was performed by a Step One Applied Biosystems (Foster City, USA) instrument. Relative expression of TGFβ was calculated using 2-∆∆CT method. Gene expression level of TGFβ1 was normalized to the expression of the housekeeping gene GAPDH (For: TGGATTTGGACGCATTGGTC and Rev: TTTGCACTGGTACGTGTTGAT).

Histopathological examination

Tissue specimens were collected from the lungs in 10% neutral buffered formalin. Processing of fixed tissue was carried out in ascending concentrations of ethanol and xylene and followed by embedding in paraffin wax. A rotary microtome was used to cut 4-µm-thick tissue sections which were then stained by hematoxylin and eosin stain in addition to Masson’s trichrome (MTC) stain. A light microscope with an installed digital camera was used to capture photographs. The degree of fibrosis was evaluated in MTC stained tissue by image analysis using ImageJ software for area percent in 3 micrographs/rat at × 400 magnification.

Immunohistochemical examination

Paraffin-embedded tissue sections were deparaffinized and rehydrated then placed in citrate buffer pH 6 for antigen retrieval overnight at 60 °C. Anti-TNF-α (1:100, sc-52746, Santa Cruz, USA) and anti-caspase-3 (1:100, sc-56053, Santa Cruz, USA) were applied to slides overnight followed by secondary antibodies according to manufacturer protocol (Bio-SB, USA). DAB was applied to slides for color development, and hematoxylin was used as a counterstain. Image analysis using ImageJ software for area percent estimation was performed in 3 micrographs/rat at × 400 magnification.

Statistical analysis

The data were analyzed using one-way analysis of variance (ANOVA) and Tukey’s multiple comparison test. Plots were displayed on the graphs (GraphPad Prism Program, San Diego, USA; version 8); p < 0.05.

Results

Assessment of pulmonary function using spirometer

As illustrated in Table 1, TV was markedly reduced in the AMD group to 0.07 fold (F = 7.092, p = 0.008) with respect to normal rats and elevated in rats treated with DIA (50 mg/kg) to 15.33 fold (F = 7.092, p = 0.0056) as compared to the control AMD group. Rats treated with DIA (100 mg/kg) did not change TV.

Table 1.

Assessment of pulmonary function by using a spirometer

Parameters TV (L) PER (L/s) FVC (L/s)
Groups
Sham 0.44@ ± 0.11 0.016@ ± 0.005 0.10@ ± 0.02
Control (AMD) 0.03* ± 0.02 0.004* ± 0.001 0.02* ± 0.00
AMD + DIA (50 mg/kg) 0.46@ ± 0.12 0.022@ ± 0.002 0.10@ ± 0.02
AMD + DIA (100 mg/kg) 0.14 ± 0.01 0.037@ ± 0.00 0.10@ ± 0.02
Open in a new tab

Values are reported as mean ± SEM. *Significant difference versus normal, @significant difference versus AMD, †significant difference versus AMD + DIA (100 mg/kg) at p < 0.05. AMD amiodarone, DIA diacerein

AMD administration significantly reduced PER to 0.25 fold (F = 12.91, p = 0.006) as compared to normal rats. Administration of DIA in doses of 50 and 100 mg/kg significantly elevated PER to 5.5 (F = 12.92, p = 0.0231) and 9.25 (F = 12.92, p < 0.0001) folds as compared to normal rats, respectively.

AMD administration significantly reduced FVC to 0.2 fold (F = 4.97, p = 0.0138) as compared to normal rats. DIA in the 2 dose levels remarkedly elevated FVC to 5 (F = 4.97, p = 0.0284) and 5 folds (F = 4.97, p = 0.0403) in comparison to control AMD rats, respectively.

mRNA expression of TGFβ1

Table 2 illustrates that AMD remarkably elevated mRNA expression of TGF to 5.18 fold change (F = 136.9, p < 0.0001) as compared to normal rats. DIA in 2 dose levels reduced TGF gene expression to 0.59 (F = 136.9, p < 0.0001) and 0.39 (F = 136.9, p < 0.0001) fold change as compared to the control (AMD) group.

Table 2.

