Skip to main content
NCBI home page
Springer logoLink to Springer
. 2025 Feb 17;33(4):1949–1963. doi: 10.1007/s10787-025-01645-w

Vanillic acid ameliorates collagen-induced arthritis by suppressing the inflammation response via inhibition of the MAPK and NF-κB signaling pathways

Yu Zhou 1,#, Pengfei Li 1,2,#, Zhongwen Zhi 1,#, Rong Chen 2, Chenghai Li 3, Chunbing Zhang 1,2,3,✉
PMCID: PMC11991997  PMID: 39961907

Abstract

Objective

To explore the potential therapeutic effects and underlying mechanism of vanillic acid (VA) in the treatment of rheumatoid arthritis (RA).

Methods

A collagen-induced arthritis (CIA) model was established in DBA/1 J mice. Methotrexate (MTX, 1 mg/kg/d) and VA (5 mg/kg/d, 10 mg/kg/d, 20 mg/kg/d) were then administered to investigate their therapeutic efficacy on RA in vivo. The body weight, joint score, and spleen index of the mice in different experimental groups were evaluated. Micro-CT was performed to detect joint destruction in the mice, and HE staining was utilized to observe the pathological conditions of their joints and spleens. Quantitative real-time PCR (qRT-PCR) and enzyme linked immunosorbent assay (ELISA) were used to detect inflammatory cytokines and chemokines. Changes in synovial tissue signaling pathways were detected using immunohistochemistry. For in vitro analysis, RAW 264.7 cells were pretreated with different concentrations of VA (25, 50, 100 μg/ml) and then treated with lipopolysaccharide (LPS), and changes in their signaling pathways were detected by western blot (WB).

Results

VA improved the clinical symptoms and bone destruction of arthritis in CIA mice, reduced pathological damage to ankle synovial and spleen tissue, and inhibited polarization of macrophages to M1 in the synovial tissue as well. In addition, VA inhibited the expression of TNF-α, IL-6, IL-1β, MCP-1, and iNOS in CIA mice and in LPS-stimulated RAW264.7 cells and also inhibited the phosphorylation of p65, IκBα, ERK, JNK, and p38 MAPKs.

Conclusions

VA can significantly improve the clinical symptoms of RA and exerts anti-inflammatory effects by inhibiting the activation of the NF-κB/MAPK pathway.

Keywords: Vanillic acid, Rheumatoid arthritis, Collagen-induced arthritis model, Macrophages, NF-κB signaling pathway, MAPK signaling pathway

Introduction

Rheumatoid arthritis (RA) is an autoimmune disease in which the body’s immune system attacks its own joints, causing systemic joint inflammation. It typically affects the small joints of the hand and foot and is characterized by symmetric, multi-joint pain and swelling (Gravallese et al. 2023). RA can occur at any age, but peaks between 50 and 59 years. Recent studies report that one in every 200 adults worldwide is affected, with a higher incidence in women (2–3 × that of men) (Aletaha and Smolen 2018). RA has significantly impacted the quality of life of millions of individuals worldwide and poses a major threat to their continued health and well-being. Consequently, research into effective RA treatments is vital.

Traditional western medicine therapy for RA is often costly and accompanied by numerous side effects. For example, methotrexate can lead to drug resistance if used for a long time (Yu and Zhou 2020). In recent years, an increasing amount of research has been dedicated to the treatment of RA using traditional Chinese medicine (TCM), with some notable achievements laying the groundwork for subsequent development of new drugs (Bu et al. 2022; Liu et al. 2023). Traditional Chinese medicine monomers have demonstrated effects on regulating apoptosis, inhibiting inflammation and immune response, and protecting against RA by regulating select pathways (Shi et al. 2020).

Although the pathogenesis of RA is complex and not fully understood, researchers generally believe that RA is a synovial inflammatory reaction caused by activation of the autoimmune response, in which various immune cells play important roles. Activated immune cells, including T cells, B cells, monocytes, and macrophages, interact to produce inflammatory cytokines that induce activation and proliferation of fibroblast-like synovial cells (FLSs), jointly promote osteoclast formation, and ultimately lead to joint destruction (Smolen et al. 2016).

Macrophages in particular are known to be involved in the initiation of inflammation, and they play a vital role in the pathogenesis of RA. Studies show higher macrophage numbers in RA patient synovial biopsy specimens compared to normal synovium, increasing the capacity to produce cytokines that enhance inflammation and promote cartilage and bone destruction (Udalova et al. 2016). Yang et al. observed that regulating macrophage polarization and down-regulating M1 macrophages to reduce inflammatory cytokines release can inhibit RA arthritis progression (Yang et al. 2023). Therefore, modulating the immune response of macrophages in synovial tissue and inhibiting the release of inflammatory cytokines may greatly alleviate RA symptoms.

Activated B cell nuclear factor-κB light chain enhancer (NF-κB) is a typical inflammation-related signaling pathway, and it can induce the expression of inflammatory cytokines and chemokines. More specifically, activation of NF-κB in RA can enhance the aggregation of inflammatory cells and synovial inflammation (Tak et al. 2001). Interestingly, studies have found that curcumin regulates the polarization of macrophages to M2 macrophages by inhibiting the activation of the NF-κB signaling pathway, thereby inhibiting the secretion of pro-inflammatory interleukin-1β (IL-1β) and IL-8 and promoting the secretion of anti-inflammatory IL-10, reducing adjuvant arthritis (Abd-Elhalem et al. 2023).

