Skip to main content
NCBI home page
PLOS One logoLink to PLOS One
. 2025 Apr 10;20(4):e0319273. doi: 10.1371/journal.pone.0319273

Current pattern of antibiotic resistance and molecular characterization of virulence genes in Klebsiella pneumoniae obtained from urinary tract infection (UTIs) patients, Peshawar

Zeeshan Khan 1, Qaisar Ali 1, Sadiq Azam 1,*, Ibrar Khan 1, Jamila Javed 2, Noor Rehman 3, Mesaik M Ahmed 4,5, Jalal Uddin 6, Ajmal Khan 7,8, Ahmed Al-Harrasi 7,*
Editor: Yung-Fu Chang9
PMCID: PMC11984708  PMID: 40208900

Abstract

The current study investigates the prevalence of virulence genes obtained from clinical isolates of multidrug-resistant (MDR) Klebsiella pneumoniae at Khyber Teaching Hospital Peshawar, from October 2021 to January 2023. Upon proper consent, clinical samples of suspected UTIs patients were collected and inoculated on the nutrients agar media, McConkey agar media, and Cysteine Lysine Electrolyte Deficient (CLED) agar media followed by incubation at 37°C for 24 hrs. The phenotypic and genotypic identification were employed for the bacterial isolates. The phenotypic identification includes gram staining followed by the Analytical Profile Index (API 20E). A total of 215 (3.85%) positive isolates were found with the highest prevalence observed among the female patients (4.35%) followed by male (3.26%). The highest prevalence, constituting 52.55% (n = 113), was detected in the age group of 21-40 years, followed by 31.62% (n = 68) in the 41-60 age group. Additionally, 10.23% (n = 22), 3.25% (n = 7), and 2.32% (n = 5) of cases were identified in the age groups of 01-10 years, 11-20 years, and above 60 years, respectively. Among the total positive samples, 44.65% (n = 96) were collected from the Outpatient department (OPD), while inpatient department (IPD) cases contributed 55.35% (n = 119). The antibiotic susceptibility profile of K. pneumoniae showed significant resistance to trimethoprim/Sulfamethoxazole (93%) and Colistin (79.07%). Tigecycline emerged as the most effective antibiotic with a sensitivity rate of 90%, along with Cefepime at the same level. Minimum Inhibitory Concentration (MIC) values indicated higher resistance for CTX, MEM, CN, AK, DO, CIP, and SXT in K. pneumoniae-causing UTIs from KTH, Peshawar. Molecular characterization of virulence genes reveals the highest prevalence of fimH (80%) followed by SAT (65%), papEF (49%), afa (29%), and VAT (16%). The sequencing data of the virulence genes reveals mutations in fimH and papEF, while sat, afa and vat virulence genes showed no mutations. The Chi-square test indicated a significant association between the types of bacteria, supporting our null hypothesis with a significance level of p ≤  0.05. The current study’s finding is to evaluate the rise of antibiotic resistance in hospital settings, which highly demands the focus of health authorities and clinicians to manage the burden of the disease effectively.

Introduction

Klebsiella pneumoniae is a Gram-negative, non-motile, facultative anaerobic bacterium in rod-shaped forms, varying in size from 1–2µm. It is commonly found in different strains as commensal, with some strains being pathogenic to humans [1]. Typically found in the human intestine, K. pneumoniae can cause various infections, including bacteremia, suppurative infections, soft tissue infections, osteomyelitis, or meningitis, and usually immunocompromised patients. Sometimes it colonizes human mucosal surfaces in the oropharynx and gastrointestinal (GI) tract [2]. K. pneumoniae is a member of the ESKAPE (Enterococcus spp, staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter spp) group and is considered the second-most uropathogenic bacterium after E. coli [3]. This bacterial species is a significant challenge due to its MDR, as it is highly reported for producing β-lactamases. Such resistance leads to limited treatment options. However, the variation in the pathogenicity of the K. pneumoniae strains can be attributed to the presence or expression of the virulence factors [4]. The enhancement of K. pneumoniaes’s pathogenicity is attributed to the presence of the MDR virulence Mega plasmid. Well-characterized virulence factors in K. pneumoniae include siderophores, lipopolysaccharides, and fimbriae [5]. These essential virulence factors are crucial in the initial stages of infection [6]. These structural components are critical in adherence, invasion, and development of infections [7]. In recent studies, several virulence factors, including porins, outer membrane proteins, iron transport systems, efflux pumps, and genes involved in allantoin metabolism, have been thoroughly characterized. Surface anchored proteins (SAT) are involved in the adhesion of bacterium to host cells [8]. Once attached to the host cell, Sat triggers the activation of signaling pathways that lead to the uptake of K. pneumoniae by the host cell. Type 1 fimbrial adhesin is found on the tip of fimbriae, which are hair-like structures that extend from the surface of K. pneumoniae [9]. The fimH is responsible for the binding of K. pneumoniae to specific carbohydrate molecules on the surface of host cells particularly in the urinary and respiratory tracts [9]. This interaction also ends in bacterial uptake. The absence of either Sat or FimH significantly weakens K. pneumoniae virulence. Additionally, a multitude of factors, including the capsule, lipopolysaccharide, siderophores, and efflux pumps, contribute to the pathogen’s virulence [10]. The presence of virulence factors and drug resistance mechanisms enhances the pathogen’s capability to establish and persist in the colonized form. Therefore, considering the pathogenicity of K. pneumoniae strains, molecular characterization of virulence genes in both community and hospital settings is necessary for the development of potential antibiotic therapies. Different studies have been reported on the epidemiology of resistant genes, but limited research has addressed the genomics and pathogenicity of different strains [11]. Therefore, the current research work was conducted to assess antibiotic susceptibility testing and molecular characterization of virulence genes in clinical isolates of K. pneumoniae obtained from UTIs patients in KTH, Peshawar.