Effect of DIA on mRNA expression of TGF in AMD-induced pulmonary fibrosis in rat

Parameters mRNA expression of TGF (fold change)
Groups
Normal 1.02@† ± 0.11
Control (AMD) 5.28*† ± 0.21
AMD + DIA (50 mg/kg) 3.14@† ± 0.20
AMD + DIA (100 mg/kg) 2.08@ ± 0.07
Open in a new tab

Values are reported as mean ± SEM. *Significant difference versus normal, @significant difference versus AMD, †significant difference versus AMD + DIA (100 mg/kg) at p < 0.05. AMD amiodarone, DIA diacerein

Effect of DIA on oxidative stress indices

Figure 1 reveals that AMD dramatically elevated serum MDA level to 6.23 fold (F = 116.6, p < 0.0001) and significantly reduced GSH serum level to 0.40 (F = 327.7, p < 0.0001) fold as compared to normal rats. DIA in doses of 50 and 100 mg/kg remarkably reduced serum MDA level to 0.40 (F = 116.6, p < 0.0001) and 0.56 fold (F = 116.6, p < 0.0001) and elevated serum GSH levels to 3.19 (F = 327.7, p < 0.0001) and 2.58 fold (F = 327.7, p < 0.0001) as compared to control (AMD) rats, respectively.

Fig. 1.

Fig. 1

Open in a new tab

Effect of DIA on a MDA and b GSH serum levels in AMD-induced pulmonary fibrosis in rats. Values are reported as mean ± SEM. *Significant difference versus normal, @significant difference versus AMD, †significant difference versus AMD + DIA (100 mg/kg) at p < 0.05. AMD, amiodarone; DIA, diacerein

Effect of DIA on pulmonary biochemical indices

Figure 2 depicts that amiodarone strikingly elevated α-SMA, Smad3, and p-STAT-3 to 7.08 (F = 130.7, p < 0.0001), 9.97 (F = 189.1, p < 0.0001), and 12.91 fold (F = 228.7, p < 0.0001), respectively. Co-administration of DIA in 50 and 100 mg/kg declined α-SMA to 0.55 (F = 130.7, p < 0.0001) and 0.34 fold (F = 130.7, p < 0.0001), Smad3 to 0.60 (F = 189.1, p < 0.0001) and 0.46 fold (F = 189.1, p < 0.0001), and p-STAT-3 to 0.74 (F = 228.7, p < 0.0001) and 0.55 fold (F = 228.7, p < 0.0001), respectively, as compared to control (AMD) rats.

Fig. 2.

Fig. 2

Open in a new tab

Effect of DIA on a alpha-SMA, b Smad, and c p-STAT3 contents in AMD-induced pulmonary fibrosis in rat. Values are reported as mean ± SEM. *vs. normal, @vs. AMD, †AMD + DIA (100 mg/kg) at p < 0.05. AMD, amiodarone; DIA, diacerein

Effect of DIA on autophagic indices

Figure 3 manifests that AMD showed a fundamental decline in pulmonary content of Beclin to 0.13 fold (F = 260.0, p < 0.0001), LCII to 0.40 fold (F = 117.4, p < 0.0001), and elevation in p62 pulmonary content to 7.64 fold (F = 677.9, p < 0.0001). DIA (50 and 100 mg/kg) significantly elevated pulmonary contents of Beclin to 4.27 (F = 260.0, p < 0.0001) and 3.62 fold (F = 260.0, p < 0.0001) and LCII to 1.57 (F = 117.4, p < 0.0001) and 1.99 fold (F = 117.4, p < 0.0001) and reduced p62 to 0.44 (F = 677.9, p < 0.0001) and 0.25 fold (F = 677.9, p < 0.0001), respectively, as compared to control (AMD) rats.

Fig. 3.

Fig. 3

Open in a new tab

Effect of DIA on a Beclin, b LCII, and c p63 contents in AMD-induced pulmonary fibrosis in rats. Values are reported as mean ± SEM. *Significant difference versus normal, @significant difference versus AMD, †significant difference versus AMD + DIA (100 mg/kg) at p < 0.05. AMD, amiodarone; DIA, diacerein

Histopathological findings

Microscopy of the lungs in the normal group revealed normal histological structure (Fig. 4a). In the control (AMD) group, the histopathology of the lungs showed thickening of the alveolar wall and interstitial tissue with fibrous connective tissue proliferation and leukocytic cell infiltration (Fig. 4b). In the diacerein-treated groups, the lesions observed in the control (AMD) group were partially alleviated as demonstrated by the decreased fibrosis and alveolar wall thickening (Fig. 4c, d). The fibrous connective tissue in the alveolar wall and interstitial tissue was stained blue by Masson’s trichrome. The fibrosis was very little in the normal group (Fig. 5a), very prominent in the control (AMD) group (Fig. 5b), and moderate in DIA-treated groups (Fig. 5c, d).

