Abstract
Ribosome stalling is a major source of cellular stress. Therefore, many specialized elongation factors help prevent ribosome stalling. One of the best characterized of these factors is EF-P, which prevents ribosome stalling at polyproline tracts and other difficult-to-translate sequences. Recent evidence suggests that other factors also facilitate translation of polyproline motifs. For example, YfmR was recently identified as a protein that prevents ribosome stalling at proline-containing sequences in the absence of EF-P. Here, we show that YebC2 (formerly YeeI) functions as a translation factor in Bacillus subtilis that resolves ribosome stalling at polyprolines. YebC2 associates with the ribosome, supporting a direct role for YebC2 in translation. Moreover, YebC2 can reduce ribosome stalling and support cellular fitness in the absence of EF-P and YfmR. Finally, we present evidence that YebC2 is evolutionarily distinct from previously characterized YebC-family transcription factors and demonstrate that these paralogs have distinct physiological roles in B. subtilis. Altogether our work identifies YebC2 as a translation factor that resolves ribosome stalling in B. subtilis and provides crucial insight into the relationship between YebC2, EF-P, and YfmR, three factors that prevent ribosome stalling at polyprolines.
Author summary
Polyproline motifs are essential structural features of many proteins but are difficult for the ribosome to synthesize. EF-P reduces ribosome pausing at polyproline motifs. Here, we show that YebC2 (formerly YeeI) can also prevent ribosome stalling at polyprolines. YebC2 belongs to the YebC family of proteins which have been characterized as transcription factors. However, YebC2 is evolutionarily distinct from these factors and associates with the ribosome, indicating it plays a direct role in translation. YebC2 is important for fitness in the absence of EF-P. Moreover, YebC2 over-expression can rescue the severe fitness defect of cells lacking EF-P and the newly characterized anti-stalling factor YfmR. Our work suggests that EF-P, YfmR, and YebC2 act independently to prevent ribosome stalling and are important for maintaining cellular fitness.
Introduction
Ribosomes catalyze peptide bond formation between amino acids to produce proteins. The polymerization rate is heavily influenced by the identity of the amino acids involved, with proline posing a special challenge since its side chain forms a rigid pyrrolidine loop that limits flexibility of the peptide backbone in the ribosomal exit tunnel [1,2]. EF-P was the first translation factor shown to resolve ribosome stalling at polyprolines and other difficult-to-translate sequences in bacteria [1–9]. EF-P interacts transiently with the ribosomal E site and then binds stably when tRNAPro is present in the P site [10,11] and promotes a favorable geometry of the polypeptide in the exit tunnel to facilitate peptide bond formation [1,2]. efp is essential in Mycobacterium tuberculosis, Acinetobacter baumannii, and Neisseria meningitidis [12–14]. In contrast, efp deletion from Bacillus subtilis causes sporulation and motility defects but does not cause a growth defect in standard lab conditions [15–19].
Recently, YfmR was identified as a protein that prevents ribosome stalling at polyproline tracts and Asp-Pro motifs in B. subtilis, and which is important for fitness in the absence of EF-P [20,21]. YfmR is a member of the ABCF family of ATPases that are widespread throughout bacteria and eukaryotes and have diverse roles in preventing ribosome stalling and mediating antibiotic resistance [22–27]. The Escherichia coli ortholog of YfmR, Uup, resolves ribosome stalling at polyprolines in vitro [28]. A recent structure of Uup bound to E. coli ribosomes reveals that it binds the ribosomal E site and makes contacts near the peptidyl-transferase center [29,30], suggesting that YfmR/Uup may promote peptide bond formation in a manner similar to EF-P. In support of this model, deletion of yfmR or efp does not result in a fitness defect in B. subtilis, whereas double deletion of both yfmR and efp results in a significant synthetic fitness defect [21].
The screen we used to identify YfmR also uncovered yebC2 (formerly yeeI) as a gene that may be important for fitness in ∆efp cells. Consistent with this finding, a screen performed by Hummels and colleagues in 2019 identified yebC2 (yeeI) as a gene whose over-expression could rescue the swarming motility defect of ∆efp B. subtilis cells [18]. YebC family proteins are annotated as transcription factors in bacteria since several of these proteins exhibit promoter binding activity and yebC deletion causes differential gene expression in E. coli, Pseudomonas aeruginosa, Lactobacillus delbrueckii, and Borrelia burgdorferi [31–34]. The human YebC homolog, TACO1, is localized to mitochondria where it is important for efficient translation of COX1 [35,36]. TACO1 was recently shown by mitoribosome profiling to prevent ribosome stalling at XPPX motifs and therefore accelerate translation of COX1 in human cells [37], and recent work by Ignatov and colleagues demonstrates that YebC in Streptococcus pyogenes (YebC_II) facilitates translation of polyproline motifs both in vivo and in vitro [38]. Altogether, these findings suggest that some YebC-family proteins play a role in translation.
Here, we show that B. subtilis YebC2 is a translation factor that prevents ribosome stalling at a polyproline tract and determine its genetic interaction with efp and yfmR. Depleting EF-P from ∆yebC2 cells causes a significant fitness defect, and this defect is even more severe in ∆yebC2∆yfmR cells. We find that ∆yebC2 cells exhibit increased ribosome stalling at a polyproline track in vivo and that over-expression of YebC2 in ∆efp cells reduces ribosome stalling. We further show that YebC2 co-migrates with 70S ribosomes by sucrose density gradient ultracentrifugation, which suggests that YebC2 facilitates translation by acting directly on the ribosome. Finally, we present evidence that YebC2 proteins represent a class of translation factors that are evolutionarily distinct from the previously characterized YebC transcription factors.
Results
Deletion of efp and yebC2 causes significant growth and translation defects
Previously, we investigated genetic interactions with efp using Tn-seq [20]. This screen predicted that yfmR is a gene that becomes important for fitness in the absence of EF-P, and we confirmed this result with CRISPRi [20]. Our Tn-seq screen also identified yebC2 (yeeI) as a gene with significantly more transposon-insertions in the wild-type than in the ∆efp background suggesting that it may be important for fitness in the absence of efp. To test this, we deleted yebC2 from ∆efp cells. Growth of ∆efp∆yebC2 is significantly impaired compared to ∆efp or ∆yebC2 single deletions (Fig 1A). We complemented this growth defect by providing a single copy of yebC2 integrated into the chromosome under the control of an IPTG-inducible promoter (Fig 1A). Moreover, ∆efp∆yebC2 cells exhibit a significant decrease in polysomes consistent with a defect in protein synthesis (Fig 1B). The decrease in actively translating ribosomes in the ∆efp∆yebC2 background was similar to what we and Takada and colleagues observed in ∆efp∆yfmR cells [20,21].
Fig 1. Loss of efp and yebC2 results in severe growth and fitness defects.
(A) Growth rates of ∆efp and ∆efp∆yebC2 in LB at 37˚C. The growth defect is complemented by expressing YebC2 from an IPTG-inducible promoter (∆efp∆yebC2 + yebC2). Error bars represent standard deviation of three independent experiments and p-values represent results of an unpaired t-test with Welch’s correction. (B) Polysome profiles of wild-type, ∆efp, and ∆efp∆yebC2 strains. A representative of three independent experiments is shown. Quantification shows relative abundance of each ribosomal species as determined by area under each curve. Error bars represent standard deviation of three independent experiments.
YebC2 over-expression rescues the synthetic fitness defect of ∆efp∆yfmR
Previously, we found that deletion of yfmR in B. subtilis ∆efp::mls is lethal [20]. However, removal of the erythromycin resistance marker allows construction of the ∆efp∆yfmR strain, but with a significant synthetic growth defect (Fig 2A) [21]. Therefore, we tested whether over-expression of YebC2 could rescue this synthetic defect. We expressed YebC2 under the control of an IPTG-inducible promoter in ∆efp∆yfmR cells. At both 30˚C and 37˚C over-expression of YebC2 significantly improves fitness, as determined by growth in liquid media and colony size measurements (Figs 2A, 2B and S1). Rescue was especially pronounced at the lower temperature of 30˚C (Fig 2A and 2B), consistent with previous observations that ∆efp∆yfmR cells are especially sensitive to lower temperatures [21]. Additionally, we tested whether YfmR over-expression could rescue growth of ∆efp∆yebC2 cells. Indeed, expression of YfmR in ∆efp∆yebC2 cells also rescued growth as determined by colony size measurements (Fig 2B). These data suggest that YebC2 supports cellular growth in the absence of EF-P and YfmR.