Methodology

Isolation and identification of clinical samples

The current research study was conducted in the pathology laboratory at KTH, Peshawar, and the Molecular and Genomics laboratory, at the Center of Biotechnology and Microbiology, University of Peshawar from October 2021 to January 2023. Upon proper consent, the patient’s medical history, along with various parameters such as gender and age distribution. The study was approved by Khyber Medical College Peshawar Institutional Research and Ethical Board (IREB) Pakistan (No.124/DME/KMC).

Urine samples were collected from the UTIs patients and were inoculated on the nutrients agar media, McConkey agar media, and CLED agar media. The growth of bacterial samples was observed after incubation at 37°C for 24 hrs. Subsequently, both Phenotypic and genotypic identification were employed to identify the bacterial isolates. The phenotypic identification includes gram staining followed by the API 20E.

Extraction of genomic DNA

Genomic DNA was extracted from the 24 h old culture of confirmed bacterial isolates using a Thermo Scientific DNA Purification Kit. A 1% agarose gel was prepared in 1X Tris Acetate EDTA (TAE) buffer, and gel electrophoresis was conducted to confirm the presence of DNA. Gel DocTM Bio-Rad Molecular imager® was utilized to visualize the bands.

Molecular identification of bacterial isolates

Genotypic identification via a specific primer of WBBZ (567bp) as shown in Table 2, under optimized conditions was performed for confirmation of the bacterial isolates. The specific gene was amplified, followed by electrophoresis on a 2% agarose Gel. The resulting bands were visualized by using the Gel DocTM Bio-Rad Molecular imager®.

Table 2. Specific primers sequence used for molecular identification and virulence genes.

Target Genes Primer Sequence (5'–3') Amplicon Size PCR Conditions References
wbbz F: AGGATTGTATTCTGAAGGTC
R: TCAACTTGCCGTAATAAAGC		 576 Annealing(°C/s): 53/30 Present study
Sat F: CTACAGCTTGATCACCTATGGC
R: CTCCCTGGTATTTCTTTGTGG		 410 Annealing(°C/s): 59/60 [12]
Vat F: TTCACGGTACTGTTGTTCGC
R: CAGATAACTCCAGCGTCACG		 217 Annealing(°C/s): 54/60 [12]
fimH F: CGGCGTGTTATCTAGTTTTTCC
R: TAGGTAATACCCCAGGTTTTGG		 397 Annealing(°C/s): 57/60 [13]
papEF F: GCAACAGCAACGCTGGTTGCATCAT
R: AGAGAGAGCCACTCTTATACGGACA		 336 Annealing(°C/s): 57/30 [14]
Afa F: GCTGGGCAGCAAACTGATAACTCTC
R: CATCAAGCTGTTTGTTCGTCCGCCG		 750 Annealing(°C/s): 57/30 [14]
Open in a new tab

Antibiotic susceptibility testing

Using the Kirby Bauer disc diffusion method, the antibiotic susceptibility pattern of bacterial isolates was determined against various groups of antibiotics following the guidelines of the Clinical and Laboratory Institutes (CLSI-2022). A standardized bacterial suspension equivalent to 0.5 McFarland turbidity was prepared from the isolate. The suspension was evenly spread across the surface of a sterile Muller Hinton agar (MHA) plate using a sterile cotton swab to create a uniform lawn of bacteria. The swab was passed in three directions to ensure consistent coverage, with a final sweep along the edge of the plate. The agar plate was allowed to dry for a few minutes at room temperature to ensure proper adherence to the bacterial inoculum. Next, selected antibiotic discs were carefully placed on the agar surface using sterile forceps, ensuring even spacing to avoid overlapping zones of inhibition. The plates were then incubated for 24 h at 37°C in an inverted position to prevent condensation from affecting the diffusion of antibiotics. After incubation, the zones of inhibition around each disc were measured in millimeters. The results were interpreted according to CLSI guidelines as intermediate (I), resistant (R), or sensitive (S) as shown in Table 1.

Table 1. Selected specific antibiotics and their concentration used in the current research study.

S. No Antibiotic (Symbol) Concentration (µg) Inhibition zone (mm)
S I R
1 Amikacin (AK) 30 ≥30 15–16 ≤14
2 Gentamicin (CN) 10 ≥15 13–14 ≤12
3 Cefepime (FEP) 30 ≥25 19–24 ≤18
4 Amoxicillin-Clavulanate (AMC) 10/20 ≥18 14–17 ≤13
5 Levofloxacin (LEV) 5 ≥17 14–16 ≤13
6 Imipenem (IPM) 10 ≥23 20–22 ≤19
7 Colistin (CO) 30 ≥14 12–14 ≤12
8 Cefotaxime (CTX) 30 ≥26 23–25 ≤22
9 Piperacillin-tazobactam (TZP) 10/100 ≥21 18–20 ≤17
10 Ampicillin (AMP) 10 ≥17 14–16 ≤13
11 Sulfamethoxazole (SXT) 12.5/23.75 ≥16 11–15 ≤10
12 Ciprofloxacin (CIP) 10 ≥26 22–25 ≤21
13 Tobramycin (TOB) 10 ≥15 13–14 ≤12
14 Meropenem (MEM) 10 ≥23 20–22 ≤19
15 Cefoperazone-sulbactam (SCF) 30/75 ≥21 16–20 ≤15
16 Tigecycline (TGC) 15 ≥18 16–17 ≤15
Open in a new tab

Molecular characterization of the virulence genes

Specific PCR primers for the virulence genes as shown in Table 2, under optimized conditions, were employed in the investigation of all bacterial isolates. A total PCR reaction volume of 27 µl was prepared by combining 12.5 µl of 2x Thermo scientific master mix, 1 µl of forward and reverse primer, 2 µl of DNA template, and the remaining volume was filled with PCR grade water. The amplified products were then run on 2% agarose gel and visualized using the Del Doc® system.