Fig. 4.

Fig. 4

Open in a new tab

Histopathology of lungs of rats in different groups. a Normal histological structure in the normal group, b thickening of the alveolar wall and interstitial tissue with fibrosis (star) and leukocytic cell infiltration (arrow) in the control (AMD) group, c moderate thickening of the alveolar wall in DIA 50, and d mild thickening of the alveolar wall in DIA 100. Hematoxylin and eosin stain × 200

Fig. 5.

Fig. 5

Open in a new tab

Masson’s trichrome stained lungs of rats in different groups. a Little fibrous connective tissue in the alveolar wall and interstitial tissue of the lung in the normal group, b prominent fibrous connective tissue in the alveolar wall and interstitial tissue (arrow) in the control (AMD) group, c moderate fibrous connective tissue in the alveolar wall and interstitial tissue (arrow) in DIA 50, and d DIA 100. Masson’s trichrome × 200

Immunohistochemical findings

TNF-α expression was weekly seen in the lung interstitial tissue of the normal group (Fig. 6a). However, it was severely expressed in the cells infiltrating the thickened alveolar wall in the control (AMD) group (Fig. 6b). In DIA-treated groups, TNF-α was moderately expressed in the lung interstitial tissue (Fig. 6c, d). Caspase-3 expression was weak in the normal group, mild in the control (AMD) group, severe in DIA (50 mg/kg), and moderate in DIA (100 mg/kg) (Fig. 7).

Fig. 6.

Fig. 6

Open in a new tab

Immunohistochemistry of TNF-α in the lungs of different groups. a Weak expression of TNF-α in the lungs of the normal group. b Severe expression of TNF-α (arrow) in the interstitial tissue of the lungs in the control (AMD) group. c Mild to moderate expression of TNF-α (arrow) in the interstitial tissue of the lungs in DIA 50 and d DIA 100 (arrow). Immunoperoxidase and hematoxylin counterstain × 400

Fig. 7.

Fig. 7

Open in a new tab

Immunohistochemistry of caspase-3 in the lungs of different groups. a Weak expression of caspase-3 in the lungs of the normal group. b Mild expression of caspase-3 in the interstitial tissue of the lungs in the control (AMD) group (arrow). c Severe expression of caspase-3 (arrow) in the interstitial tissue of the lungs in DIA 50 group and d moderate expression of caspase-3 (arrow) in DIA 100 group. Immunoperoxidase and hematoxylin counterstain × 400

Discussion

To the best of the authors’ knowledge, this is the first study to assess the attenuation of AMD-induced pulmonary fibrosis by DIA in rats evidenced by amelioration of lung function, alleviation of the TGF-β1/α-SMA/Smad3 pathway, p-STAT3 lung content, oxidative stress, and apoptosis in addition to enhancement of autophagy and attenuation of histopathological alterations.

In accordance with prior studies of Harb et al. (2023) and Radwan et al. (2020), herein, AMD increased TGF-β1 gene expression and α-SMA lung content and TNF-α protein expression compared to normal rats. It is well-established that pro-fibrogenic cytokine TGF-β activates α-SMA expression and thereby pro-inflammatory and fibrogenic cytokine production in AMD-induced pulmonary fibrosis (Weng et al. 2020; Ibrahim Fouad and Mousa 2021).

Through the TGF-β receptor 1 (TGFR1), TGF-β1 activates Smad2 and Smad3, and subsequently, Smad4 attaches to the active Smad2/3. The nucleus is where this complex translocates. The complex’s Smad3 component attaches itself directly to gene promoters to trigger the transcription of profibrotic molecules, such as collagen I and α-smooth muscle actin (α-SMA), which result in the activation of myofibroblasts and the deposition of ECM (Fan et al. 2020). In harmony with prior in vitro and in vivo studies (Wang et al. 2021; Li et al. 2022), herein, AMD administration resulted in a significant increase in p-STAT3 level as compared to normal value reflecting the deposition of fibrous tissue.