Fig 2. Ectopic expression of YebC2 significantly increases fitness of ∆efp∆yfmR cells.
(A) Growth in LB media at 30˚C of wild-type, ∆efp, ∆efp∆yfmR, and ∆efp∆yfmR expressing YebC2 from an IPTG-inducible promoter. Error bars represent standard deviation of 3 biological replicates. (B) Colony area measurements of indicated strains grown on LB plates for 48 hours at 30˚C. YfmR and YebC2 were expressed from an IPTG-inducible promoter. Error bars represent standard deviation and p-values represent results of an unpaired t-test with Welch’s correction. Growth curves and colony sizing for these strains at 37˚C shows similar results and is available in S1 Fig. (C) Schematic of CRISPR interference used to deplete EF-P. Guide RNA targeting efp is expressed constitutively while deactivated Cas9 (dCas9) is expressed from a xylose-inducible promoter. Addition of xylose blocks transcription of efp thereby depleting EF-P. (D) Results of EF-P depletion from ∆yfmR, ∆yebC2, or ∆yfmR∆yebC2 double deletion. Culture was serially diluted and plated on LB with and without xylose to induce expression of dCas9. A representative of >3 independent experiments is shown.
YebC2 is important for cellular fitness in the absence of EF-P and YfmR
To further characterize the genetic interaction between efp, yfmR, and yebC2, we constructed a strain to deplete EF-P using CRISPR interference [39]. This strain expresses a guide RNA (sgRNAefp) that blocks transcription of efp when expressed alongside a deactivated Cas9 (dCas9) [39,40](Fig 2C). Consistent with our previous observations, depleting EF-P from ∆yfmR cells decreased colony formation by 3 orders of magnitude compared to when EF-P was not depleted (Fig 2D). EF-P depletion from ∆yebC2 cells reduced colony formation by 2 orders of magnitude. Since depletion of EF-P from the ∆yebC2 and ∆yfmR single deletions caused a significant fitness defect in both backgrounds, we next sought to deplete EF-P from a ∆yebC2∆yfmR double deletion background. ∆yebC2∆yfmR cells did not exhibit a fitness defect. However, when EF-P was depleted from ∆yfmR∆yebC2 cells, colony formation decreased even more significantly than EF-P depletion from either of the single deletions (Fig 2D). These results demonstrate that YebC2 is important in cells lacking EF-P, and even more important in cells lacking both EF-P and YfmR. Moreover, since EF-P depletion from ∆yfmR∆yebC2 was more severe than depletion from either single mutant, and since over-expression of YebC2 or YfmR in the absence of the other two factors significantly rescues growth, we conclude that YebC2, YfmR, and EF-P can each independently support growth.
YebC2 reduces ribosomal stalling at polyprolines
To determine whether YebC2 is important for preventing ribosome stalling at polyprolines, we used an in vivo stalling reporter encoding an N-terminal Flag tag for detection and five consecutive prolines mid-way through the protein sequence (Fig 3A). If ribosomes stall at the polyproline tract a truncated stalled peptide is produced. Percent stalled peptide was determined by quantifying levels of stalled peptide divided by the sum of the stalled plus full-length peptide.
Fig 3. YebC2 prevents ribosome stalling at a polyproline tract in vivo and associates with 70S ribosomes.
(A) A reporter encoding a Flag-tagged penta-proline tract was used to monitor ribosome stalling in vivo. Western blot shows levels of stalled and full-length (FL) peptide. Percent stalling is reported as level of stalled protein divided by the sum of stalled and full-length peptide. Error bars indicate standard deviation of 3 biological replicates. P-values report the results of an unpaired t-test. (B) Lysate from a strain expressing His-tagged YebC2 was resolved by sucrose density gradient ultracentrifugation. Fractions were probed with anti-His antibody or a polyclonal antibody raised against EF-Tu as a positive control for ribosome association. His-tagged GFP was used as a negative control for ribosome association.
As expected, ribosome stalling is near undetectable in wild-type cells whereas significant stalling at the polyproline tract is observed in ∆efp cells (Fig 3A). ∆yebC2 cells also exhibit levels of stalled peptide that are significantly higher than in wild-type cells (Fig 3A). The ribosome stalling observed in ∆yebC2 cells (8 ± 1%) is not as high as in ∆efp cells (36 ± 4%), suggesting that EF-P is the main factor for preventing ribosome stalling at polyproline motif. Meanwhile, over-expression of YebC2 in ∆efp cells significantly reduces ribosome stalling (p = 0.0062). These results suggest that YebC2 prevents ribosome stalling at polyproline tracts.
Since both ∆efp and ∆yebC2 single deletions exhibit significant stalled peptide, we next determined levels of stalled peptide in ∆efp∆yebC2 cells. These cells exhibit very high levels of stalled peptide (64 ±8%), significantly higher than either of the single deletions. Providing YebC2 under the control of an IPTG-inducible promoter in ∆efp∆yebC2 cells complemented this phenotype and reduced stalled peptide to levels lower than that of the ∆efp single deletion.
Since YebC2 over-expression in ∆efp cells significantly reduced ribosome stalling, we next asked whether YebC2 over-expression can also reduce ribosome stalling in cells lacking both EF-P and YfmR. As observed previously, loss of both EF-P and YfmR causes high levels of ribosome stalling [20] (Fig 3A). Ribosome stalling was significantly reduced when these cells were provided with YebC2 under the control of an IPTG-inducible promoter (Fig 3A). Decreased ribosome stalling when YebC2 is over-expressed in the absence of EF-P and YfmR further demonstrates that YebC2 can function independently of EF-P and YfmR to prevent ribosome stalling.
YebC2 associates with ribosomes
To determine whether YebC2 interacts directly with the ribosome, we constructed a His-tagged version of YebC2 to monitor ribosome association. His-tagged YebC2 was functional, as evidenced by its ability to complement the impaired growth of ∆efp∆yebC2 cells (S2 Fig). Cells expressing His-tagged YebC2 were harvested in late exponential phase, and cell lysate was resolved by sucrose density gradient ultracentrifugation. We found that YebC2 co-migrates with ribosomes, including with 70S ribosomes (Fig 3B). In contrast, His-tagged GFP that served as a negative control for ribosome association was found only at the top of the gradient. Both 70S ribosomes and polysomes in sucrose density gradients contain actively translating ribosomes [41]. Although we observed YebC2 co-migration with 70S ribosomes, we did not detect YebC2 co-migration with polysomes, suggesting that either YebC2 does not interact with these ribosomes, or that the interaction is transient. Nevertheless, these results suggest that YebC2 exerts its anti-stalling activity by acting directly on the ribosome.
YebC2 is evolutionarily distinct from YebC transcription factors
Many bacterial species, including B. subtilis, encode two YebC-family paralogs [42]. The B. subtilis YebC2 paralog is called YrbC. AlphaFold modeling of YebC2 and YrbC from B. subtilis predicts a high degree of structural similarity (Fig 4A). However, the results of our Tn-seq screen did not suggest a genetic interaction between efp and yrbC since we detected a similar number of transposon insertions in yrbC in ∆efp cells as in wild-type cells [20]. Consistent with the results of the transposon-insertion screen, we did not detect increased ribosome stalling at polyprolines in ∆yrbC cells, or in ∆efp∆yrbC cells relative to Δefp cells (Fig 4B). Additionally, over-expression of YrbC from the same promoter used to over-express YebC2 did not reduce ribosome stalling in the ∆efp strain (Fig 4B).
Fig 4. YebC2 and YebC paralogs are structurally similar but evolutionarily distinct.
(A) AlphaFold model of the paralogs YebC2 (gray) and YrbC (green) from Bacillus subtilis. (B) Western blot showing levels of stalled and full-length (FL) peptide produced from a reporter for ribosome stalling at a penta-proline tract in vivo. Quantification reports the results of 3 biological replicates. Error bars represent standard deviation and p-values report the results of an unpaired t-test. (C) YebC2 proteins share a common ancestor exclusive of YebC-family transcription factors (99.9% maximum likelihood bootstrap value). Unrooted maximum-likelihood tree was built using all YebC family protein sequences detected in a database of >15,000 prokaryotic representative genomes. Bs, Bacillus subtilis; Ld, Lactobacillus delbrueckii; Pa, Pseudomonas aeruginosa; Ec, Escherichia coli; Bb, Borrelia burgdorferi; Sp, Streptococcus pyogenes. Clades containing proteins characterized in current literature are highlighted.