Minimum inhibitory concentration (MIC)

The effectiveness of antibiotics is determined by their MIC values by using E-strips as shown in Table 3. The clinical isolates were inoculated on MHA media and strips were employed followed by incubation at 37°C for 24 h.

Table 3. E-Strip used for the MIC determination.

S. NO Antibiotic MIC E-Strips Symbol Breakpoint
S I R
1 Cefotaxime E-CT CTX ≤1 2 ≥4
2 Meropenem E-MP MEM ≤1 2 ≥4
3 Gentamycin E-GM CN ≤4 8 ≥16
4 Doxycycline E-DC DO ≤4 8 ≥16
5 Co-Trimoxazole E-TS SXT ≤2/38 – ≥4/76
6 Amikacin E-AK AK ≤16 – 64
7 Ciprofloxacin E-CL CIP ≤0.25 0.5 ≥1
Open in a new tab

Mutational analysis of PCR products

The amplified DNA was sent to the Genomic and Sequencing Laboratory of Khyber Medical University, Peshawar for sequencing by using the Sanger Sequencing method. The sequencing data were analyzed by different bioinformatics tools such as Bio-edit sequence alignment editor, and CLUSTLW. The consensus sequences were generated for each gene and checked through the NCBI Basic Local Alignment Search Tool (BLAST) to determine the local similarity between them.

Statistical analysis

An analysis using SPSS version 20 utilized chi-square to determine the association between the expected value and the observed value, revealing a significance level of p ≤  0.05. This analysis was conducted with a sample size (n) of 150, employing degrees of freedom calculated as n-1.

Results

Isolation and identification of Klebsiella pneumoniae

A total of 5,580 clinical isolates were analyzed, of which 215 were detected positive for K. pneumoniae, isolated in KTH, Peshawar from Urine samples. The highest prevalence, constituting 52.55% (n = 113), was detected in the age group of 21–40 years, followed by 31.62% (n = 68) in the 41-60 years age group. Additionally, 10.23% (n = 22), 3.25% (n = 7), and 2.32% (n = 5) of cases were identified in the age groups of 01–10 years, 11-20 years, and above 60 years, respectively. Among the total positive samples, 44.65% (n = 96) were collected from the Outpatient department (OPD), while inpatient department (IPD) cases contributed 55.35% (n = 119) as shown in Table 4. For the precise and accurate identification of K. pneumoniaee clinical isolates, the API kit was employed as shown in Fig 1 and S3 Fig. The API system includes a series of biochemical tests designed to exploit the metabolic activities of bacteria. Positive results were observed for catalase and urease activity, demonstrating the organism’s ability to hydrolyze urea and produce ammonia. Additionally, K. pneumoniaee exhibited positive fermentation of glucose and lactose, with acid detected as the product. Other biochemical tests, including indole production, phenylalanine deaminase activity, sucrose fermentation, and citrate utilization, also yielded positive results, further confirming the identity of the isolate.

Table 4. Different parameters of the clinical isolates obtained from UTIs patients.

Parameters Klebsiella pneumoniae (n = 215)
Number (%)
Gender Female 131 (4.35%)
Male 84 (3.26%)
Different age groups 01–10 yrs 22 (10.2%)
11–20 yrs 7 (3.2%)
21–40 yrs 113 (52.5%)
Above 60 yrs 68 (31.6%)
Patients’ status OPD 96 (44.6%)
IPD 119 (55.3%)
Open in a new tab

Fig 1. Analytical profile index result for the identification of Klebsiella pneumoniae.

Fig 1

Open in a new tab

Antibiotic susceptibility testing

The antibiotic-sensitivity pattern of K. pneumoniae revealed the resistance-sensitive percentage values in the Table 2. Especially, SXT stands out with the highest resistance rate, reaching 93%. Following closely is CO, exhibiting a resistance rate of 79.07%. Especially, SXT stands out with the highest resistance rate, reaching 93%. Following closely is CO, exhibiting a resistance rate of 79.07%. The TGC emerges as the most effective antibiotic, demonstrating a sensitivity rate of 90%. Similarly, FEP shows a high sensitivity level, also standing at 90%. The overall values are presented in Table 5.

Table 5. Antibiotic susceptibility pattern of K. pneumoniae against selected antibiotics.

S. No Antibiotic (Symbol) Resistance (%) Sensitive (%)
1 Amikacin (AK) 82.0 (38) 133.0 (62)
2 Gentamicin (CN) 76.0 (35) 139.0 (65)
3 Cefepime (FEP) 22.0 (10) 193.0 (90)
4 Amoxicillin-Clavulanate (AMC) 166.0 (87) 49.0 (23)
5 Levofloxacin (LEV) 153.0 (71) 62.0 (29)
6 Imipenem (IPM) 129.0 (60) 86.0 (40)
7 Colistin (CO) 170.0 (55) 45.0 (20.9)
8 Cefotaxime (CTX) 155.0 (72) 60.0 (28)
9 Piperacillin-tazobactam (TZP) 64.0 (30) 151.0 (70)
10 Ampicillin (AMP) 162.0 (75) 53.0 (25)
11 Sulfamethoxazole (SXT) 200.0 (93) 15.0 (7)
12 Ciprofloxacin (CIP) 162.0 (75) 53.0 (25)
13 Tobramycin (TOB) 65.0 (30) 150.0 (70)
14 Meropenem (MEM) 54.0 (25) 161.0 (75)
15 Cefoperazone-sulbactam (SCF) 78.0 (36) 137.0 (64)
16 Tigecycline (TGC) 22.0 (10) 193.0 (90)
Open in a new tab

Minimum inhibitory concentration (MIC)

The potency of antibiotics can be determined by their MIC valves, with MIC valves signifying greater effectiveness and higher MIC valves indicating diminished potency (S1, S2, S5 and S6 Figs). The K. pneumoniae causing UTIs obtained from the KTH, Peshawar revealed more resistance in the case of CTX, MEM, CN, AK, DO, CIP, and SXT as shown in Table 6.