In this work, AMD causes elevated serum MDA level, a widely recognized indicator of lipid peroxidation which destructs the pulmonary endothelium as a result of free radical generation (Cherian et al. 2019). It has been proposed that oxidative stress is a key player in the development of pulmonary damage caused by AMD. This finding is in line with the prior study of Ahmed et al. (2020). AMD group reduced GSH, an important molecule for fending off oxidative stress (Ibrahim Fouad and Mousa 2021). A prior investigation has demonstrated that the administration of AMD significantly decreased glutathione levels, indicating a diminished capacity of mitochondria for detoxification (Akbay et al. 2019).

Moreover, pulmonary fibrosis was accompanied by a reduction in Beclin1, LC3II, elevation of p62 lung content, and caspase-3 protein expression, indicating a decline in autophagy and enhancement of apoptosis. All those findings were supported by a decline in pulmonary function and Masson trichrome staining, confirming the existence of pulmonary fibrosis.

DIA ameliorated pulmonary fibrosis via attenuation of the TGF1/Smad3/α-SMA pathway as it reduced TGFβ1 gene expression, Smad3, and α-SMA pulmonary contents. Also, it was found that DIA has the ability to suppress the protein expression of TGF-β1 in myopic hamsters (Abdel-Aziz et al. 2023). A previous study has shown that by suppressing the expression of α-SMA, the rhein therapy, an active metabolite of DIA, greatly reduced renal interstitial fibrosis. Rhein reduced α-SMA expressions in a rat model of IgA nephropathy, which had anti-fibrotic effect (Zhu et al. 2022).

It is noteworthy that TGF-β/Smads signaling has a major role in the development of tissue fibrosis, including lung and kidney fibrosis. Furthermore, TGF-β1 has demonstrated a role in fostering the differentiation of fibroblasts into myofibroblasts, the latter of which is thought to be the “prime criminal” of lung fibrosis (Liu et al. 2018). α-SMA mediates the activation of fibroblast to myofibroblast, promoting collagen and ECM deposition (Bahramifar et al. 2024).

DIA abrogated the activation of STAT3 via reducing the pulmonary content of its phosphorylated form. STAT3 enhances collagen deposition in lung fibroblasts induced by the TGF1/Smad3/α-SMA pathway; thus, its attenuation mitigates pulmonary fibrosis. A prior study has shown that both DIA and rhein significantly decreased the amount of p-STAT3 protein in many cell lines. Another study has shown that in breast cancer cell lines, diacerein therapy lowers p-STAT3 protein expression (Yang et al. 2019; Manore et al. 2022).

TGF-β1 causes fibrogenesis via mediating oxidative stress. It was discovered that TGF-β raised the oxidative genes’ expression levels. TGF-β1 has the ability to suppress GSH synthesis and increase MDA and reactive oxygen species formation, which in turn enhances TGF-β1 signaling and mediates fibrogenic responses triggered by TGF-β (Chu et al. 2017). Thus, DIA’s anti-oxidant effect manifested by a reduction in MDA and elevation of GSH was mediated by suppression of the major fibrogenic regulatory component. It was found that in rats with kidney damage caused by cisplatin, DIA enhanced renal anti-oxidants and reduced oxidative stress. Also, rhein downregulated the mRNA expression of MDA, which significantly reduced ROS generation and kidney MDA levels (Barakat et al. 2021). A previous study has shown that DIA treatment reduced the elevated MDA level in the ovaries, skeletal muscles, and liver of polycystic ovary syndrome in rats (Ibrahim et al. 2022). DIA’s anti-oxidant action may be related to its anthraquinone composition and anti-inflammatory characteristics (Abdelfattah et al. 2023).

According to a prior study, DIA therapy led to a dose-dependent, noticeable decrease in MDA levels and a clear rise of liver GSH. This is explained by diacerein’s ability to neutralize ROS and its strong anti-oxidant capability in various body tissues (Abd-Ellatif et al. 2019; Sreevallabhan et al. 2021; Mohamed Kamel et al. 2022).