To determine the evolutionary relationship between the YebC paralogs we built a maximum likelihood tree based on the protein sequences of >15,000 YebC family proteins (Fig 4C). We found that the YebC paralogs that have experimental support for a role in transcription (YebC from E. coli, L. delbrueckii, B. burgdorferi and PmpR from P. aeruginosa) cluster together, while those that have a role in translation (B. subtilis and S. pyogenes YebC2 and E. coli YeeN) cluster separately (99.9% maximum likelihood bootstrap value) (Fig 4C). YebC2 from B. subtilis, E. coli, and S. pyogenes share a common ancestor exclusive of the YebC proteins that have been characterized as transcription factors (100% maximum likelihood bootstrap value) (S3 Fig). Importantly, this clustering is not based on species phylogeny, since B. subtilis YrbC clusters with the YebC transcription factors.
Residues that are important for the physiological function of YebC2 reside in Domain I
B. subtilis YebC2 and YrbC have high amino acid sequence identity (41%) (S3 and S4 Figs) and are predicted by AlphaFold to be structurally similar (Fig 4A). However, the results of our phylogenetic analysis (Fig 4C) and experiments with the polyproline stalling reporter (Fig 4B) suggest that YebC2 and YrbC have distinct roles in vivo. To investigate potential differences between the two proteins we modeled their electrostatic potential using ChimeraX [43]. We found that while both proteins are highly negatively charged, YebC2 contains a region of positive charge on the surface of Domain I that is negatively charged in YrbC (Fig 5A, 5B, and 5C).
Fig 5. Residues that are important for YebC2 function in vivo are in Domain I.
AlphaFold modeling of YebC2 (A) and YrbC (B) from Bacillus subtilis. Electrostatics are modeled with ChimeraX. (C) Amino acid sequence alignment from a portion of YebC2 and YebC paralogs highlighting difference in charges within a predicted surface region of Domain I. (D) Chimeric versions of YebC2 and YrbC as illustrated in the schematic were expressed in ∆efp∆yebC2 cells from an IPTG-inducible promoter. Flag-tagged in vivo reporter containing a penta-proline tract was used to determine which versions of the proteins could complement the ribosome stalling phenotype of ∆efp∆yebC2 cells. Quantification reports the results of 3 biological replicates. Error bars represent standard deviation. P-values report the results of an unpaired t-test that compares each of the indicated complementation strains to the ∆efp∆yebC2 uncomplemented strain. *** indicates p-value <0.001.
To test the contribution of Domain I to YebC2 function in vivo, we constructed strains expressing chimeric versions of YebC2 and YrbC. We replaced Domain I of YebC2 with Domain I of YrbC (YebCYrbC-D1) and we replaced Domain I of YrbC with Domain I of YebC2 (YrbCYebC2-D1). We expressed these chimeric proteins in the ∆efp∆yebC2 double deletion strain containing a reporter for polyproline stalling. As expected, expression of wild-type YebC2 complemented ∆efp∆yebC2 and reduced ribosome stalling below the levels of the ∆efp single deletion (Fig 5D). In contrast, expressing YrbC from the same promoter did not reduce ribosome stalling. When we expressed YebC2 encoding Domain I from YrbC (YebCYrbC-D1), this chimeric version of the protein failed to complement the ribosome stalling phenotype of ∆efp∆yebC2. However, when we expressed YrbC encoding Domain I of YebC2 (YrbCYebC2-D1), this chimeric version complemented the ∆efp∆yebC2 ribosome stalling phenotype to the same level as wild-type YebC2. These results suggest that residues that are important for YebC2 function reside in Domain I.
YebC proteins are widely distributed in bacteria while YebC2 proteins are more restricted
Having determined that YebC and YebC2 proteins are evolutionarily distinct, we next determined the conservation of these paralogs across the bacterial domain (Fig 6) (S1 Table). 87% of the >15,000 bacterial genomes we surveyed encode at least one YebC-family protein (either YebC or YebC2), consistent with its likely presence in the common ancestor of bacteria [42]. YebC is much more widely distributed and highly conserved than YebC2. We detected YebC in 80% of our surveyed genomes and YebC2 in only 13%. YebC2 was mainly restricted to Firmicutes (Bacillota) and Gammaproteobacteria. Interestingly, organisms that encode YebC2 were more likely to lack the YebC paralog. Of the taxa encoding YebC2 only 34% encoded YebC. Interestingly, some organisms encode up to 3 YebC paralogs and up to 2 YebC2 paralogs (Fig 6) (S1 Table). The broad conservation of YebC-family proteins suggests that they impart a strong selective advantage in the organisms that encode them.
Fig 6. Distribution of YebC-family paralogs in bacteria.
A midpoint rooted 16S maximum-likelihood phylogenetic tree of species in the bacterial domain, indicating the number of yebC2 or yebC genes in each genome. YebC2 paralogs are most well-conserved in Firmicutes (Bacillota), and Gammaproteobacteria whereas YebC paralogs are widely distributed across most bacterial phyla. 87% of surveyed genomes encode at least one YebC-family protein.
Discussion
Here we show that YebC2 is a ribosome-associated protein that reduces ribosome stalling at a penta-proline tract in vivo (Fig 3). These findings are in complete agreement with the elegant work of Brischigliaro and Krüger and colleagues and Ignatov and colleagues which recently determined a similar role for human TACO1 and S. pyogenes YebC_II [37,38]. Our work further shows that simultaneous loss of YebC2, EF-P, and YfmR greatly reduces the viability of the bacterium B. subtilis (Figs 1 and 2), and that YebC2 can reduce ribosome stalling in the absence of EF-P and YfmR (Fig 3). We also detect YebC2 associated with ribosomes, including 70S ribosomes, suggesting that YebC2 may function in translation elongation (Fig 3B). Altogether, this work contributes to a more complete understanding of the various factors that prevent ribosome stalling at polyproline tracts.
Our data support a model in which EF-P, YfmR, and YebC2 independently prevent ribosome stalling and support cellular fitness. An independent role for YebC2 is demonstrated by its ability to prevent ribosome stalling on a polyproline tract in cells lacking both EF-P and YfmR (Fig 3). If YebC2 were dependent on either EF-P or YfmR for its activity, it would be unable to rescue growth or prevent ribosome stalling in the ∆efp∆yfmR background. In agreement with these results, EF-P depletion from ∆yfmR∆yebC2 cells reduces viability more than EF-P depletion from either the ∆yfmR or ∆yebC2 single deletions (Fig 2). Thus, loss of all three factors is more detrimental than loss of any two factors which further suggests that these factors have some redundant function and that the presence of at least one factor is important for fitness.
How does YebC2 reduce ribosome stalling? Using a reporter for ribosome stalling at a polyproline tract, we observe that ∆efp∆yebC2 and ∆efp∆yfmR cells exhibit increased levels of stalled peptide accompanied by decreased levels of full-length peptide (Fig 3A). In both strains, over-expression of YebC2 decreases levels of truncated peptide while increasing levels of full-length peptide (Fig 3A). These observations suggest that YebC2 may directly promote translation of the full-length peptide. Consistent with this possibility, Ignatov and colleagues found that YebC_II from S. pyogenes likely makes contacts with the base of Helix 89 of the large ribosomal subunit near the region where the acceptor stems of the A- and P-site tRNAs come into proximity for peptidyl transfer [38]. A structure of YebC2 bound to the ribosome is necessary to show the precise role YebC2 in enhancing translation at polyprolines.
In B. subtilis, ribosomes that stall upstream of the 3’ end of the mRNA are split from the mRNA by MutS2 and the stalled peptide remains bound to the P-site tRNA and obstructs the exit tunnel of the large subunit [44,45]. The stalled peptide is targeted for degradation through the template-free addition of an alanine tag by RqcH [46–49]. The stability of the truncated peptide produced from ribosome stalling at polyprolines suggests that addition of alanine to the polyproline tract may pose a special challenge for RqcH. Interestingly, the eukaryotic EF-P homolog, eIF5A, facilitates CAT-tailing by the RqcH homolog Rqc2 [50]. Therefore, along with promoting translation of full-length peptide, it remains an exciting possibility that YebC2 promotes alanine addition by RqcH. These possibilities are not mutually exclusive, both involve a role for YebC2 in promoting peptidyl-transfer, and the co-migration of YebC2 with 70S and 50S ribosomes that we observe by sucrose density gradient ultracentrifugation is consistent with either of these possibilities (Fig 3B).