Under stimulation of lipopolysaccharide (LPS), macrophages are activated by Toll-like receptors (TLRs) that trigger phosphorylation of p38 mitogen-activated protein kinases (MAPKs), extracellular signal-regulated kinase (ERK), and c-Jun N-terminal kinase (JNK) in the mitogen-activated protein kinase (MAPK) signaling pathway and also activate the downstream NF-κB signaling pathway, thereby exacerbating inflammation (de Oliveira et al. 2017). Our own previous studies have demonstrated that magnoflorine alleviates the severity of arthritis and joint damage in collagen-induced arthritis (CIA) mice by inhibiting the MAPK and NF-κB signaling pathways and reducing the expression of pro-inflammatory cytokines such as tumor necrosis factor (TNF-α), IL-6, IL-1β, monocyte chemoattractant protein-1 (MCP-1), inducible nitric oxide synthase (iNOS), and interferon-beta (IFN-β) in synovial tissue in a dose-dependent manner. In vitro experiments have also shown that magnoflorine reduces production of inflammatory cytokines by inhibiting the phosphorylation of ERK, p38 MAPKs, and JNK in the MAPK signaling pathway and p65 and IκBα in the NF-κB signaling pathway (Li et al. 2017). Therefore, both the MAPK and NF-κB signaling pathways are crucial in the process of RA inflammation and are closely related to the disease’s progression.

Vanillic acid (VA) is a natural phenolic acid compound found in Atractylodes, Angelica, and other plants, with the molecular formula C8H8O4, that exhibits strong anti-oxidation and anti-inflammatory activity (Huang and Sheu 2006; Bai et al. 2019; Taqvi et al. 2021). Recent studies show that VA has other various pharmacological properties, including anti-inflammatory (Kim et al. 2010), anti-cancer (Sk et al. 2022), and anti-oxidation activity (Yao et al. 2020). Furthermore, in vitro studies have confirmed that VA suppress osteoarthritis through NF-κB signaling pathway modulation in chondrocytes (Ziadlou et al. 2020), inhibits NOD-like receptor protein 3 (NLRP3) inflammasome activation, and reduces synovial inflammation in knee osteoarthritis (Ma et al. 2021). These findings suggest that VA provides anti-inflammatory and anti-oxidant effects as well as articular cartilage protection. In summary, existing studies provide an important theoretical basis for VA’s clinical application in treating RA, though no report has yet been published on the topic.

In this study, we assessed VA's effects on joint inflammation in CIA mice, and explored the potential protective mechanisms in LPS-treated RAW264.7 cells through in vitro cell experiments.

Materials and methods

Drugs and reagents

VA (purity ≥ 97%) was purchased from Yuanye Biological (Shanghai, China). Methotrexate tablets were purchased from Xinyi pharmaceutical industry (Shanghai, China). Bovine type II collagen, complete Freund’s adjuvant (CFA) and incomplete Freund’s adjuvant (IFA) were purchased from Chondrex (Woodinville, WA, USA). LPS was purchased from Sigma-Aldrich (St. Louis, MO, USA). Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were purchased from Gibco (New York, USA). Trizol reagent was purchased from Invitrogen (CA, USA). An RNA reverse transcription kit was purchased from TaKaRa (Shiga, Japan), and Primers and quantitative real-time polymerase chain reaction (qRT-PCR) detection kits were purchased from Keygen Biotechnology (Jiangsu, China). Enzyme-linked immunosorbent assay (ELISA) kits were purchased from Enzyme Linked Immunosorbent Assay (Shanghai, China). Specific primary antibodies F4/80, CD206, an NF-κB signaling pathway sampler kit, a Phospho-MAPK family antibody sampler kit, and a MAPK family antibody sampler kit were purchased from Cell Signaling Technology (Danvers, USA). An iNOS antibody kit was purchased from Proteintech (Wuhan, China). β-Actin antibody was purchased from Boster (Wuhan, China).

The collagen-induced arthritis mouse model and drug administration

DBA/1 J mice were purchased from Shanghai SLAC Laboratory Animals. All animal experiments were conducted in accordance with ARRIVE guidelines and the National Research Council’s Guide for the Care and Use of Laboratory Animals (ethics number: 202207A079). Six-to-eight-week-old male DBA/1 J mice (18 ± 2 g) were housed in a specific pathogen free (SPF) animal laboratory with 5 mice per cage at 20–24 °C. All items used in the experimental procedures were first sterilized using an autoclave. The mice were free to eat and drink at all times, and their padding was replaced twice a week. Each mouse was weighed once per week. After one week of adaptive feeding, the mice were divided into 6 groups (n = 15/group): the control group, the CIA group, the MTX positive control group, the VA-L (5 mg/kg/d) group, the VA-M (10 mg/kg/d) group, and the VA-H (20 mg/kg/d) group. The control group was fed normally, and the other five groups underwent CIA modeling by collagen induction (Miyoshi and Liu 2018). Based on published data (Wang et al. 2023), the MTX positive control group (1 mg/kg/d) and VA treatment groups (VA-L, VA-M, VA-H) were treated by intraperitoneal injection once a day for 14 days.

All mice were euthanized under isoflurane anesthesia. Following this, peritoneal macrophages and synovial tissue of the knee joint were collected for mRNA detection, ankle joint and spleen tissues were harvested for pathological and immunohistochemical analysis, and serum was taken for enzyme linked immunosorbent assay.

Arthritis score, body weight, and spleen index

The joints of the mice were scored according to an existing reference (Brand et al. 2007), and the body weights were evaluated weekly, as mentioned above. The spleen was isolated, and the spleen index was calculated as (spleen weight/body weight) × 100.