Table 6. MIC of the selected antibiotic used against K. pneumoniae.

Antibiotics MIC50 (μg/ml) MIC90 (μg/ml) MIC range(μg/ml)
Cefotaxime (CTX) 128 192 4–192
Meropenem (MEM) 4 24 3–24
Gentamicin (CN) 16 16 4–16
Amikacin (AK) 16 192 1–192
Doxycycline (DO) 16 192 1–192
Ciprofloxacin (CIP) 32 256 0.094–256
Trimethoprim/Sulfamethoxazole (SXT) 32 32 0.064–32
Open in a new tab

Comprehensive molecular characterization of virulence genes in Klebsiella pneumoniae

A detailed analysis of the virulence genes among the total isolates of K. pneumoniae reveals the highest prevalence of fimH (80%) followed by SAT (65%), papEF (49%), and afa (29%). The lowest prevalence of VAT (16%) was recorded as shown in Table 7 and Fig 2 and S4 and S7 Figs.

Table 7. Distribution of virulence genes detected in K. pneumoniae.

Virulence genes Positive isolates (%) Negative isolates (%)
fimH 172 (80) 43 (20)
SAT 140 (65) 75 (35)
papEF 105 (49) 110 (51)
afa 63 (29) 152 (71)
VAT 35 (16) 180 (84)
Open in a new tab

Fig 2. (A) L2-L7 showing PCR products of FimH (397 bp); (B) L2-L9 representing PCR products of VAT (217 bp); (C) DNA ladder of 100 bp in L1 and L8, with L2-L7 showing PCR products of SAT (410 bp); (D) L1 and L10 illustrating a 100 bp DNA ladder, with L2-L9 representing PCR products of the afa gene (750 bp), (E) DNA ladder of 100 bp in L1 and L9, with L2-L8 showing PCR products of papEF (336 bp).

Fig 2

Open in a new tab

Combination of different virulence genes in K. pneumoniae

The distribution of virulence gene combinations is briefly presented, detailing the number of genes, occurrence frequency, and percentage for each combination. The most prevalent combination is Sat/fimH/papEF which is observed in 24 isolates accounting for 11.01% of the total occurrences. Following closely is Sat/fimH, with two genes occurring 21 times, constituting 9.5% of total isolates. Other distinguished combinations include fimH/papEF (2 genes, 15 occurrences, 6.9%), Sat/fimH/afa (3 genes, 11 occurrences, 5.19%), Sat/fimH/afa/vat (4 genes, 10 occurrences, 4.5%), Sat/afa/vat (3 genes, 9 occurrences, 4.34%), Sat/fimH/papEF/vat (5 genes, 6 occurrences, 2.9%), Sat/fimH/papEF/afa (4 genes, 7 occurrences, 3.32%), and Sat/fimH/papEF/vat/afa (5 genes, 6 occurrences, 2.7%) as shown in Table 8.

Table 8. Combination of the virulence genes and their frequency detected in K. pneumoniae.

Gene Combination Number of Genes Occurrence Frequency Percentage
Sat/fimH/papEF 3 24 11.01
Sat/fimH 2 21 9.5
fimH/papEF 2 15 6.9
Sat/fimH/afa 3 11 5.19
Sat/fimH/afa/vat 4 10 4.5
Sat/afa/vat 3 9 4.34
Sat/fimH/papEF/vat 5 6 2.9
Sat/fimH/papEF/afa 4 7 3.32
Sat/fimH/papEF/vat/afa 5 6 2.7
Open in a new tab

Distribution and prevalence of virulence gene combinations in clinical isolates

The analysis reveals a significant statistical correlation between antibiotic resistance phenotypes and the presence of virulence genes. The presence of different virotypes showed a statistically insignificant association (P value >  0.05) with antimicrobial resistance phenotypes. An inverse relationship was observed across all studied genes, virotypes, and phenotypic antibiotic resistance. The odds ratio indicated a negative correlation, with values less than 1. The various combinations of virulence genes and their corresponding association data are presented in Table 9.

Table 9. Combination of the virulence gene association with antibiotic association frequency.