It has been demonstrated that the TGF-β1/Smad pathway plays a role in controlling inflammation and fibrotic illness (Kriseman et al. 2019). DIA reduced TNF-α pulmonary protein expression, revealing its anti-inflammatory activity that was mediated by attenuation of the TGF-β1/Smad pathway and thereby combated pulmonary fibrosis. It has been reported that DIA attenuated lung injury induced by lipopolysaccharide in rats via its anti-inflammatory activity (Youssef et al. 2022).

DIA enhanced pulmonary autophagy manifested by elevation of Beclin1, LC3II, and reduction in p62 lung content and combated apoptosis by reducing the protein expression of caspase-3, the end product of pulmonary apoptosis. There is a link between autophagy and apoptosis where Beclin1 activates autophagic cascades and contributes to antiapoptotic mechanism (Du et al. 2019); those findings indicate that DIA alleviated pulmonary fibrosis via promoting autophagy and combating apoptosis. Also, DIA attenuated nephrotoxicity induced by diclofenac via its anti-apoptotic effect (Mansoure et al. 2024).

In conclusion, DIA exerted a novel protective effect against pulmonary fibrosis via attenuating the activation of the TGFβ1/Smad3/α-SMA pathway, STAT3, oxidative stress, and inflammation. In addition to enhancing autophagy and combating apoptosis, further studies are still warranted to investigate other molecular mechanisms that may mediate the ameliorating effect of DIA on pulmonary fibrosis in rats, which remains a limitation of this study.

Authors contributions

Conceptualization: S.A.M.; Resources, methodology, investigation, formal analysis, writing-review and editing: H.F., P.E.M., M.S.K., S.A.M. The authors declare that all data were generated in-house and that no paper mill was used.

Funding

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

Data availability

Data will be available upon request.

Declarations

Conflict of interest

The authors declare no competing interests.

Ethics approval

The experimental procedures were carried out in accordance with the ethical standards of the National Research Centre (PT: 01411023, Cairo, Egypt) and adhered to the guide of the Care and Use of Laboratory Animals (NIH Publication No. 85–23, revised 2011).

Consent to participate

N/A.

Consent for publication

N/A.

Footnotes

This article has been retracted. Please see the retraction notice for more detail: https://doi.org/10.1007/s00210-026-05324-7

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Change history

4/11/2026

This article has been retracted. Please see the Retraction Notice for more detail: 10.1007/s00210-026-05324-7