Micro-computed tomography (micro-CT) analysis

After the mice were euthanized, their entire hind limbs were cut off and stored in a tissue fixative that contained neutral formalin. Micro-CT scanning was then performed to acquire three-dimensional (3-D) reconstructions of ankle joints using the Quantum GX micro-CT system (PerkinElmer, Hopkinton, MA, USA). The scanning parameters were set to 90 kV and 80 μA, and PerkinElmer analyze software (12.0) was used for data analysis.

Histological examination

After the spleen and ankle joints were washed with normal saline, they were fixed in 10% neutral formalin tissue for 24 h, and the ankle joints were decalcified with EDTA decalcifying solution until they became soft and easy to cut. After dehydration, the ankle joints and spleen that were embedded in paraffin were cut into 5 μm slices and stained with hematoxylin–eosin (H&E). The histopathological changes were then observed by optical microscope. Briefly, the spleen pathological score was based on the degree of red pulp congestion, the degree of marginal zone hyperplasia, and the number of germinal centers (El-Waseef 2020). The joint score was based on inflammatory cell infiltration, synovial tissue hyperplasia, bone destruction, and pannus formation (Krenn et al. 2002; El-Waseef 2020).

Immunohistochemistry staining

For immunohistochemistry staining, the paraffin sections of ankle joints were dewaxed, hydrated, and antigen repaired, and their endogenous peroxidase was removed prior to blocking. The sections were then incubated with anti-F4/80 (1:200), anti-CD206 (1:500), anti-iNOS (1:200), anti-phospho-p65 (1:200), anti-phospho-inhibitory subunit of NF kappa b alpha (IκBα) (1:200), anti-phospho-extracellular regulating kinase (ERK)1/2 (1:400), and anti-phospho-p38 MAPK (1:600) primary antibodies overnight at 4 °C. Then, the slices were incubated with goat-anti-rabbit IgG horseradish peroxidase (HRP) secondary antibody at 37 °C for 30 min. Subsequently, DAB (3,3′-diaminobenzidine) chromogenic agent was added, followed by re-dyeing, dehydration, and sealing. Positive staining in each area was examined in at least five random fields of × 100 magnification, and the average optical density of above-mentioned proteins in synovial tissue of ankle joints was determined by Image J software (National Institutes of Health, Bethesda, MD, USA).

Cell cultures and treatment

RAW264.7 cells were acquired from the American Type Culture Collection cell bank (Manassas, VA, USA). Peritoneal macrophages (PMs) were isolated from the mice by flushing the abdominal cavity with 5 mL pre-cooled phosphate-buffered saline (PBS) and were then centrifuged at 300 g for 5 min. The PMs were subsequently homogenized in Trizol reagent for qRT-PCR tests. RAW264.7 cells were cultured in DMEM supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin. Then, RAW264.7 cells in their logarithmic growth phase were seeded in 12-well cell culture plates at a density of 1 × 105/well or 2 × 105/well and placed in an incubator at 37 °C overnight. These cells were pretreated with VA (25, 50, 100 μg/ml) for 4 h and then stimulated by LPS (100 ng/ml). After 6 h, the cells were collected for qRT-PCR tests. After 12 h, the supernatant was isolated for ELISA testing.

Cell viability assay

RAW264.7 cells were plated in 96-well cell culture plates at a density of 5 × 103/well and placed in an incubator at 37 °C overnight. The cells were then treated with VA at different concentrations (0, 5, 10, 25, 50, 100, 200, 500 and 1000 μg/ml) for 24 h. 10 μl of CCK-8 solution was then added to each well, and the cells incubated at 37 °C for another 4 h. The absorbance value of each well at 450 nm was measured by Multiskan FC 96-well plate microplate reader (Thermo Fisher Scientific, USA). Finally, cell viability was calculated according to the formula cell viability (%) = [A (administration)-A (blank)]/[A (0 administration) -A (blank)] × 100.

Quantitative real-time PCR (qRT-PCR)

For qRT-PCR, the RNA in the synovial tissues and RAW264.7 cells was first isolated by using a TRIzol kit. Then, the RNA was reverse transcribed into cDNA using a PrimeScript™ RT reagent Kit. After this, the expression of TNF-α, IL-6, IL-1β, MCP-1, and iNOS mRNA was detected by a SYBR Green Real time PCR Master Mix kit. The cycle threshold (CT) of the target gene was determined by ABI 7500 PCR amplification instrument (Applied Biosystems, USA), and relative gene expression levels were then calculated using the 2−ΔΔCt formula and normalized to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Each experiment was performed in triplicate. The primer sequences used are shown in Table 1.

Table 1.

Primer sequences for qRT-PCR

Gene Forward primer Reward primer
TNF-α CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG
IL-6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC
IL-1β GAAATGCCACCTTTTGACAGTG CTGGATGCTCTCATCAGGACA
MCP-1 TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGATTTACGGGT
iNOS ACATCGACCCGTCCACAGTAT CAGAGGGGTAGGCTTGTCTC
GAPDH TGAGGCCGGTGCTGAGTATGT CAGTCTTCTGGGTGGCAGTGAT
Open in a new tab

ELISA

The orbital blood of the mice was taken in a 1.5 ml EP tube and placed at room temperature (RT) for 30 min and then centrifuged at 3500 g for 15 min to obtain the serum. The supernatants derived from the RAW264.7 cells were centrifuged at 12,000 g for 5 min, and the levels of TNF-α, IL-6, IL-1β, MCP-1, and iNOS in the serum and supernatants were quantified using the corresponding commercial ELISA kits. All the measurements were performed strictly according to the manufacturer’s instructions.