Phenotypic Antibiotics Resistance Profile
Virulence Genes AMP AMC SAM TZP FEP CN SXT C FOS CTX CAZ ATM MEM IPM CN TOB
Total isolates Number Percentage Number Percentage Number Percentage Number Percentage Number Percentage Number Percentage Number Percentage Number Percentage Number Percentage Number Percentage Number Percentage Number Percentage Number Percentage Number Percentage Number Percentage Number Percentage
Vat/sat 23 23 100 23 100 6 26 13 56 16 69 13 56 17 73 6 26 6 26 23 100 12 52 17 73 6 26 6 26 00 00 9 39
Sat/fimH/papEF 4 3 75 3 75 1 25 4 100 3 75 2 50 3 75 1 25 0 00 4 100 4 100 3 75 1 25 1 25 0 00 2 50
sat/fimH 26 26 100 15 57 3 11 15 57 21 80 0 00 24 92 4 15 1 3.8 26 100 20 76 24 92 8 30 8 30 9 34 12 46
fimH/papEF 5 5 100 4 75 0 00 4 75 5 100 0 00 4 75 0 00 0 00 4 80 4 80 5 100 4 80 4 80 3 60 3 66
Sat/fimH/afa 3 3 100 3 100 0 00 1 25 3 75 1 25 2 66 1 33 1 33 3 100 2 66 3 100 2 66 2 66 0 00 2 67
Sat/fimH/afa/vat 1 1 100 0 0 0 00 0 00 1 100 0 00 1 100 0 00 0 00 1 100 1 100 1 100 0 00 0 00 0 00 0 00
Sat/afa/vat 1 1 100 1 100 0 00 0 00 1 100 1 100 1 100 0 00 0 00 1 100 0 00 1 100 1 100 1 100 1 100 1 100
sat/fimH/papEF/vat 3 3 100 1 33 0 00 2 66 2 67 0 0 3 100 0 00 0 00 3 100 2 66 3 100 0 00 0 00 2 66 2 66
Sat/fimH/papEF/afa 19 19 100 15 78 5 26 10 52 15 78 0 00 16 84 6 31 5 26 19 100 14 73 16 84 6 31 6 31 10 52 9 47
Open in a new tab

Statistical analysis

The Chi-square test indicated a significant association between the type of bacteria, supporting our null hypothesis with a significance level of p ≤  0.05. The one-way ANOVA test demonstrated a noteworthy relationship between the dependent and independent variables.

Discussion

Multidrug resistance K. pneumoniae is one of the leading causes of life-threatening among several infections globally. Ghafourian et al. reported that the extensive utilization of antimicrobial agents has contributed to the increase in the prevalence of MDR K. pneumoniae [15]. Ciccozzi et al. reported in the study that the rising prevalence of MDR in K. pneumoniae strains is a significant and determined public health risk, contributing to elevated levels of illness and death globally [16]. Manjula et al. reported that Gram-negative bacteria have developed mechanisms to resist existing antibiotics, highlighting the challenge in treating bacterial infections. Similarly, in the current research study, the highest prevalence rate of 89% MDR K. pneumoniae was identified, consistent with the 90.2% prevalence by Manjula et al. in the literature. In the reported study most of the strains showed resistance to various antibiotics including cephalosporins, penicillin, fluoroquinolones, sulfonamides, and aminoglycosides [17]. The antibiotic susceptibility profile of K. pneumoniae showed significant resistance to Amoxicillin/Clavulanate (87%), trimethoprim/Sulfamethoxazole (93%), and Colistin (79.07%). The reported study reveals that MDR K. pneumoniae is responsible for hospital-acquired infection and was found highly resistant toward tetracycline (95.2%), ciprofloxacin, and gentamycin (76.5% each), sulphathiazole (66.7%), nalidixic acid (61.9%) and norfloxacin (42.9%) [18]. Similarly, Indrajitha et al. (2021) reported a study regarding the drug resistance of K. pneumoniae which highlighted the 38% resistance to imipenem and 31% to meropenem respectively. The highest prevalence rate was detected in female patients (n = 131, 4.3%), followed by male patients (n = 84, 3.26%) in clinical isolates of K. pneumoniae in the current research study as supported by the reported study [19]. The prevalence of K. pneumoniae infection is increasing in Pakistan which is directly aligned with an increase in antibiotic resistance. This is consistent with the findings of Martin et al. (2016), who reported a 23% infection rate, and Zhang et al. (2018), who reported a 73.9% infection rate [20,21]. In the present study, the high prevalence rate of virulence genes such as fimH (80%), SAT (65%), papEF (49%), afa (29%), and VAT (16%) in the MDR K. pneumoniae were observed. The strains obtained from patients with UTIs were investigated to determine their high potential rate of pathogenicity. A similar study of the virulence genes was reported in hospital-acquired infection caused by K. pneumoniae strains in China, the UK, France, and Brazil [22–25]. According to the reported study, Type-I fimbriae is the most common and frequent adhesive factor in the strains of K. pneumoniae. However, the presence of this gene has been associated with increased susceptibility to UTIs. This type 1 fimbrial adhesion has been identified as a mediating factor in the binding of K. pneumoniae strains to the mucous tissue layer of respiratory and Urinary tracts [26]. Wasfi et al. (2016) reported that most of the MDR strains of K. pneumoniae express type-I fimbrial adhesions. Similarly in the current research study, the prevalence of FimH (80%), papEF (49%), and afa (29%), adhesive gene was identified [26]. Literature has reported that focused on the characterization of virulence factors in K. pneumoniae isolates performed statistical tests to evaluate the prevalence of fimH, which is crucial for adhesion and biofilm formation. The study utilized chi-square tests to analyze the correlation between the presence of fimH and the severity of UTIs, indicating a statistically significant association (p ≤  0.05) between fimH expression and increased virulence [27]. Another research paper assessed the prevalence of various virulence genes, including afa, vat, sat, and papEF, among clinical isolates of K. pneumoniae. One-way ANOVA was employed to compare the mean expression levels of these genes in multidrug-resistant (MDR) and non-MDR strains. The results showed significant differences (p ≤  0.05) in the expression of vat and papEf among different resistance profiles, revealing their potential role in the pathogenicity of MDR strain [28]. Similarly, in this current study, the virulence gene’s association with antibiotic resistance was determined. The analyzed study statistically correlates antibiotic resistance phenotypes and virulence genes. The presence of various virotypes demonstrated a varied statistical connection (P value >  0.05) with antimicrobial resistance phenotypes. Overall, there was a noted inverse association observed among all studied genes, virotypes, and phenotypic antibiotic resistance. The odds ratio revealed a negative correlation, representing a value of less than 1. The finding and mutation in the virulence genes may offer a molecular explanation of antibiotic resistance observed in the isolates of the conducted study.