References

  1. Abdelazeim SA, Shehata NI, Aly HF, Shams SGE (2020) Amelioration of oxidative stress-mediated apoptosis in copper oxide nanoparticles-induced liver injury in rats by potent antioxidants. Sci Rep 10:10812 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Abdel-Aziz AM, Fathy EM, Hafez HM, Ahmed AFM MZ (2023) TLR4/ MyD88/NF-κB signaling pathway involved in the protective effect of diacerein against lung fibrosis in rats. Human ExpToxicol 42:1-12 [DOI] [PubMed]
  3. Abdelfattah AM, Mahmoud SS, El-Wafaey DI, Abdelgeleel HM, Abdelhamid AM (2023) Diacerein ameliorates cholestasis-induced liver fibrosis in rat via modulating HMGB1/RAGE/NF-kappaB/JNK pathway and endoplasmic reticulum stress. Sci Rep 13:11455 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Abd-Ellatif RN, Hegab II, Atef MM, Sadek MT, Hafez YM (2019) Diacerein protects against glycerol-induced acute kidney injury: modulating oxidative stress, inflammation, apoptosis and necroptosis. Chem Biol Interact 306:47–53 [DOI] [PubMed] [Google Scholar]
  5. Ahmed D, Youssef MY, Emam NM (2020) Oxidative stress in amiodarone-induced pulmonary toxicity in rats and the protective effect of L-carnitine and vitamin C. Mansoura J Forensic Med Clin Toxicol 28:43–53 [Google Scholar]
  6. Akbay E, Erdem B, Unlu A, Durukan AB, Onur MA (2019) Effects of N-acetyl cysteine, vitamin E and vitamin C on liver glutathione levels following amiodarone treatment in rats. Kardiochir Torakochirurgia Pol 16:88–92 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ali DM, Mahmoud MH, Rifaai RA, Fawzy MA, Atta M, Welson NN, Batiha GE, Alexiou A, Papadakis M, Abdelzaher WY (2023) Diacerein modulates TLR4/ NF-kappaB/IL-1beta and TRPC1/CHOP signalling pathways in gentamicin-induced parotid toxicity in rats. J Cell Mol Med 27:1735–1744 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Almezgagi M, Zhang Y, Hezam K, Shamsan E, Gamah M, Al-Shaebi F, Abbas AB, Shoaib M, Saif B, Han Y, Jia R, Zhang W (2020) Diacerein: recent insight into pharmacological activities and molecular pathways. Biomed Pharmacother 131:110594 [DOI] [PubMed] [Google Scholar]
  9. Bahramifar A, Jafari RM, Sheibani M, Manavi MA, Rashidian A, Tavangar SM, Akbariani M, Mohammadi Hamaneh A, Goudarzi R, Shadboorestan A, Dehpour AR (2024) Sumatriptan mitigates bleomycin-induced lung fibrosis in male rats: involvement of inflammation, oxidative stress and alpha-SMA. Tissue Cell 88:102349 [DOI] [PubMed] [Google Scholar]
  10. Barakat N, Barakat LAA, Zakaria MM, Khirallah SM (2021) Diacerein ameliorates kidney injury induced by cisplatin in rats by activation of Nrf2/Ho-1 pathway and Bax down-regulation. Saudi J Biol Sci 28:7219–7226 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cherian DA, Peter T, Narayanan A, Madhavan SS, Achammada S, Vynat GP (2019) Malondialdehyde as a marker of oxidative stress in periodontitis patients. J Pharm Bioallied Sci 11:S297–S300 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chu H, Shi Y, Jiang S, Zhong Q, Zhao Y, Liu Q, Ma Y, Shi X, Ding W, Zhou X, Cui J, Jin L, Guo G, Wang J (2017) Treatment effects of the traditional Chinese medicine Shenks in bleomycin-induced lung fibrosis through regulation of TGF-beta/Smad3 signaling and oxidative stress. Sci Rep 7:2252 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Du S, Li C, Lu Y, Lei X, Zhang Y, Li S, Liu F, Chen Y, Weng D, Chen J (2019) Dioscin alleviates crystalline silica-induced pulmonary inflammation and fibrosis through promoting alveolar macrophage autophagy. Theranostics 9:1878–1892 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Elsayed A, Elkomy A, Elkammar R, Youssef G, Abdelhiee EY, Abdo W, Fadl SE, Soliman A, Aboubakr M (2021) Synergistic protective effects of lycopene and N-acetylcysteine against cisplatin-induced hepatorenal toxicity in rats. Sci Rep 11:13979 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Fan Z, Qi X, Yang W, Xia L, Wu Y (2020) Melatonin ameliorates renal fibrosis through the inhibition of NF-kappaB and TGF-beta1/Smad3 pathways in db/db diabetic mice. Arch Med Res 51:524–534 [DOI] [PubMed] [Google Scholar]