Although we observe anti-stalling activity for EF-P, YfmR, and YebC2 on a penta-proline reporter, it is likely these factors prevent ribosome stalling at sequences that extend beyond prolines. For example, YfmR also prevents ribosome stalling on polyacidic residues [21]. Meanwhile, EF-P promotes peptide bond formation at other difficult-to-translate sequences [51,52]. EF-P likely plays a role in formation of the first peptide bond since it recognizes both tRNAPro and initiating tRNAfMet in the P site [11,53]. Moreover, EF-P promotes peptide bond formation between initiating formyl-methionine and the second amino acid and helps maintain the reading frame during early elongation [54–56]. YfmR may also participate in early elongation since YfmR depletion in ∆efp cells causes increased association of initiator tRNA with stalled ribosomes [20]. Finally, there is also evidence that YebC2 plays a role at non-proline encoding sequences since deletion of the YebC2 ortholog in yeast causes a more general defect in protein synthesis, with reduced overall synthesis of mitochondrial-localized reporters [57].
YebC family proteins are widely annotated as transcription factors [31–34,58,59]. By analyzing YebC family protein sequences, we found that these proteins cluster into divergent clades in agreement with experimental evidence supporting their roles in either transcription or translation (Fig 4). Since B. subtilis encodes both YebC2 and YebC (YrbC) we investigated the physiological role of each protein in vivo. We found that while YebC2 over-expression from an IPTG-inducible promoter could reduce levels of ribosome stalling at a polyproline tract in ∆efp cells (Fig 3A), YrbC expression from the same promoter did not reduce stalled peptide levels (Fig 4B). Moreover, whereas we detect significant levels of stalled peptide in ∆yebC2 cells, we do not detect significant stalling at the same polyproline tract in ∆yrbC cells (Fig 4B). Interestingly, E. coli YebC resolves ribosome stalling at a penta-proline tract in vitro [38] despite its reported role in transcription [34]. Since E. coli YebC clades with characterized YebC/YrbC transcription factors (Fig 4C), it is possible that B. subtilis YrbC also reduces ribosome stalling in vitro. However, our data suggest that YrbC does not have a significant physiological role in reducing ribosome stalling at a polyproline tract in vivo.
YebC2 is conserved primarily within Firmicutes (Bacillota) and Gammaproteobacteria while YebC is broadly conserved and was likely present in the common ancestor of bacteria (Fig 6). The retention of both YebC and YebC2 paralogs in many taxa further supports a model in which these proteins impart unique selective advantages due to independent physiological roles. We also note that many taxa encode more than one YebC2 and up to three YebC paralogs per genome (Fig 6). A similar observation has been made recently for EF-P, in which EF-P paralogs (EfpL) have been identified in approximately 12% of bacterial genomes [60]. Ribosome profiling revealed that EF-P and EfpL have both overlapping and non-overlapping substrate specificities, and are subjected to different modes of post-translational modification to regulate their activities [60]. Future work is necessary to determine the precise substrates and physiological roles of the YebC2 paralogs in diverse species.
Materials and Methods
Strains and media
Strains were derived from B. subtilis 168 trpC2 and are listed in Table 1. Single deletions were obtained from the BKK collection [63] and moved into the lab’s 168 trpC2 strain by natural transformation. The kanamycin resistance cassette was excised to make clean deletions using pDR244 [63]. B. subtilis strains were cultured in LB and supplemented with antibiotics at final concentrations of 100 µg/mL spectinomycin, 1x MLS (1 µg/mL erythromycin and 25 µg/mL lincomycin), or 5 µg/mL chloramphenicol. E. coli DH5alpha strains were cultured in LB with 100 µg/mL ampicillin.
Table 1. Strains, plasmids, and primers.
| Strain (strain number) | Description | Source |
|---|---|---|
| HAF1 | 168 trpC2 B. subtilis wild type | [61] |
| HAF242 | 168 trpC2 Δefp::kan | [19] |
| HAF450 | 168 trpC2 ΔyebC2::kan | This study |
| HAF451 | 168 trpC2 ΔyfmR::kan | This study |
| HRH575 | 168 trpC2 Δefp | This study |
| HRH802 | 168 trpC2 ΔyebC2 | This study |
| HRH804 | 168 trpC2 ΔyfmR | This study |
| HAF519 | 168 trpC2 Δefp ΔyebC2::kan | This study |
| HAF521 | 168 trpC2 Δefp ΔyfmR::kan | This study |
| HRH1132 | 168 trpC2 ΔyebC2::kan ΔyfmR | This study |
| HAF518 | 168 trpC2 Δefp ΔyebC2::kan amyE::Phyper-YfmR | This study |
| HAF527 | 168 trpC2 Δefp ΔyebC2::kan amyE::Phyper-YebC2 | This study |
| HAF528 | 168 trpC2 Δefp ΔyfmR amyE::Phyper-YebC2 | This study |
| HRH774 | 168 trpC2 WT lacA::Pxyl-dCas9 | This study |
| HRH776 | 168 trpC2 Δefp::kan lacA::Pxyl-dCas9 | This study |
| HRH1022 | 168 trpC2 ΔyfmR::kan lacA::Pxyl-dCas9 | This study |
| HRH1024 | 168 trpC2 ΔyebC2::kan lacA::Pxyl-dCas9 | This study |
| HRH1134 | 168 trpC2 ΔyebC2::kan ΔyfmR lacA::Pxyl-dCas9 | This study |
| HRH829 | 168 trpC2 Δefp::kan lacA::Pxyl-dCas9 amyE::Pveg-sgRNAyebC2 | This study |
| HRH1042 | 168 trpC2 ΔyfmR::kan lacA::Pxyl-dCas9 amyE::Pveg-sgRNAefp | This study |
| HRH1053 | 168 trpC2 ΔyebC2::kan lacA::Pxyl-dCas9 amyE::Pveg-sgRNAefp | This study |
| HRH1137 | 168 trpC2 ΔyebC2::kan ΔyfmR lacA::Pxyl-dCas9 amyE::Pveg-sgRNAefp | This study |
| HRH1177 | 168 trpC2 WT sacA::Phyper-3xFLAG-rfp-cfp | This study |
| HRH1193 | 168 trpC2 Δefp sacA::Phyper-3xFLAG-rfp-cfp | This study |
| HRH1178 | 168 trpC2 ΔyfmR sacA::Phyper-3xFLAG-rfp-cfp | This study |
| HRH1179 | 168 trpC2 ΔyebC2 sacA::Phyper-3xFLAG-rfp-cfp | This study |
| HRH1195 | 168 trpC2 Δefp ΔyfmR::kan sacA::Phyper-3xFLAG-rfp-cfp | This study |
| HRH1197 | 168 trpC2 Δefp ΔyebC2 sacA::Phyper-3xFLAG-rfp-cfp | This study |
| HRH1180 | 168 trpC2 ΔyebC2 ΔyfmR sacA::Phyper-3xFLAG-rfp-cfp | This study |
| HRH1185 | 168 trpC2 Δefp amyE::Phyper-YfmR sacA::Phyper-3xFLAG-rfp-cfp | This study |
| HRH1187 | 168 trpC2 Δefp amyE::Phyper-YebC2 sacA::Phyper-3xFLAG-rfp-cfp | This study |
| HRH1199 | 168 trpC2 Δefp ΔyfmR::kan amyE::Phyper-YebC2 sacA::Phyper-3xFLAG-rfp-cfp | This study |
| HRH1201 | 168 trpC2 Δefp ΔyebC2::kan amyE::Phyper-YfmR sacA::Phyper-3xFLAG-rfp-cfp | This study |
| HRH1203 | 168 trpC2 Δefp ΔyebC2::kan amyE::Phyper-YebC2 sacA::Phyper-3xFLAG-rfp-cfp | This study |
| HRH1205 | 168 trpC2 Δefp ΔyfmR::kan amyE::Phyper-YfmR sacA::Phyper-3xFLAG-rfp-cfp | This study |