Western blot (WB)

RAW264.7 cells in their logarithmic growth phase were plated in 6-well cell culture plates at a density of 1.5 × 106/well and placed in an incubator at 37 °C overnight. The cells were pretreated with different concentrations of VA (25, 50, 100 μg/ml) for 1 h followed by stimulation with 100 ng/mL LPS for 1 h. Then, the cells were lysed by RIPA buffer that contained PMSF and phosphatase inhibitor after which the protein concentration was determined by bicinchoninic acid (BCA) method. Next, cellular proteins (30 μg) were resolved on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene fluoride (PVDF) membrane. After being blocked in Tris-buffered saline and Tween 20 (TBST) with 5% bovine serum albumin (BSA) for 1 h at RT, the membranes were incubated with primary antibodies p65 (1:1000), phospho-p65 (1:1000), IκBα (1:1000), phospho-IκBα (1:1000), p38 MAPK (1:1000), phospho-p38 MAPK (1:1000), JNK (1:1000), phospho-JNK (1:1000), ERK1/2 (1:1000), phospho-ERK1/2 (1:2000), and β-actin (1:1000) overnight at 4 °C. After being washed three times using TBST, the membranes were incubated with corresponding secondary antibodies for 2 h at RT. Detection was then performed with enhanced chemiluminescence (ECL). Finally, the Tanon 4600 chemiluminescence imaging analysis system (Shanghai, China) was used to record the imaging, and the density of the above-mentioned protein was quantified by ImageJ software. The density of the phosphorylated proteins was normalized with the total protein.

Statistical analysis

Statistical analysis was carried out using GraphPad Prism (Version 9). Data were expressed as mean ± standard error of mean (SEM) or median (interquartile ranges [IQR]) depending on whether the data follows a normal distribution. The differences between multiple groups were evaluated by one-way analysis of variance (ANOVA) tests followed by Tukey’s post hoc test (for normally distributed data) or by Kruskal–Wallis test (for nonnormally distributed data). A two-sided P < 0.05 was considered to indicate statistically significant test results for all tests.

Results

VA improved the clinical symptoms and bone destruction of arthritis in CIA mice

On the 28th day after the first immunization, we observed that the limbs of the mice began to show redness and swelling. As time went on, the redness and swelling in the model group gradually worsened, while that of the administration group was alleviated, especially in the MTX group and the VA-H group (Fig. 1A). From the 35th day, the arthritis index of the administration group gradually decreased as well. One week after administration, MTX showed significant efficacy, with a significant decrease in arthritis index compared to the model group (P < 0.001). Additionally, compared to the model group, the arthritis index of mice in both the VA-M and VA-H significantly decreased on the 42nd day (P < 0.01, P < 0.001) (Fig. 1B).

Fig. 1.

Fig. 1

Open in a new tab

The effects of VA on ankle joints and bones in vivo. A Comparison of ankle swelling in each group of mice. B Arthritis index scores for each group (n = 15, ***P < 0.001, CIA vs. CIA + MTX; $$$P < 0.001, CIA vs. CIA + VA-H; ##P < 0.01, CIA vs. CIA + VA-M; ###P < 0.001, CIA vs. CIA + VA-M). C The average spleen index for each group (n = 15, ###P < 0.001 vs. Con; *P < 0.05, **P < 0.01 vs. CIA). D Weight changes for each group (P > 0.05). E Micro-CT 3D imaging of the hind paws of each group. F The average bone mineral density of the hind paws of each group (n = 3, ###P < 0.001 vs. Con; *P < 0.05, **P < 0.01 vs. CIA)

The spleen index of the mice in the model group was significantly higher than that of the normal group (P < 0.001). After treatment, compared to the model group, the spleen index of the mice in the MTX, VA-M, and VA-H groups were significantly lower (P < 0.01, P < 0.05, P < 0.01), but there was no significant change in the spleen index of the mice in the VA-L group (Fig. 1C). The weight gain of mice in the model group and the administration group were slower than in the control group as well, but the difference was not significant (P > 0.05) (Fig. 1D).

Furthermore, we observed the bone destruction of mice in each group. As shown in Fig. 1E, micro-CT 3D imaging revealed aggravated bone destruction of mice in the model group, but the degree of bone destruction in the treatment group mice was improved to some extent. The results of bone density analysis also showed that compared to the control group, the bone density of the mice in the model group was significantly lower (P < 0.001). Compared to the model group, the bone density of the mice in MTX and VA-H groups were both higher (P < 0.05, P < 0.01), however, and the VA-L and VA-M groups showed no statistical difference from the model group (Fig. 1F).

VA alleviated pathological damage of ankle synovial and spleen tissue in CIA mice

Histological analysis of the ankle joints and spleens of the mice was performed to confirm the anti-arthritic effects of VA (Fig. 2A). We observed that the degree of inflammation, synovial infiltration, bone destruction, and pannus formation in the CIA group were significantly higher compared to the control group (P < 0.001). After VA treatment, the above pathological changes were all alleviated. Among them, VA-M and VA-H had comparable therapeutic effects to MTX, and both appreciably improved ankle joint injuries compared to the CIA group (P < 0.05, P < 0.01, P < 0.001). However, VA-L only significantly reduced pannus formation (P < 0.05) (Fig. 2B).

Fig. 2.