  16. Gad ES, Salama AAA, El-Shafie MF, Arafa HMM, Abdelsalam RM, Khattab M (2020) The anti-fibrotic and anti-inflammatory potential of bone marrow-derived mesenchymal stem cells and nintedanib in bleomycin-induced lung fibrosis in rats. Inflammation 43:123–134 [DOI] [PubMed] [Google Scholar]
  17. Glass DS, Grossfeld D, Renna HA, Agarwala P, Spiegler P, DeLeon J, Reiss AB (2022) Idiopathic pulmonary fibrosis: current and future treatment. Clin Respir J 16:84–96 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Harb I, Ashour H, Rashed LA, Mostafa A, Samir M, Aboulhoda BE, El-Hanbuli H, Rashwan E, Mahmoud H (2023) Nicorandil mitigates amiodarone-induced pulmonary toxicity and fibrosis in association with the inhibition of lung TGF-beta1/PI3K/Akt1-p/mTOR axis in rats. Clin Exp Pharmacol Physiol 50:96–106 [DOI] [PubMed] [Google Scholar]
  19. Ibrahim YF, Alorabi M, Abdelzaher WY, Toni ND, Thabet K, Hegazy A, Bahaa HA, Batiha GE, Welson NN, Morsy MA, Venugopala KN, Abdel-Aziz AM (2022) Diacerein ameliorates letrozole-induced polycystic ovarian syndrome in rats. Biomed Pharmacother 149:112870 [DOI] [PubMed] [Google Scholar]
  20. Ibrahim Fouad G, Mousa MR (2021) The protective potential of alpha lipoic acid on amiodarone-induced pulmonary fibrosis and hepatic injury in rats. Mol Cell Biochem 476:3433–3448 [DOI] [PubMed] [Google Scholar]
  21. Jia J, Lietz S, Barth H, Ernst K (2024) The antiarrhythmic drugs amiodarone and dronedarone inhibit intoxication of cells with pertussis toxin. Naunyn Schmiedebergs Arch Pharmacol [DOI] [PMC free article] [PubMed]
  22. Kriseman M, Monsivais D, Agno J, Masand RP, Creighton CJ, Matzuk MM (2019) Uterine double-conditional inactivation of Smad2 and Smad3 in mice causes endometrial dysregulation, infertility, and uterine cancer. Proc Natl Acad Sci U S A 116:3873–3882 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kumagai K, Tabu K, Sasaki F, Takami Y, Morinaga Y, Mawatari S, Hashimoto S, Tanoue S, Kanmura S, Tamai T, Moriuchi A, Uto H, Tsubouchi H, Ido A (2015) Glycoprotein nonmetastatic melanoma B (Gpnmb)-positive macrophages contribute to the balance between fibrosis and fibrolysis during the repair of acute liver injury in mice. PLoS ONE 10:e0143413 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lederer DJ, Martinez FJ (2018) Idiopathic pulmonary fibrosis. N Engl J Med 378:1811–1823 [DOI] [PubMed] [Google Scholar]
  25. Li Z, Geng J, Xie B, He J, Wang J, Peng L, Hu Y, Dai H, Wang C (2022) Dihydromyricetin alleviates pulmonary fibrosis by regulating abnormal fibroblasts through the STAT3/p-STAT3/GLUT1 signaling pathway. Front Pharmacol 13:834604 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Li H, Wang YG, Chen TF, Gao YH, Song L, Yang YF, Gao Y, Huo W, Zhang GP (2024) Panax notoginseng saponin alleviates pulmonary fibrosis in rats by modulating the renin-angiotensin system. J Ethnopharmacol 318:116979 [DOI] [PubMed] [Google Scholar]
  27. Liu YY, Shi Y, Liu Y, Pan XH, Zhang KX (2018) Telomere shortening activates TGF-beta/Smads signaling in lungs and enhances both lipopolysaccharide and bleomycin-induced pulmonary fibrosis. Acta Pharmacol Sin 39:1735–1745 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mamizu H, Kohda H, Tomita Y, Hatakeyama T, Mamizu M, Ishikawa D, Kawakami H, Furukawa T, Ishida T, Sakai T (2024) Autopsy of drug-induced lung injury with atypical diffuse alveolar disorder due to amiodarone: a case report. Intern Med. 10.2169/internalmedicine.3141-23 [DOI] [PMC free article] [PubMed]
  29. Manore SG, Doheny DL, Wong GL, Lo HW (2022) IL-6/JAK/STAT3 signaling in breast cancer metastasis: biology and treatment. Front Oncol 12:866014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Mansoure AN, Elshal M, Helal MG (2024) Inhibitory effect of diacerein on diclofenac-induced acute nephrotoxicity in rats via modulating SIRT1/HIF-1alpha/NF-kappaB and SIRT1/p53 regulatory axes. Int Immunopharmacol 131:111776 [DOI] [PubMed] [Google Scholar]