Conclusion

The study highlights the critical global threat of antibiotic resistance, particularly in K. pneumoniae. The observed resistance in Gram-negative bacteria, remarkable to key antibiotics, signals a pressing need for alternative treatment strategies. The prevalence of MDR K. pneumoniae in hospital-acquired infections, especially among female patients, mirrors an alarming trend in Pakistan. The investigation into virulence gene expression provides valuable awareness of the molecular basis of antibiotic resistance. Urgent and concerted efforts are needed to address this growing challenge and develop effective therapeutic approaches against MDR bacterial infections.

Supporting information

S1 Fig. Bacterial growth on MacConkey agar media.

(JPG)

pone.0319273.s001.jpg (32.1KB, jpg)
S2 Fig. Gram staining of K. Pneumoniae.

(JPG)

pone.0319273.s002.jpg (36.8KB, jpg)
S3 Fig. Analytical Profile Index for the identification of K. pneumoniae.

(JPG)

pone.0319273.s003.jpg (48.9KB, jpg)
S4 Fig. Gel image of Wbbz (567 bp) for Molecular identification of K. pneumoniae: L1,L10: DNA ladder 100 bp, L2-L9: PCR product of Wbbz Gene.

(JPG)

pone.0319273.s004.jpg (30.9KB, jpg)
S5 Fig. Representative image of Antibiogram of K. pneumoniae.

(JPG)

pone.0319273.s005.jpg (29KB, jpg)
S6 Fig. Representative image of determination of MIC of K. pneumoniae determined by E-strip.

(JPG)

pone.0319273.s006.jpg (32KB, jpg)
S7 Fig. Original uncropped images of gel of Fig 2 of the main text.

(DOCX)

pone.0319273.s007.docx (864.8KB, docx)

Acknowledgments

The authors would like to thank the Higher Education Commision (HEC), Pakistan and University of Nizwa (UoN) for the generous support of this project. Informed consent was obtained from all subjects involved in the study.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

The authors extend their appreciation to the Deanship of Scientific Research at King Khalid University for funding this work through the Large Groups Project under grant number (RGP2/98/45). The project was supported by grant from The Oman Research Council (TRC) through the funded project (BFP/RGP/HSS/23/037).