| HRH1181 | 168 trpC2 WT sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HRH1194 | 168 trpC2 Δefp sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HRH1182 | 168 trpC2 ΔyfmR sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HRH1183 | 168 trpC2 ΔyebC2 sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HRH1207 | 168 trpC2 Δefp ΔyfmR::kan sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HRH1209 | 168 trpC2 Δefp ΔyebC2::kan sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HRH1184 | 168 trpC2 ΔyebC2 ΔyfmR sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HRH1190 | 168 trpC2 Δefp amyE::Phyper-YfmR sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HRH1191 | 168 trpC2 Δefp amyE::Phyper-YebC2 sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HRH1211 | 168 trpC2 Δefp ΔyfmR::kan amyE::Phyper-YebC2 sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HRH1213 | 168 trpC2 Δefp ΔyebC2::kan amyE::Phyper-YfmR sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HRH1215 | 168 trpC2 Δefp ΔyebC2::kan amyE::Phyper-YebC2 sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HRH1217 | 168 trpC2 Δefp ΔyfmR::kan amyE::Phyper-YfmR sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HAF602 | 168 trpC2 Δefp ΔyebC2::kan amyE::Phyper-yebC2yrbC-D1 sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HF603 | 168 trpC2 Δefp ΔyebC2::kan amyE::Phyper-yrbCyebC2-D1 sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HAF604 | 168 trpC2 Δefp ΔyebC2::kan amyE::Phyper-yrbC sacA::Phyper-3xFLAG-rfp-5xprolines-cf | This study |
| HAF586 | 168 trpC2 Δefp amyE::Phyper-yrbC sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| HAF582 | 168 trpC2 ∆efp ∆yrbC::kan sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| Plasmid | Description | Source |
| pHRH703 | pDR111 amyE::Phyper-B. subtilis YebC2 | This study |
| pHRH706 | pDR111 amyE::Phyper-B. subtilis YfmR | [20] |
| pHRH1021 | pJMP2 amyE::Pveg-sgRNAefp | This study |
| pHRH819 | pJMP2 amyE::Pveg-sgRNAyebC2 | This study |
| pHRH899 | pDR111 amyE::Phyper-3xFLAG-rfp-cfp | [20] |
| pHRH903 | pDR111 amyE::Phyper-3xFLAG-rfp-5xprolines-cfp | [20] |
| pECE174 | SacA integration plasmid to B. subtilis | [62] |
| pHRH1169 | pECE174 sacA::Phyper-3xFLAG-rfp-cfp | This study |
| pHRH1173 | pECE174 sacA::Phyper-3xFLAG-rfp-5xprolines-cfp | This study |
| Primer | Sequence | Source |
| HRH sgRNA-efp-3 | 5’- gctcgtgttgtacaataaatgtatcgcgccagtgcgaaggttggttttagagctagaaatagcaagttaaaataaggc -3’ | This study |
| HRH sgRNA-YeeI-3 | 5’- gctcgtgttgtacaataaatgtacgccgccacataaatctcagttttagagctagaaatagcaagttaaaataaggc -3’ | This study |
| HRH175 | 5’- acatttattgtacaacacgagcc-3’ | [20] |
| HRH155 | 5’- taattgtgagcggataacaattaagcttggaggaaaaaaaatgggccgtaagtggaaca -3’ | This study |
| HRH156 | 5’- ctcgtttccaccgaattagcttgcatgcttactcacctaaatcaacgttatgatatacc -3’ | This study |
| HRH157 | 5’- attgtgagcggataacaattaagcttggaggaaaaaaaatgagcatattaaaagcggaa -3’ | This study |
| HRH158 | 5’- acctcgtttccaccgaattagcttgcatgcttagctttccagttcttcga -3’ | This study |
| HRH204 | 5’- gccgatgataagctgtcaaacatgagaattcgactctctagcttgaggcatc -3’ | This study |
| HRH205 | 5’- tggtaatggtagcgaccggcgctcaggatcctaactcacattaattgcgttgc -3’ | This study |
Complementation of yebC2 and yfmR
Primers are listed in Table 1. yebC2 was amplified from the wild-type B. subtilis 1772 WT 168 trpC2 genomic DNA using primers HRH155 and HRH156 which contain 22 bp of homology to pDR111. Primers HRH157 and HRH158 were used to amplify yfmR. The resulting fragments were cloned by Gibson assembly into pDR111 cut with HindIII and SphI. The resulting plasmids, pHRH703 (Phyper-YebC2) and pHRH706 (Phyper-YfmR), were linearized with ScaI and transformed for integration on the chromosome at amyE. For the experiment exchanging Domain I of YebC2 and YrbC residues 1–74 of YebC2 were exchanged with residues 1–76 of YrbC. The chimeric versions of these genes were ordered as gene blocks from Integrated DNA Technologies and assembled into pDR111 by Gibson assembly. For over-expression of YrbC and YebC2, untagged yrbC and yebC2 were ordered as gene blocks from Integrated DNA Technologies and assembled into pDR111 by Gibson assembly.
Growth curves
B. subtilis strains were grown overnight at room temperature, and inoculated to a final OD600 0.05 in 150 µl LB, and supplemented with 1 mM IPTG where appropriate in a 96 well-plate (ThermoScientific 167008). The cultures were incubated at 30°C and 37°C with linear shaking (2-mm intensity). OD600 of strains was measured at 15-minute intervals over 20 hours using a microplate reader (BioTek).
Colony size measurement
B. subtilis strains were cultured in LB at room temperature or 37°C overnight in a roller drum at 80 rpm. 1 mM IPTG was added to the strains overexpressing Yebc2 or YfmR. The cells were normalized to OD600 0.05, serially diluted, and plated onto two LB agar plates for incubation at 30°C or 37°C for 24 hours, and placed at room temperature for 24 hours before imaging with ChemiDoc MP (Biorad). The area of individual colonies was quantified using ImageJ [64].
CRISPRi depletion
Primer HRH sgRNA-efp-3 containing an sgRNA sequence (5’-tcgcgccagtgcgaaggttg-3’) was designed to target EF-P. HRH sgRNA-efp-3 and HRH175 [20] were used to amplify pJMP2 [40], generating pHRH1021. pJMP1 carrying dCas9 under a xylose-inducible promoter [40] was transformed into the single deletion strains ΔyebC2::kan (HAF450) and ΔyfmR::kan (HAF451) and the double deletion strain ΔyebC2ΔyfmR (HRH1132). Next, pHRH1021 was transformed into the strains harboring dCas9, therefore producing EF-P depletion strains. The resulting B. subtilis CRISPRi knockdown strains were cultured overnight without xylose and diluted to an OD600 0.05 in PBS. The cultures were subsequently diluted 10-fold as 10−2 to 10−6 and spotted onto LB agar without xylose or onto LB agar containing 5% xylose and incubated for 12 hours at 37˚C.
Proline stalling reporter and western blots
The RFP-CFP fusion cassette containing a pentaproline stalling motif (5’-ccaccaccaccaccc-3’) or the reporter cassette without the motif were amplified using primers HRH204 and HRH205 from the previous constructs pHRH899 and pHRH903 (Table 1). The resulting fragments were cloned into pECE174 [62] plasmid cut with EcoRI and BamHI, producing pHRH1169 and pHRH1173. The resulting reporter plasmids were sequenced by Plasmidsaurus and linearized with ScaI to transform into the different combinations of deletions in B. subtilis for recombination at sacA. The reporter strains were grown overnight with 1 mM IPTG and then diluted back to OD600 0.05. The diluted cultures were induced with 1 mM IPTG and grown up to OD600 1.2 at 37°C. Cell cultures were normalized by OD and resuspended in 60 µL of lysis buffer (10 mM Tris pH 8, 50 mM EDTA, 1 mg/mL lysozyme), then incubated at 37°C for 10 min then added to 4x SDS-PAGE loading buffer. Samples were heated at 85 °C for 5 min and immediately cooled on ice. 12 µL samples were loaded onto a 12% SDS-PAGE gel and run at 150 V for 70 min. The protein was transferred to PVDF membrane (Biorad) at 300 mAmp for 110 min. The membrane was blocked with 3% BSA for 20 min and incubated with 1 µL anti-FLAG monoclonal antibody (Sigma A8592) in 10 mL 3% BSA for 2 hours at room temperature. The membrane was washed 3 times with PBS-T and developed with ECL (Biorad170-5060) for 2 min and imaged on ChemiDocMP (Biorad).