Fig. 2

Open in a new tab

HE staining evaluation of VA on the joints and spleens of CIA mice. A Representative HE staining of mouse ankle joints under a microscope (× 100; inflammatory cell infiltration: black arrow; synovial hyperplasia: yellow arrow; bone erosion: green arrow; pannus: red arrow). B Pathological HE staining score of mouse ankle joints (n = 15, ###P < 0.001 vs. Con; *P < 0.05, **P < 0.01, ***P < 0.001 vs. CIA). C Representative HE staining of mouse spleen tissue under a microscope (× 100; germinal center: yellow arrow; marginal zone: black arrow; red pulp: red arrow). D Pathological score of mouse spleen tissue by HE staining (n = 15, ###P < 0.001 vs. Con; *P < 0.05, ***P < 0.001 vs. CIA)

As the most important peripheral immune organ, the spleen is involved in systemic inflammation in the occurrence and development of RA. In the model group, the spleen pathology of the mice was characterized by increased germinal centers, hyperplasia of the marginal zone, and severe red pulp congestion, which was alleviated in the administration group (Fig. 2C). Our pathological scoring results confirmed and increased number of germinal centers, marginal zone hyperplasia, and red pulp congestion in the CIA group (all P < 0.001), which were all remarkably alleviated by MTX (P < 0.05, P < 0.001). Furthermore, as the concentration increased, VA exhibited significant effects compared to the CIA group. The number of germinal centers in the VA-M group was statistically significantly lower compared to the CIA group (P < 0.05), and VA-H remarkably inhibited the number of germinal centers, marginal zone hyperplasia, and red pulp congestion (P < 0.001, P < 0.05, P < 0.05) (Fig. 2D).

VA inhibited pro-inflammatory macrophage infiltration into synovial tissue of the CIA mice

Considering the crucial roles of macrophage during RA synovitis, we continued to study the macrophage phenotype in the synovial tissue of the mice after the above treatments. The effects of VA on macrophage phenotype in synovial tissue were assessed by immunohistochemistry conducted using the macrophage-specific marker F4/80 and M1 (iNOS) and M2 (CD206) macrophage markers (Fig. 3A). In the CIA group, we noticed a substantial increase in F4/80 and iNOS (P < 0.001, P < 0.001), but VA and MTX treatment evidently decreased the expression of F4/80 and iNOS (P < 0.001, P < 0.001). In contrast, MTX, VA-M, and VA-H significantly promoted the expression of CD206 (P < 0.001, P < 0.001, P < 0.001) (Fig. 3B).

Fig. 3.

Fig. 3

Open in a new tab

Identification of synovial macrophages by immunohistochemistry. A The expression of F4/80, iNOS and CD206 protein in the ankle joints of mice was detected by immunohistochemistry. B ImageJ was used to analyze the expression of F4/80, iNOS, and CD206 protein in mouse ankle joints (n = 15, ###P < 0.001 vs. Con; ***P < 0.001 vs. CIA)

VA decreased the expression of inflammatory cytokines and chemokines in the CIA mice

To gain insight into the molecular mechanisms that underlie the observed anti-arthritic effects of VA, we investigated inflammatory cytokines and chemokines. Specifically, we used qRT-PCR to detect TNF-α, IL-6, IL-1β, MCP-1, and iNOS mRNA expression in the synovial tissue and PMs of the mice in each group. As expected, the CIA model mice showed a markedly higher expression of TNF-α, IL-6, IL-1β, and MCP-1 mRNA in their synovial tissue (P < 0.001), as well as increased iNOS mRNA (P < 0.05) compared to the control group. In addition, VA-H and MTX-treatment group significantly reduced the expression of TNF-α, IL-6, IL-1β, MCP-1, and iNOS mRNA (P < 0.01, P < 0.01, P < 0.001, P < 0.01, P < 0.05). What’s more, VA-M significantly inhibited the expression of IL-6, IL-1β, MCP-1, and iNOS mRNA (P < 0.05, P < 0.01, P < 0.01, P < 0.05), and VA-L inhibited IL-1β and MCP-1 mRNA (P < 0.01, P < 0.01) (Fig. 4A).

Fig. 4.

Fig. 4

Open in a new tab

VA suppressed the expression of inflammatory cytokines and chemokines in CIA mice. A The relative expression of inflammatory cytokines and chemokines in synovial tissue was detected by qRT-PCR (n = 15, #P < 0.05, ###P < 0.001 vs. Con; *P < 0.05, **P < 0.01, ***P < 0.001 vs. CIA). B The relative expression of inflammatory cytokines and chemokines in peritoneal macrophages was detected by qRT-PCR (n = 15, #P < 0.05, ##P < 0.01, ###P < 0.001 vs. Con; *P < 0.05, **P < 0.01, ***P < 0.001 vs. CIA). C The content of inflammatory cytokines and chemokines in serum of mice was detected by ELISA (n = 15, #P < 0.05, ##P < 0.01, ###P < 0.001 vs. Con; *P < 0.05, **P < 0.01, ***P < 0.001 vs. CIA)

The PM results for the mice are also shown in Fig. 4. Compared to the control group, the expression of TNF-α, IL-6, IL-1β, MCP-1, and iNOS mRNA in the PMs of the CIA model group were markedly higher (P < 0.05, P < 0.01, P < 0.05, P < 0.001, P < 0.01). After treatment, however, the expression of TNF-α, IL-6, IL-1β, MCP-1, and iNOS mRNA decreased. The inhibitory effects of VA-M and VA-H on inflammatory cytokines and chemokines were comparable to those of MTX (P < 0.05, P < 0.01, P < 0.05, P < 0.001, P < 0.01), although VA-L did not markedly reduce the expression of TNF-α, IL-1β, or iNOS mRNA (Fig. 4B).