References

  • 1.Rønning TG, Aas CG, Støen R, Bergh K, Afset JE, Holte MS, et al. Investigation of an outbreak caused by antibiotic-susceptible Klebsiella oxytoca in a neonatal intensive care unit in Norway. Acta Paediatr. 2019;108(1):76–82. doi: 10.1111/apa.14584 [DOI] [PubMed] [Google Scholar]
  • 2.Tsereteli M, Sidamonidze K, Tsereteli D, Malania L, Vashakidze E. Epidemiology of carbapenem-resistant Klebsiella pneumoniae in intensive care units of multiprofile hospitals in Tbilisi, Georgia. Georgian Med News. 2018;280(281):164–8. [PubMed] [Google Scholar]
  • 3.Mulani MS, Kamble EE, Kumkar SN, Tawre MS, Pardesi KR. Emerging strategies to combat ESKAPE pathogens in the era of antimicrobial resistance: a review. Front Microbiol. 2019;10:539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Martin RM, Cao J, Wu W, Zhao L, Manthei DM, Pirani A, et al. Identification of pathogenicity-associated loci in klebsiella pneumoniae from hospitalized patients. Msystems. 2018;3(3):e00015–18. doi: 10.1128/mSystems.00015-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Paczosa MK, Mecsas J. Klebsiella pneumoniae: Going on the offense with a strong defense. Microbiol Mol Biol Rev. 2016;80(3):629–61. doi: 10.1128/MMBR.00078-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Huynh DTN, Kim A-Y, Kim Y-R. Identification of pathogenic factors in klebsiella pneumoniae using impedimetric sensor equipped with biomimetic surfaces. Sensors (Basel). 2017;17(6):1406. doi: 10.3390/s17061406 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bien J, Sokolova O, Bozko P. Role of uropathogenic escherichia coli virulence factors in development of urinary tract infection and kidney damage. Int J Nephrol. 2012;2012:681473. doi: 10.1155/2012/681473 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Martin RM, Bachman MA. Colonization, infection, and the accessory genome of klebsiella pneumoniae. Front Cell Infect Microbiol. 2018;8:4. doi: 10.3389/fcimb.2018.00004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Gerlach G-F, Clegg S, Allen BL. Identification and characterization of the genes encoding the type 3 and type 1 fimbrial adhesins of Klebsiella pneumoniae. J Bacteriol. 1989;171(3):1262–70. doi: 10.1128/jb.171.3.1262-1270.1989 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Li B, Zhao Y, Liu C, Chen Z, Zhou D. Molecular pathogenesis of Klebsiella pneumoniae. Future Microbiol. 2014;9(9):1071–81. doi: 10.2217/fmb.14.48 [DOI] [PubMed] [Google Scholar]
  • 11.Ragheb SM, Tawfick MM, El-Kholy AA, Abdulall AK. Phenotypic and genotypic features of klebsiella pneumoniae harboring carbapenemases in Egypt: OXA-48-Like Carbapenemases as an investigated model. Antibiotics (Basel). 2020;9(12):852. doi: 10.3390/antibiotics9120852 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Saraylu J, Fallah-Mehrabadi J, Imani-Fooladi AA, Sabbaghi A, Molla-Aghamirzaei H, Hasankhani M. Prevalence and evaluation of toxin genes among uropathogenic Escherichia coli clinical isolates by duplex PCR. J Med Bacteriol. 2012;1(1–2):17–22. [Google Scholar]
  • 13.Sorsa J. Characterization of genomic diversity in extraintestinal pathogenic Escherichia coli (ExPEC) and development of a diagnostic DNA microarray for the differentiation of ExPEC isolates causing urinary tract infections. University of Helsinki; 2007. [Google Scholar]
  • 14.Le Bouguenec C, Archambaud M, Labigne A. Rapid and specific detection of the pap, afa, and sfa adhesin-encoding operons in uropathogenic Escherichia coli strains by polymerase chain reaction. J Clin Microbiol. 1992;30(5):1189–93. doi: 10.1128/jcm.30.5.1189-1193.1992 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ghafourian S, Bin Sekawi Z, Sadeghifard N, Mohebi R, Kumari Neela V, Maleki A, et al. The Prevalence of ESBLs producing klebsiella pneumoniae isolates in some major hospitals, Iran. Open Microbiol J. 2011;5:91–5. doi: 10.2174/1874285801105010091 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ciccozzi M, Cella E, Lai A, De Florio L, Antonelli F, Fogolari M, et al. Phylogenetic analysis of multi-drug resistant klebsiella pneumoniae strains from duodenoscope biofilm: Microbiological surveillance and reprocessing improvements for infection prevention. Front Public Health. 2019;7:219. doi: 10.3389/fpubh.2019.00219 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Manjula N, Math GC, Nagshetty K, Patil SA, Gaddad SM, Shivannavar C. Antibiotic susceptibility pattern of ESβL producing Klebsiella pneumoniae isolated from urine samples of pregnant women in Karnataka. J Clin Diagn Res. 2014;8(10):DC08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Fatima S, Liaqat F, Akbar A, Sahfee M, Samad A, Anwar M, et al. Virulent and multidrug-resistant Klebsiella pneumoniae from clinical samples in Balochistan. Int Wound J. 2021;18(4):510–8. doi: 10.1111/iwj.13550 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Indrajith S, Mukhopadhyay AK, Chowdhury G, AI Farraj DA, Alkufeidy RM, Natesan S, et al. Molecular insights of Carbapenem resistance Klebsiella pneumoniae isolates with focus on multidrug resistance from clinical samples. J Infect Public Health. 2021;14(1):131–8. doi: 10.1016/j.jiph.2020.09.018 [DOI] [PubMed] [Google Scholar]
  • 20.Martin RM, Cao J, Brisse S, Passet V, Wu W, Zhao L, et al. Molecular epidemiology of colonizing and infecting isolates of klebsiella pneumoniae. mSphere. 2016;1(5):e00261-16. doi: 10.1128/mSphere.00261-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Zhang Y, Wang Q, Yin Y, Chen H, Jin L, Gu B, et al. Epidemiology of carbapenem-resistant Enterobacteriaceae infections: report from the China CRE Network. Antimicrob Agents Chemother. 2018;62(2). doi: 10.1128/aac.01882-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Jian-Li W, Yuan-Yuan S, Shou-Yu G, Fei-Fei D, Jia-Yu Y, Xue-Hua W, et al. Serotype and virulence genes of Klebsiella pneumoniae isolated from mink and its pathogenesis in mice and mink. Sci Rep. 2017;7(1):17291. doi: 10.1038/s41598-017-17681-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Turton JF, Payne Z, Coward A, Hopkins KL, Turton JA, Doumith M, et al. Virulence genes in isolates of Klebsiella pneumoniae from the UK during 2016, including among carbapenemase gene-positive hypervirulent K1-ST23 and “non-hypervirulent” types ST147, ST15 and ST383. J Med Microbiol. 2018;67(1):118–28. doi: 10.1099/jmm.0.000653 [DOI] [PubMed] [Google Scholar]
  • 24.Kassaza K, Orikiriza P, Llosa A, Bazira J, Nyehangane D, Page A-L, et al. Lowenstein-Jensen selective medium for reducing contamination in Mycobacterium tuberculosis culture. J Clin Microbiol. 2014;52(7):2671–3. doi: 10.1128/JCM.00749-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lopes ACS, Rodrigues JF, Cabral AB, da Silva ME, Leal NC, da Silveira VM, et al. Occurrence and analysis of irp2 virulence gene in isolates of Klebsiella pneumoniae and Enterobacter spp. from microbiota and hospital and community-acquired infections. Microb Pathog. 2016;96:15–9. doi: 10.1016/j.micpath.2016.04.018 [DOI] [PubMed] [Google Scholar]
  • 26.Wasfi R, Elkhatib WF, Ashour HM. Molecular typing and virulence analysis of multidrug resistant Klebsiella pneumoniae clinical isolates recovered from Egyptian hospitals. Sci Rep. 2016;6(1):38929. doi: 10.1038/srep38929 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Stahlhut SG, Tchesnokova V, Struve C, Weissman SJ, Chattopadhyay S, Yakovenko O, et al. Comparative structure-function analysis of mannose-specific FimH adhesins from Klebsiella pneumoniae and Escherichia coli. J Bacteriol. 2009;191(21):6592–601. doi: 10.1128/JB.00786-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lopatto ED, Pinkner JS, Sanick DA, Potter RF, Liu LX, Bazán Villicaña J, et al. Conformational ensembles in Klebsiella pneumoniae FimH impact uropathogenesis. Proc Natl Acad Sci U S A. 2024;121(39):e2409655121. doi: 10.1073/pnas.2409655121 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Yung-Fu Chang

6 Dec 2024

PONE-D-24-44471Current Pattern of Antibiotic Resistance and Molecular Characterization of Virulence Gene in Klebsiella Pneumonia Obtained from Urinary Tract (UTIs) Infection Patient, PeshawarPLOS ONE

Dear Dr. Azam,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Your manuscript has been reviewed and a minor revision is suggested. Please follow the comments and make all necessary revision. 