  31. Mathai SK, Schwartz DA (2019) Translational research in pulmonary fibrosis. Transl Res 209:1–13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. McCall KL, Hennig KR, Abe ZT, Dattler DN, Hurd KL, Portnoy SL, Zagoria ZJ (2024) Rising cases of drug-induced pulmonary fibrosis: analysis of the Food and Drug Administration Adverse Event Reporting System (FAERS) database, 2000–2022. Pharmacoepidemiol Drug Saf 33:e5797 [DOI] [PubMed] [Google Scholar]
  33. Mohamed MZ, Abed El Baky MF, Ali ME, Hafez HM (2022) Aprepitant exerts anti-fibrotic effect via inhibition of TGF-beta/Smad3 pathway in bleomycin-induced pulmonary fibrosis in rats. Environ Toxicol Pharmacol 95:103940 [DOI] [PubMed] [Google Scholar]
  34. Mohamed Kamel GA, Harahsheh E, Hussein S (2022) Diacerein ameliorates acetaminophen hepatotoxicity in rats via inhibiting HMGB1/TLR4/NF-kappaB and upregulating PPAR-gamma signal. Mol Biol Rep 49:5863–5874 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Radwan SM, Ghoneim D, Salem M, Saeed M, Saleh Y, Elhamy M, Wael K, Shokair O, Wahdan SA (2020) Adipose tissue-derived mesenchymal stem cells protect against amiodarone-induced lung injury in rats. Appl Biochem Biotechnol 191:1027–1041 [DOI] [PubMed] [Google Scholar]
  36. Shi S, Xue L, Han S, Qiu H, Peng Y, Zhao P, Liu QH, Shen J (2020) Anti-contractile and anti-inflammatory effects of diacerein on isolated mouse airways smooth muscle and mouse asthma model. Front Pharmacol 11:560361 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Sreevallabhan S, Mohanan R, Jose SP, Sukumaran S, Jagmag T, Tilwani J, Kulkarni A (2021) Hepatoprotective effect of essential phospholipids enriched with virgin coconut oil (Phoscoliv) on paracetamol-induced liver toxicity. J Food Biochem 45:e13606 [DOI] [PubMed] [Google Scholar]
  38. Wang X, Ren R, Xu Z, Huang H, Jiang W, Ma J (2021) Tirbanibulin attenuates pulmonary fibrosis by modulating Src/STAT3 signaling. Front Pharmacol 12:693906 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Weng J, Chen H, Wu H, Tu M, Wang Z, Chen D, Wang Z, Chen C (2020) Amiodarone induces epithelial-mesenchymal transition in A549 cells via activation of TGF-beta1. Drug Chem Toxicol 43:415–422 [DOI] [PubMed] [Google Scholar]
  40. WHO (2019) The top 10 causes of death. World Health Organization. https://www.who.int/news-room/fact-sheets/detail/the-top-10-causes-ofdeath#:~:text=The%20top%20global%20causes%20of,birth%20asphyxia%20and%20birth%20trauma%2C. Accessed 7 Aug 2024
  41. Xu X, Zheng L, Yuan Q, Zhen G, Crane JL, Zhou X, Cao X (2018) Transforming growth factor-beta in stem cells and tissue homeostasis. Bone Res 6:2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Yang L, Li J, Xu L, Lin S, Xiang Y, Dai X, Liang G, Huang X, Zhu J, Zhao C (2019) Rhein shows potent efficacy against non-small-cell lung cancer through inhibiting the STAT3 pathway. Cancer Manag Res 11:1167–1176 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Ye Z, Hu Y (2021) TGF‑beta1: gentlemanly orchestrator in idiopathic pulmonary fibrosis (Review). Int J Mol Med 48:132 [DOI] [PMC free article] [PubMed]
  44. Youssef NS, Elzaitony AS, Abdel Baky NA (2022) Diacerein attenuate LPS-induced acute lung injury via inhibiting ER stress and apoptosis: impact on the crosstalk between SphK1/S1P, TLR4/NFkappaB/STAT3, and NLRP3/IL-1beta signaling pathways. Life Sci 308:120915 [DOI] [PubMed] [Google Scholar]
  45. Zeng F, Wang K, Duan H, Xu XT, Kuang GY, Lu M (2023) Diacerein versus non-steroidal anti-inflammatory drugs in the treatment of knee osteoarthritis: a meta-analysis. J Orthop Surg Res 18:308 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zhou P, Wu X, Chen K, Du J, Wang F (2024) Buyang Huanwu decoction ameliorates bleomycin-induced pulmonary fibrosis in rats by attenuating the apoptosis of alveolar type II epithelial cells mediated by endoplasmic reticulum stress. J Ethnopharmacol 319:117300 [DOI] [PubMed] [Google Scholar]
  47. Zhu Y, Yang S, Lv L, Zhai X, Wu G, Qi X, Dong D, Tao X (2022) Research progress on the positive and negative regulatory effects of rhein on the kidney: a review of its molecular targets. Molecules 27 [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data will be available upon request.

Articles from Naunyn-Schmiedeberg's Archives of Pharmacology are provided here courtesy of Springer

RESOURCES