Next, we examined the concentrations of inflammatory cytokines and chemokines in the mouse serum to evaluate the systemic inflammation mediated by CIA. Compared to the control group, the levels of TNF-α, IL-6, IL-1β, MCP-1, and iNOS in the serum of the CIA model group were remarkably elevated (P < 0.001, P < 0.05, P < 0.01, P < 0.001, P < 0.01). After treatment, though, the inflammatory cytokines and chemokines levels were significantly reduced, and the inhibitory effects of VA-H on these cytokines was similar to those of MTX (Fig. 4C). In summary, in vivo results of this study were consistent across experiments.

VA inhibited the expression of inflammatory cytokines and chemokines in the LPS-stimulated RAW264.7 cells

To investigate the cytotoxic activity of VA, we assessed the effects of VA on RAW264.7 cells. CCK8 assay showed no obvious cytotoxicity at doses of VA up to 200 μg/ml. At 500 μg/ml, however, cell viability was significantly reduced (P < 0.001) (Fig. 5A). Consequently, three lower doses of VA-L (25 μg/ml), VA-M (50 μg/ml) and VA-H (100 μg/ml), were used in the following study.

Fig. 5.

Fig. 5

Open in a new tab

The effects of VA on pro-inflammatory cytokines and chemokines in LPS-stimulated RAW264.7 cells. Each experiment was repeated at least three times. A The effect of VA on the viability of the RAW264.7 cells (***P < 0.001 vs. Con). B The relative expression of inflammatory cytokines and chemokines in the RAW264.7 cells was detected by qRT-PCR (##P < 0.01, ###P < 0.001 vs. Con; *P < 0.05, **P < 0.01, ***P < 0.001 vs. LPS). C The relative expression of inflammatory cytokines and chemokines in the supernatant of the RAW264.7 cells was detected by ELISA (###P < 0.001 vs. Con; *P < 0.05, **P < 0.01, ***P < 0.001 vs. LPS)

In this experiment, LPS was used stimulated RAW264.7 cells to induce an RA inflammation model, and the cells received VA doses of either 25, 50, or 100 μg/ml. The expression of TNF-α, IL-6, IL-1β, MCP-1, and iNOS mRNA was then detected by qRT-PCR. After LPS stimulation, the expression of the above inflammatory cytokines’ and chemokines’ mRNA dramatically increased (P < 0.01, P < 0.001), but, VA-M and VA-H significantly suppressed TNF-α, IL-6, IL-1β, MCP-1, and iNOS secretion (P < 0.05, P < 0.01, P < 0.001) (Fig. 5B).

Cell supernatants were also collected, and the concentrations of TNF-α, IL-6, IL-1β, MCP-1, and iNOS were quantified by ELISA. These results showed that levels of TNF-α, IL-6, IL-1β, MCP-1, and iNOS were significantly elevated after LPS stimulation compared to the control group (all P < 0.001). However, VA significantly reversed the above changes (P < 0.05, P < 0.01, P < 0.001) (Fig. 5C).

VA attenuated the activation of the NF-κB and MAPK signaling pathways in the CIA mice and LPS-stimulated RAW264.7 cells

The effects of VA on the related signaling pathway proteins in the synovial tissue was further detected by immunohistochemistry. Specifically, the proteins of p-p65, p-IκBα, p-ERK 1/2, and p-p38 MAPK in the MAPK and NF-κB signaling pathways were detected. As shown in Fig. 6A, the p-p65, p-IκBα, p-ERK ½, and p-p38 MAPK were significantly increased in the CIA group (all P < 0.001) and significantly decreased after VA-H and MTX treatment (all P < 0.001). However, VA-L had no significant effects on p-p65 or p-ERK 1/2 proteins, and VA-M had no significant effects on p-ERK 1/2 protein (Fig. 6B).

Fig. 6.

Fig. 6

Open in a new tab

VA regulated the NF-κB/MAPK signaling pathways in the synovium of CIA mice and LPS-induced RAW264.7 cells. Each experiment was repeated at least three times. A Immunohistochemistry was used to detect the expression of p-P65, p-IκBα, p-ERK, and p-P38 in the ankle joints of mice in each group. B ImageJ was used to analyze the expression of p-P65, p-IκBα, p-ERK, and p-P38 in the ankle joints of mice in each group (n = 15, ###P < 0.001 vs. Con; *P < 0.05, **P < 0.01, ***P < 0.001 vs. CIA). C WB was used to detect the phosphorylation levels of P65 and IκBα protein in the RAW264.7 cells (##P < 0.01, ###P < 0.001 vs. Con; *P < 0.05, **P < 0.01 vs. LPS). D The phosphorylation levels of ERK, P38, and JNK proteins in the RAW264.7 cells were detected by WB (##P < 0.01, ###P < 0.001 vs. Con; *P < 0.05, **P < 0.01, ***P < 0.001 vs. LPS)

Similarly, WB analysis showed that LPS indeed induced the phosphorylation of p65 and IκBα in the NF-κB signaling pathway in the RAW 246.7 cells (P < 0.001, P < 0.01). However, in the VA intervention group, VA-M (50 μg/ml) and VA-H (100 μg/ml) significantly reduced the production of phosphorylated p65 and IκBα (P < 0.05, P < 0.01) (Fig. 6C). Similarly, LPS stimulation significantly enhanced the phosphorylation of ERK 1/2, JNK, and p38 MAPK in the MAPK signaling pathway (P < 0.001, P < 0.01, P < 0.001), but LPS-induced phosphorylation of ERK 1/2, p38 MAPK, and JNK were markedly suppressed by VA-pretreatment (P < 0.05, P < 0.01, P < 0.001). However, VA-L showed no significant effects on p-JNK protein (Fig. 6D).