Please submit your revised manuscript by Jan 20 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org . When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols .

We look forward to receiving your revised manuscript.

Kind regards,

Yung-Fu Chang

Academic Editor

PLOS ONE

Journal requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Please amend either the title on the online submission form (via Edit Submission) or the title in the manuscript so that they are identical. 3. Please include a caption for table 2.  4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.   In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 5. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. 6. Please ensure that you have specified a) Did participants provide their written or verbal informed consent to participate in this study?b) If consent was verbal, please explain i) why written consent was not obtained, ii) how you documented participant consent, and iii) whether the ethics committees/IRB approved this consent procedure." - In consent please state in Ethics Method section and manuscript if it is written or verbal. If consent was verbal, please explain a) why written consent was not obtained, b) how you documented participant consent, and c) whether the ethics committees/IRB approved this consent procedure. 7. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript. 

8. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: 1- All scientific name must be written in italic

2- Inoculation method in the antibiotics sensitivity test should be explained in more details.

3- Figures of gel electrophoresis should be with high resolution and the arrows pointed between two bands?!!

4- Statistical analysis not clearly showed in results section.

5- nutrient agar media not Nutrient agar Media.

6- The authors mentioned that bacterial isolates were identified by phenotype method using API test but the API test showed some biochemical not phenotype identification.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy .

Reviewer #1: Yes:  Hussein S. Salama

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/ . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org . Please note that Supporting Information files do not need this step.

PLoS One. 2025 Apr 10;20(4):e0319273. doi: 10.1371/journal.pone.0319273.r003

Author response to Decision Letter 1

8 Jan 2025

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Response: We follow the guidelines and format the MS

2. Please amend either the title on the online submission form (via Edit Submission) or the title in the manuscript so that they are identical.

Response: Done

3. Please include a caption for Table 2.

Response: Done

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

Response: The original uncropped images of the gel are given in the supporting information.

5. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

Response: Done

6. Please ensure that you have specified a) Did participants provide their written or verbal informed consent to participate in this study?

b) If consent was verbal, please explain i) why written consent was not obtained, ii) how you documented participant consent, and iii) whether the ethics committees/IRB approved this consent procedure."

- In consent please state in the Ethics Method section and manuscript if it is written or verbal. If consent was verbal, please explain a) why written consent was not obtained, b) how you documented participant consent, and c) whether the ethics committees/IRB approved this consent procedure.

Response: Written consent has been taken.

7. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript.

Response: done

8. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Response: done

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #1: 1- All scientific names must be written in italic

Response: Corrected throughout in the MS

2- The inoculation method in the antibiotics sensitivity test should be explained in more detail.

Response: It is explained in detail and highlighted

3- Figures of gel electrophoresis should be with high resolution and the arrows pointed between two bands?!!

Response: A clear and high-resolution figure has been added.

4- Statistical analysis is not clearly shown in the results section.

Response: the correction has addressed

5- nutrient agar media, not Nutrient agar Media.

Response: Corrected

6- The authors mentioned that bacterial isolates were identified by phenotype method using the API test, but the API test showed some biochemical not phenotype identification.

Response: The correction has been addressed in accordance with the reviewer’s query.

Attachment

Submitted filename: Responses to Reviewers comments_R1.docx

pone.0319273.s009.docx (19.1KB, docx)

Decision Letter 1

Yung-Fu Chang

30 Jan 2025

Current Pattern of Antibiotic Resistance and Molecular Characterization of Virulence Gene in Klebsiella pneumoniae Obtained from Urinary Tract (UTIs) Infection Patient, Peshawar

PONE-D-24-44471R1

Dear Dr. Azam,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager®  and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Yung-Fu Chang

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Acceptance letter

Yung-Fu Chang

PONE-D-24-44471R1

PLOS ONE

Dear Dr. Azam,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Yung-Fu Chang

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Bacterial growth on MacConkey agar media.

    (JPG)

    pone.0319273.s001.jpg (32.1KB, jpg)
    S2 Fig. Gram staining of K. Pneumoniae.

    (JPG)

    pone.0319273.s002.jpg (36.8KB, jpg)
    S3 Fig. Analytical Profile Index for the identification of K. pneumoniae.

    (JPG)

    pone.0319273.s003.jpg (48.9KB, jpg)
    S4 Fig. Gel image of Wbbz (567 bp) for Molecular identification of K. pneumoniae: L1,L10: DNA ladder 100 bp, L2-L9: PCR product of Wbbz Gene.

    (JPG)

    pone.0319273.s004.jpg (30.9KB, jpg)
    S5 Fig. Representative image of Antibiogram of K. pneumoniae.

    (JPG)

    pone.0319273.s005.jpg (29KB, jpg)
    S6 Fig. Representative image of determination of MIC of K. pneumoniae determined by E-strip.

    (JPG)

    pone.0319273.s006.jpg (32KB, jpg)
    S7 Fig. Original uncropped images of gel of Fig 2 of the main text.

    (DOCX)

    pone.0319273.s007.docx (864.8KB, docx)
    Attachment

    Submitted filename: Responses to Reviewers comments_R1.docx

    pone.0319273.s009.docx (19.1KB, docx)

    Data Availability Statement

    All relevant data are within the paper and its Supporting Information files.

    Articles from PLOS One are provided here courtesy of PLOS

    RESOURCES