Polysome profiling
Strains were grown overnight at 37°C and inoculated to an OD600 of 0.05 in 40 ml LB the next morning. Cells were collected at OD600 1.2 by centrifugation at 8000 rpm for 10 minutes (Beckman Coulter Avanti J-15R, rotor JA-10.100). Cell pellets were resuspended in 200 µl gradient buffer containing 20 mM Tris (pH 7.4 at 4˚C), 0.5 mM EDTA, 60 mM NH4Cl, and 7.5 mM MgCl2 and 6mM 2-mercaptoethanol. Cells were lysed using a homogenizer (Beadbug6, Benchmark) by five 20 second pulses at speed 4350 rpm with chilling on ice for 2 min between the cycles and clarified by centrifugation at 21,300 rcf for 20 min (Eppendorf 5425R, rotor FA-24x2). Clarified lysates were normalized to 1500 ng/µl and loaded onto 10–40% sucrose gradients in gradient buffer and run for 3 hours at 30,000 rpm at 4°C in an SW-41Ti rotor. Gradients were collected using a Biocomp Gradient Station (BioComp Instruments) with A260 continuous readings (Triax full spectrum flow cell). The area under each peak was quantified using Graphpad Prism.
Detection of YebC2 ribosome association
We constructed a strain expressing YebC2 encoding an in-frame 6X-Histidine tag immediately after Gly74 in an unstructured loop. We verified that this tagged YebC2 was functional by determining that it could complement the ∆efp∆yebC2 growth defect (S2 Fig). Ribosomes from this strain were resolved by sucrose density gradient ultracentrifugation as described for polysome profiling. Resulting fractions were resolved by SDS-PAGE, transferred to PVDF membrane and probed with anti-His antibody (Invitrogen MA1-21315-HRP).
Gene detection
Genes were detected in a database of >18,000 representative prokaryotic genomes from NCBI RefSeq using HMMER v3.3 (nhmmer) (hmmer.org) with an E-value cutoff of 0.05 and a query of characterized yebC-family gene sequences (S1 Data). Hits were classified as either yebC or yebC2 depending on the gene query that resulted in a higher sequence bit score, and therefore greater homology. Genomes were filtered for <10% CheckM contamination [65], which left us with 15,259 genomes to survey.
Phylogenetics and protein modeling
16S rRNA sequences of all genomes were identified and acquired using BLAST v2.13.0, aligned using MAFFT v7.453, and applied to FastTree v2.1.11 [66] to infer a maximum-likelihood tree [67]. FastTree produces unrooted phylogenies, so the tree was midpoint rooted using the phangorn v2.11.1 package [68]. Taxonomic classification was assigned to genomes using the NCBI Taxonomy database [69] and taxonkit v0.17.0 [70]. Phyla were named using the conventions in Coleman et al. 2021 [71]. The tree was visualized using ggtree v3.12.0 [72]. For the large YebC-family tree, the gene sequences of HMMER hits were translated using a Python script, and the tree was built and visualized with iTol v7.0 [73]. Protein models were determined with AlphaFold [74,75] and visualized with ChimeraX version 1.8 [43].
Supporting information
(Left) Growth in LB liquid media at 37˚C of wild-type (WT), ∆efp, ∆yfmR, ∆efp∆yfmR and ∆efp∆yfmR cells expressing IPTG-inducible YebC2. (Right) Colony sizes on LB plates of various mutants after 24 hours of growth at 37˚C. YebC2 or YfmR was expressed from an IPTG-inducible promoter. Error bars represent standard deviation. P-vaules report the result of an unpaired t-test with Welch’s correction.
(TIF)
Growth rates in LB at 37˚C are shown for wild-type, ∆yebC2, ∆efp, ∆efp∆yebC2 and ∆efp∆yebC2 expressing His-tagged YebC2. Error bars represent standard deviation of two independent experiments.
(TIF)
Characterized YebC family proteins are labelled with their given gene name and respective organism: Bs, Bacillus subtilis; Ld, Lactobacillus delbrueckii; Pa, Pseudomonas aeruginosa; Ec, Escherichia coli; Bb, Borrelia burgdorferi; Sp, Streptococcus pyogenes. Maximum likelihood bootstrap values are listed at each node. Pairwise percent identities for the proteins are listed and shaded relative to their homology.
(TIF)
Amino acid sequences were aligned with Clustal Omega. YebC2 paralogs are shaded in gray and YebC paralogs are shaded in green. Species abbreviations: Bs, Bacillus subtilis; Ec, Escherichia coli; Sp, Streptococcus pyogenes.
(TIF)
(XLSX)
(XLSX)
Acknowledgments
We are grateful to Tory Hendry, Vasili Hauryliuk, and Allen Buskirk for feedback on the manuscript. We are grateful to Kevin England, and Daniel Tetreault for helpful discussion.
Data Availability
All data are in the manuscript and Supporting Information files (S1 Table and S1 Data).
Funding Statement
This work was funded by NIGMS R35GM147049 to HAF. CRP was supported in part by a National Science Foundation Graduate Research Fellowship Program. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Doerfel LK, Wohlgemuth I, Kubyshkin V, Starosta AL, Wilson DN, Budisa N, et al. Entropic contribution of elongation factor P to proline positioning at the catalytic center of the ribosome. J Am Chem Soc. 2015;137(40):12997–3006. doi: 10.1021/jacs.5b07427 [DOI] [PubMed] [Google Scholar]
- 2.Huter P, Arenz S, Bock LV, Graf M, Frister JO, Heuer A, et al. Structural basis for polyproline-mediated ribosome stalling and rescue by the translation elongation factor EF-P. Mol Cell. 2017;68(3):515-527.e6. doi: 10.1016/j.molcel.2017.10.014 [DOI] [PubMed] [Google Scholar]
- 3.Glick BR, Ganoza MC. Identification of a soluble protein that stimulates peptide bond synthesis. Proc Natl Acad Sci U S A. 1975;72(11):4257–60. doi: 10.1073/pnas.72.11.4257 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Ude S, Lassak J, Starosta AL, Kraxenberger T, Wilson DN, Jung K. Translation elongation factor EF-P alleviates ribosome stalling at polyproline stretches. Science. 2013;339(6115):82–5. doi: 10.1126/science.1228985 [DOI] [PubMed] [Google Scholar]
- 5.Doerfel LK, Wohlgemuth I, Kothe C, Peske F, Urlaub H, Rodnina MV. EF-P is essential for rapid synthesis of proteins containing consecutive proline residues. Science. 2013;339(6115):85–8. doi: 10.1126/science.1229017 [DOI] [PubMed] [Google Scholar]
- 6.Woolstenhulme CJ, Parajuli S, Healey DW, Valverde DP, Petersen EN, Starosta AL, et al. Nascent peptides that block protein synthesis in bacteria. Proc Natl Acad Sci U S A. 2013;110(10):E878-87. doi: 10.1073/pnas.1219536110 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Peil L, Starosta AL, Lassak J, Atkinson GC, Virumäe K, Spitzer M, et al. Distinct XPPX sequence motifs induce ribosome stalling, which is rescued by the translation elongation factor EF-P. Proc Natl Acad Sci U S A. 2013;110(38):15265–70. doi: 10.1073/pnas.1310642110 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Bullwinkle TJ, Zou SB, Rajkovic A, Hersch SJ, Elgamal S, Robinson N, et al. (R)-β-lysine-modified elongation factor P functions in translation elongation. J Biol Chem. 2013;288(6):4416–23. doi: 10.1074/jbc.M112.438879 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Starosta AL, Lassak J, Peil L, Atkinson GC, Woolstenhulme CJ, Virumäe K, et al. A conserved proline triplet in Val-tRNA synthetase and the origin of elongation factor P. Cell Rep. 2014;9(2):476–83. doi: 10.1016/j.celrep.2014.09.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Mohapatra S, Choi H, Ge X, Sanyal S, Weisshaar JC. Spatial distribution and ribosome-binding dynamics of EF-P in live Escherichia coli. mBio. 2017;8:e00300–17. doi: 10.1128/mBio.00300-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Mudryi V, Frister JO, Peng B-Z, Wohlgemuth I, Peske F, Rodnina MV. Kinetic mechanism and determinants of EF-P recruitment to translating ribosomes. Nucleic Acids Res. 2024;52(19):11870–83. doi: 10.1093/nar/gkae815 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.DeJesus MA, Gerrick ER, Xu W, Park SW, Long JE, Boutte CC, et al. Comprehensive essentiality analysis of the mycobacterium tuberculosis genome via saturating transposon mutagenesis. mBio. 2017;8(1):e02133-16. doi: 10.1128/mBio.02133-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Yanagisawa T, Takahashi H, Suzuki T, Masuda A, Dohmae N, Yokoyama S. Neisseria meningitidis translation elongation factor P and its active-site arginine residue are essential for cell viability. PLoS One. 2016;11(2):e0147907. doi: 10.1371/journal.pone.0147907 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Guo Q, Cui B, Wang M, Li X, Tan H, Song S, et al. Elongation factor P modulates Acinetobacter baumannii physiology and virulence as a cyclic dimeric guanosine monophosphate effector. Proc Natl Acad Sci U S A. 2022;119(41):e2209838119. doi: 10.1073/pnas.2209838119 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kearns DB, Chu F, Rudner R, Losick R. Genes governing swarming in Bacillus subtilis and evidence for a phase variation mechanism controlling surface motility. Mol Microbiol. 2004;52(2):357–69. doi: 10.1111/j.1365-2958.2004.03996.x [DOI] [PubMed] [Google Scholar]