Discussion

RA primarily manifests as systemic polyarthritis, causing damage to articular cartilage and bone. Pathological manifestations include synovial hyperplasia, inflammatory cell infiltration, pannus hyperplasia, and bone erosion. Our study showed that VA could effectively alleviate joint redness and swelling in mice, reduce clinical scores, increase bone density, and inhibit synovial hyperplasia, inflammatory cell infiltration, pannus hyperplasia, and bone destruction, suggesting that it is indeed an effective in RA treatment.

The spleen is the largest immune-system organ, and abnormal activation of the immune system may lead to spleen enlargement. For example, the excessive proliferation of autoreactive B cells in RA leads to increased production of immunoglobulin and splenomegaly. In our study, VA significantly lowered the splenic index in the CIA mice, indicating that VA successfully blocked peripheral immune activation in RA, thereby alleviating clinical symptoms.

Recent studies have shown that VA exhibits anti-inflammatory, antioxidant, and anti-apoptotic properties by inhibiting free radical scavenging activity and lipid peroxidation (Arabaci et al. 2024; Ni et al. 2024). Previous studies by Ahmet Yurteri et al. have also demonstrated that VA significantly promotes fracture healing in an open fracture model (Yurteri et al. 2024). In our experiments, qRT-PCR and ELISA results showed that inflammatory cytokines in the CIA mouse model were significantly elevated but that MTX and VA intervention effectively reduced the content of inflammatory cytokines and chemokines such as TNF-α, IL-6, IL-1β, MCP-1, and iNOS in CIA mice. This shows that VA can affect the release of inflammatory cytokines and chemokines, thus controlling the progression of synovial inflammation and relieving symptoms.

Other evidence from RA patients and CIA models has revealed a vital anti-inflammatory role for traditional Chinese medicine monomers. Recent reports demonstrate that sinomenine reduces the activity of RA by regulating the secretion of IL-6, TNF-α, IL-1β, and MCP-1 in vivo and in vitro (Liu et al. 2018). By inhibiting the release of inflammatory cytokines such as TNF-α and IL-6, schisandrin reduces synovial inflammation and joint destruction in CIA mice (Lin et al. 2023a, b), for example. Changes in inflammatory cytokines can reflect the synovial inflammation of RA, and VA reduces these inflammatory cytokines in CIA mice. We thus speculate that VA can improve the disease progression of RA by affecting inflammatory cytokines.

The pathogenesis of RA is a continuous and complex process. Studies have shown that the central pathogenesis of RA is associated with the activation of macrophages. Activated macrophages accumulate in the synovial tissue and produce a series of pro-inflammatory cytokines and matrix metalloproteinases that destroy joint tissues, exacerbating RA (Wang et al. 2017). Controlling the release of inflammatory cytokines by macrophages is therefore the primary method of RA progression alleviation. Macrophages can be divided into M1 macrophages and M2 macrophages, and the imbalance of macrophage M1/M2 subtype polarization is the main mechanism that leads to occurrence of RA. Specifically, M1 macrophages in the inflammatory microenvironment produce pro-inflammatory cytokines such as TNF-α, IL-6, and IL-1β that further promote the progression of RA. On the contrary, M2 macrophages can produce anti-inflammatory mediators such as Arg-1 and IL-10, thereby blocking inflammation (Tardito et al. 2019). Lin et al. have already reported that Koumine alleviates the symptoms of CIA mice by restoring the M1/M2 polarization balance of macrophages, especially the inhibition of M1, through in vivo and in vitro experiments (Lin et al. 2023a, b). In our present study, we detected the expression of F4/80 (specific marker of macrophages), iNOS (specific marker of M1 macrophage), and CD206 (specific marker of M2 macrophage) in synovial tissue by immunohistochemistry, and the results showed that F4/80 and iNOS were significantly increased in the synovial tissue of CIA mice and that there was no significant change in CD206, which may be related to the low content of macrophages in the control group. However, MTX and VA reduced the expression of iNOS and increased the content of CD206. canthus, VA may inhibit the polarization of the pro-inflammatory M1 phenotype, thereby blocking the development of inflammation and protecting against RA.

RAW264.7 cells are a mouse-derived macrophage cell line that is frequently employed as an in vitro RA inflammatory model. Numerous studies have demonstrated that LPS can induce the production of inflammatory cytokines in RAW264.7 cells, as was done in the experiments in this study. For example, Chen et al. found that LPS-stimulated RAW264.7 cells produce inflammatory cytokines including TNF-α, IL-6, and IL-1β (Chen et al. 2017), and Linghu's team used LPS to induce RAW264.7 cells and detected increased inflammatory cytokines such as TNF-α, IL-6, and MCP-1 in their supernatants (Linghu et al. 2020). In our experiment, LPS-stimulated RAW264.7 cells showed increased inflammatory cytokines that indicated in vitro inflammation model formation, which allowed us to explore the effects of VA on pro-inflammatory cytokines and chemokines on the cells. Kim’s team have already showed that VA can regulate TNF-α and IL-6 to achieve anti-inflammatory effects in LPS-induced mouse peritoneal macrophages (Kim et al. 2010), and our results confirmed this in addition to detecting decreased IL-1β, MCP-1, and iNOS levels, which further suggests that VA has anti-inflammatory activity at least partially through down-regulating inflammatory mediators.