- 16.Rajkovic A, Hummels KR, Witzky A, Erickson S, Gafken PR, Whitelegge JP, et al. Translation control of swarming proficiency in Bacillus subtilis by 5-Amino-pentanolylated elongation factor P. J Biol Chem. 2016;291(21):10976–85. doi: 10.1074/jbc.M115.712091 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Tollerson R 2nd, Witzky A, Ibba M. Elongation factor P is required to maintain proteome homeostasis at high growth rate. Proc Natl Acad Sci U S A. 2018;115(43):11072–7. doi: 10.1073/pnas.1812025115 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Hummels KR, Kearns DB. Suppressor mutations in ribosomal proteins and FliY restore Bacillus subtilis swarming motility in the absence of EF-P. PLoS Genet. 2019;15(6):e1008179. doi: 10.1371/journal.pgen.1008179 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Feaga HA, Hong H-R, Prince CR, Rankin A, Buskirk AR, Dworkin J. Elongation Factor P Is Important for Sporulation Initiation. J Bacteriol. 2023;205(2):e0037022. doi: 10.1128/jb.00370-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Hong H-R, Prince CR, Tetreault DD, Wu L, Feaga HA. YfmR is a translation factor that prevents ribosome stalling and cell death in the absence of EF-P. Proc Natl Acad Sci U S A. 2024;121(8):e2314437121. doi: 10.1073/pnas.2314437121 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Takada H, Fujiwara K, Atkinson GC, Chiba S, Hauryliuk V. Resolution of ribosomal stalling by EF-P and ABCF ATPases YfmR and YkpA/YbiT. Nucleic Acids Res. 2024;52(16):9854–66. doi: 10.1093/nar/gkae556 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Boël G, Smith PC, Ning W, Englander MT, Chen B, Hashem Y, et al. The ABC-F protein EttA gates ribosome entry into the translation elongation cycle. Nat Struct Mol Biol. 2014;21(2):143–51. doi: 10.1038/nsmb.2740 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Murina V, Kasari M, Takada H, Hinnu M, Saha CK, Grimshaw JW, et al. ABCF ATPases involved in protein synthesis, ribosome assembly and antibiotic resistance: structural and functional diversification across the tree of life. J Mol Biol. 2019;431(18):3568–90. doi: 10.1016/j.jmb.2018.12.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Ousalem F, Ngo S, Oïffer T, Omairi-Nasser A, Hamon M, Monlezun L, et al. Global regulation via modulation of ribosome pausing by the ABC-F protein EttA. Nat Commun. 2024;15(1):6314. doi: 10.1038/s41467-024-50627-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Kerr ID, Reynolds ED, Cove JH. ABC proteins and antibiotic drug resistance: is it all about transport?. Biochem Soc Trans. 2005;33(Pt 5):1000–2. doi: 10.1042/BST20051000 [DOI] [PubMed] [Google Scholar]
- 26.Wilson DN. The ABC of ribosome-related antibiotic resistance. mBio. 2016;7(3):e00598-16. doi: 10.1128/mBio.00598-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Murina V, Kasari M, Hauryliuk V, Atkinson GC. Antibiotic resistance ABCF proteins reset the peptidyl transferase centre of the ribosome to counter translational arrest. Nucleic Acids Res. 2018;46(7):3753–63. doi: 10.1093/nar/gky050 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Chadani Y, Yamanouchi S, Uemura E, Yamasaki K, Niwa T, Ikeda T, et al. The ABCF proteins in Escherichia coli individually cope with “hard-to-translate” nascent peptide sequences. Nucleic Acids Res. 2024;52(10):5825–40. doi: 10.1093/nar/gkae309 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ousalem F, Singh S, Bailey NA, Wong K-H, Zhu L, Neky MJ, et al. Comparative genetic, biochemical, and biophysical analyses of the four E. coli ABCF paralogs support distinct functions related to mRNA translation. bioRxiv. 2023:2023.06.11.543863. doi: 10.1101/2023.06.11.543863 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Singh S, Gentry RC, Fu Z, Bailey NA, Altomare CG, Wong K-H, et al. Cryo-EM studies of the fourE. coliparalogs establish ABCF proteins as master plumbers of the peptidyl-transferase center of the ribosome. 2023. doi: 10.1101/2023.06.15.543498 [DOI] [Google Scholar]
- 31.Liang H, Li L, Dong Z, Surette MG, Duan K. The YebC family protein PA0964 negatively regulates the Pseudomonas aeruginosa quinolone signal system and pyocyanin production. J Bacteriol. 2008;190(18):6217–27. doi: 10.1128/JB.00428-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Brown L, Villegas JM, Elean M, Fadda S, Mozzi F, Saavedra L, et al. YebC, a putative transcriptional factor involved in the regulation of the proteolytic system of Lactobacillus. Sci Rep. 2017;7(1):8579. doi: 10.1038/s41598-017-09124-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Zhang Y, Chen T, Raghunandanan S, Xiang X, Yang J, Liu Q, et al. YebC regulates variable surface antigen VlsE expression and is required for host immune evasion in Borrelia burgdorferi. PLoS Pathog. 2020;16(10):e1008953. doi: 10.1371/journal.ppat.1008953 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Choi E, Jeon H, Oh C, Hwang J. Elucidation of a Novel Role of YebC in Surface Polysaccharides Regulation of Escherichia coli bipA-Deletion. Front Microbiol. 2020;11:597515. doi: 10.3389/fmicb.2020.597515 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Weraarpachai W, Antonicka H, Sasarman F, Seeger J, Schrank B, Kolesar JE, et al. Mutation in TACO1, encoding a translational activator of COX I, results in cytochrome c oxidase deficiency and late-onset Leigh syndrome. Nat Genet. 2009;41(7):833–7. doi: 10.1038/ng.390 [DOI] [PubMed] [Google Scholar]
- 36.Richman TR, Spåhr H, Ermer JA, Davies SMK, Viola HM, Bates KA, et al. Loss of the RNA-binding protein TACO1 causes late-onset mitochondrial dysfunction in mice. Nat Commun. 2016;7:11884. doi: 10.1038/ncomms11884 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Brischigliaro M, Krüger A, Moran JC, Antonicka H, Ahn A, Shoubridge EA, et al. The human mitochondrial translation factor TACO1 alleviates mitoribosome stalling at polyproline stretches. Nucleic Acids Res. 2024;52(16):9710–26. doi: 10.1093/nar/gkae645 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Ignatov D, Shanmuganathan V, Ahmed-Begrich R, Alagesan K, Frese CK, Wang C, et al. Novel RNA-binding protein YebC enhances translation of proline-rich amino acid stretches in bacteria. 2024. doi: 10.1101/2024.08.26.607280 [DOI] [Google Scholar]
- 39.Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, et al. Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell. 2013;152(5):1173–83. doi: 10.1016/j.cell.2013.02.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Peters JM, Colavin A, Shi H, Czarny TL, Larson MH, Wong S, et al. A Comprehensive, CRISPR-based Functional Analysis of Essential Genes in Bacteria. Cell. 2016;165(6):1493–506. doi: 10.1016/j.cell.2016.05.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Smith AM, Costello MS, Kettring AH, Wingo RJ, Moore SD. Ribosome collisions alter frameshifting at translational reprogramming motifs in bacterial mRNAs. Proc Natl Acad Sci U S A. 2019;116(43):21769–79. doi: 10.1073/pnas.1910613116 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Zhang Y, Lin J, Gao Y. In silico identification of a multi-functional regulatory protein involved in Holliday junction resolution in bacteria. BMC Syst Biol. 2012;6 Suppl 1(Suppl 1):S20. doi: 10.1186/1752-0509-6-S1-S20 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Meng EC, Goddard TD, Pettersen EF, Couch GS, Pearson ZJ, Morris JH, et al. UCSF ChimeraX: Tools for structure building and analysis. Protein Sci. 2023;32(11):e4792. doi: 10.1002/pro.4792 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Park EN, Mackens-Kiani T, Berhane R, Esser H, Erdenebat C, Burroughs AM, et al. B. subtilis MutS2 splits stalled ribosomes into subunits without mRNA cleavage. EMBO J. 2024;43(4):484–506. doi: 10.1038/s44318-023-00010-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Cerullo F, Filbeck S, Patil PR, Hung H-C, Xu H, Vornberger J, et al. Bacterial ribosome collision sensing by a MutS DNA repair ATPase paralogue. Nature. 2022;603(7901):509–14. doi: 10.1038/s41586-022-04487-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Lytvynenko I, Paternoga H, Thrun A, Balke A, Müller TA, Chiang CH, et al. Alanine tails signal proteolysis in bacterial ribosome-associated quality control. Cell. 2019;178(1):76-90.e22. doi: 10.1016/j.cell.2019.05.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Crowe-McAuliffe C, Takada H, Murina V, Polte C, Kasvandik S, Tenson T, et al. Structural basis for bacterial ribosome-associated quality control by RqcH and RqcP. Mol Cell. 2021;81(1):115-126.e7. doi: 10.1016/j.molcel.2020.11.002 [DOI] [PubMed] [Google Scholar]
- 48.Takada H, Crowe-McAuliffe C, Polte C, Sidorova ZY, Murina V, Atkinson GC, et al. RqcH and RqcP catalyze processive poly-alanine synthesis in a reconstituted ribosome-associated quality control system. Nucleic Acids Res. 2021;49(14):8355–69. doi: 10.1093/nar/gkab589 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Takada H, Paternoga H, Fujiwara K, Nakamoto JA, Park EN, Dimitrova-Paternoga L, et al. A role for the S4-domain containing protein YlmH in ribosome-associated quality control in Bacillus subtilis. Nucleic Acids Res. 2024;52(14):8483–99. doi: 10.1093/nar/gkae399 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Tesina P, Ebine S, Buschauer R, Thoms M, Matsuo Y, Inada T, et al. Molecular basis of eIF5A-dependent CAT tailing in eukaryotic ribosome-associated quality control. Mol Cell. 2023;83(4):607-621.e4. doi: 10.1016/j.molcel.2023.01.020 [DOI] [PubMed] [Google Scholar]
- 51.Hersch SJ, Wang M, Zou SB, Moon K-M, Foster LJ, Ibba M, et al. Divergent protein motifs direct elongation factor P-mediated translational regulation in Salmonella enterica and Escherichia coli. mBio. 2013;4(2):e00180-13. doi: 10.1128/mBio.00180-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Elgamal S, Katz A, Hersch SJ, Newsom D, White P, Navarre WW, et al. EF-P dependent pauses integrate proximal and distal signals during translation. PLoS Genet. 2014;10(8):e1004553. doi: 10.1371/journal.pgen.1004553 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Blaha G, Stanley RE, Steitz TA. Formation of the first peptide bond: the structure of EF-P bound to the 70S ribosome. Science. 2009;325(5943):966–70. doi: 10.1126/science.1175800 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Gamper HB, Masuda I, Frenkel-Morgenstern M, Hou Y-M. Maintenance of protein synthesis reading frame by EF-P and m(1)G37-tRNA. Nat Commun. 2015;6:7226. doi: 10.1038/ncomms8226 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Glick BR, Chládek S, Ganoza MC. Peptide bond formation stimulated by protein synthesis factor EF-P depends on the aminoacyl moiety of the acceptor. Eur J Biochem. 1979;97(1):23–8. doi: 10.1111/j.1432-1033.1979.tb13081.x [DOI] [PubMed] [Google Scholar]
- 56.Hoffer ED, Hong S, Sunita S, Maehigashi T, Gonzalez RL Jnr, Whitford PC, et al. Structural insights into mRNA reading frame regulation by tRNA modification and slippery codon-anticodon pairing. Elife. 2020;9:e51898. doi: 10.7554/eLife.51898 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Hubble KA, Henry MF. DPC29 promotes post-initiation mitochondrial translation in Saccharomyces cerevisiae. Nucleic Acids Res. 2023;51(3):1260–76. doi: 10.1093/nar/gkac1229 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Choi E, Huh A, Hwang J. Novel rRNA transcriptional activity of NhaR revealed by its growth recovery for the bipA-deleted Escherichia coli at low temperature. Front Mol Biosci. 2023;10:1175889. doi: 10.3389/fmolb.2023.1175889 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Wei L, Wu Y, Qiao H, Xu W, Zhang Y, Liu X, et al. YebC controls virulence by activating T3SS gene expression in the pathogen Edwardsiella piscicida. FEMS Microbiol Lett. 2018;365(14):10.1093/femsle/fny137. doi: 10.1093/femsle/fny137 [DOI] [PubMed] [Google Scholar]
- 60.Sieber A, Parr M, von Ehr J, Dhamotharan K, Kielkowski P, Brewer T, et al. EF-P and its paralog EfpL (YeiP) differentially control translation of proline-containing sequences. Nat Commun. 2024;15(1):10465. doi: 10.1038/s41467-024-54556-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Gaidenko TA, Kim T-J, Price CW. The PrpC serine-threonine phosphatase and PrkC kinase have opposing physiological roles in stationary-phase Bacillus subtilis cells. J Bacteriol. 2002;184(22):6109–14. doi: 10.1128/JB.184.22.6109-6114.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Middleton R, Hofmeister A. New shuttle vectors for ectopic insertion of genes into Bacillus subtilis. Plasmid. 2004;51(3):238–45. doi: 10.1016/j.plasmid.2004.01.006 [DOI] [PubMed] [Google Scholar]
- 63.Koo B-M, Kritikos G, Farelli JD, Todor H, Tong K, Kimsey H, et al. Construction and analysis of two genome-scale deletion libraries for Bacillus subtilis. Cell Syst. 2017;4(3):291-305.e7. doi: 10.1016/j.cels.2016.12.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012;9(7):676–82. doi: 10.1038/nmeth.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, et al. BLAST+: architecture and applications. BMC Bioinformatics. 2009;10:421. doi: 10.1186/1471-2105-10-421 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Price MN, Dehal PS, Arkin AP. FastTree 2--approximately maximum-likelihood trees for large alignments. PLoS One. 2010;5(3):e9490. doi: 10.1371/journal.pone.0009490 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Prince CR, Lin IN, Feaga HA. The evolution and functional significance of the programmed ribosomal frameshift in prfB. bioRxiv. 2024:2024.09.24.614795. doi: 10.1101/2024.09.24.614795 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Schliep KP. phangorn: phylogenetic analysis in R. Bioinformatics. 2011;27(4):592–3. doi: 10.1093/bioinformatics/btq706 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Schoch CL, Ciufo S, Domrachev M, Hotton CL, Kannan S, Khovanskaya R, et al. NCBI Taxonomy: a comprehensive update on curation, resources and tools. Database (Oxford). 2020;2020:baaa062. doi: 10.1093/database/baaa062 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Shen W, Ren H. TaxonKit: A practical and efficient NCBI taxonomy toolkit. J Genet Genomics. 2021;48(9):844–50. doi: 10.1016/j.jgg.2021.03.006 [DOI] [PubMed] [Google Scholar]
- 71.Coleman GA, Davín AA, Mahendrarajah TA, Szánthó LL, Spang A, Hugenholtz P, et al. A rooted phylogeny resolves early bacterial evolution. Science. 2021;372(6542):eabe0511. doi: 10.1126/science.abe0511 [DOI] [PubMed] [Google Scholar]
- 72.Yu G, Smith DK, Zhu H, Guan Y, Lam TT. ggtree: an r package for visualization and annotation of phylogenetic trees with their covariates and other associated data. Methods Ecol Evol. 2016;8(1):28–36. doi: 10.1111/2041-210x.12628 [DOI] [Google Scholar]
- 73.Letunic I, Bork P. Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res. 2024;52(W1):W78–82. doi: 10.1093/nar/gkae268 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Jumper J, Evans R, Pritzel A, Green T, Figurnov M, Ronneberger O, et al. Highly accurate protein structure prediction with AlphaFold. Nature. 2021;596(7873):583–9. doi: 10.1038/s41586-021-03819-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature. 2024;630(8016):493–500. doi: 10.1038/s41586-024-07487-w [DOI] [PMC free article] [PubMed] [Google Scholar]