TNF-α, IL-6, and IL-1β are pro-inflammatory cytokines involved in inflammasome signal transduction. In RA, they can induce synovial cell proliferation to produce matrix metalloproteinases and participate in bone destruction (Weber et al. 2023). MCP-1 and iNOS promote RA inflammation, with iNOS responding to macrophage polarization towards the M1 type (Wang et al. 2021a, b). Current drug treatments target inflammatory cytokines (TNF inhibitors, IL-6 receptor inhibitors, etc.) but face tolerance and cost issues (Fraenkel et al. 2021). The traditional Chinese medicine monomer VA not only has anti-inflammatory properties but is also safe to use, thus offering a promising alternative for RA treatment.

NF-κB is one of the most important signaling pathways that regulates immune response, and in RA, activation of NF-κB is an important factor that leads to imbalance of immune function and synovial inflammation. There is increasing evidence that phosphorylation of IκBα can lead to degradation of IκBα, accompanied by activation of NF-κB (Tak and Firestein 2001; Haque et al. 2018). Our previous studies have found that magnoflorine can inhibit phosphorylation of IκBα and P65, thereby blocking activation of the NF-κB signaling pathway, alleviating synovial inflammation, and reducing joint destruction in CIA mice (Wang et al. 2023). In this experiment, we our immunohistochemistry results showed that MTX and VA could reverse elevated p-p65 and p-IκBα in CIA synovial tissue.

In addition, the MAPK signaling pathway plays a crucial role in controlling the secretion of pro-inflammatory cytokines during RA progression, and MAPK activation is regulated by JNK, ERK, and p38 protein kinases (Wang et al. 2021a, b). We found that the expressions of p-ERK, p-p38, and p-ERK protein were significantly decreased after MTX and VA treatment. In cell experiments, we used WB to detect changes in related pathways in macrophages and found that VA effectively reduced the expression of p-p38, p-ERK, p-JNK, p-p65, and p-IκBα proteins as well. MAPK pathways have been implicated in the development of RA, and previous studies have shown that regulation of the NF-κB/MAPK signaling pathways can effectively reduce cellular inflammation. For example, Yong Jin Oh’s team reported that inhibition of LPS-induced Toll-like receptor 4 (TLR4) and myeloid differentiation factor 88 (MyD88), which inhibited NF-κB activation and MAPK (p38, ERK and JNK) phosphorylation, could effectively control the inflammatory response and oxidative stress of RAW264.7 macrophages (Oh et al. 2023). Similarly, Guo et al. showed that imperatorin could reduce the release of TNF-α, IL-1β, and IL-6 by inhibiting activation of the NF-κB and MAPK signaling pathways, thereby reducing inflammatory response of RAW264.7 cells induced by LPS (Guo et al. 2012). In our experiment, we confirmed that VA has a protective effect on LPS-induced RAW264.7 cells, and the mechanism by which this happens is at least in part due to regulating NF-κB and MAPK signaling pathway proteins to inhibit production of inflammatory cytokines. These above results indicate that inhibition of NF-κB and MAPK signaling pathway activity may be one of the mechanisms by which VA alleviates RA synovial inflammation.

Currently, there is drug available specifically for the treatment of RA. Most drugs can only alleviate the progression of the disease and need to be taken for a long time, with nontrivial side effects. In recent years, a large number of studies have found that traditional Chinese medicines have a significant effect on the treatment of RA (Ma and Jiang 2016). For instance, berberine can selectively induce apoptosis of dendritic cells to improve RA (Hu et al. 2011), and paeoniflorin can down-regulate the NF-κB signaling pathway, inhibit osteoclast differentiation, and thereby prevent bone destruction and alleviate CIA (Xu et al. 2018). In our in vivo experiments, we selected MTX as a positive control drug and found that VA could achieve the same effects. Moreover, when the concentration increased effects became more obvious. VA effectively reduced the levels of inflammatory cytokines TNF-α, IL-6, IL-1β, MCP-1, and iNOS in the serum, synovial tissue, and peritoneal macrophages of mice, reduced the aggregation of macrophages in their synovial tissue, regulated the polarization of M1/M2 macrophages, and inhibited the phosphorylation of p65, IκBα, ERK, and p38 proteins. We thus expect VA to become a popular, cost-effective anti-inflammatory drug for the treatment of RA in the future.

This study has several limitations, however. With our in vitro cell experiments, we could not verify that VA regulates the changes in related signaling pathways in LPS-induced PM, not could we determine the regulation mechanism of VA on FLSs. In addition, we examined the changes in inflammatory cytokines in RAW264.7 cells under VA intervention but did not study its regulation on anti-inflammatory cytokines such as IL-10 and Arg-1 that are produced by M2 macrophages. A comprehensive exploration of the regulation of VA on M1/M2 macrophage polarization needs to be carried out in future research.

Conclusion

In conclusion, in this study we explored the anti-arthritic activity of VA and investigated the potential underlying molecular mechanisms. Our results show that VA can significantly improve the inflammatory response in CIA mice and LPS-induced RAW264.7 cells. Moreover, VA reduced the production of inflammatory cytokines and chemokines by inhibiting the activation of the NF-κB/MAPK signaling pathways. Therefore, VA can be considered a potential candidate drug for the treatment of RA, and our findings may provide important implications for therapies aimed at the modulation of inflammation for RA.

Acknowledgements

This work was supported by Foundation of State Key Laboratory of Ultrasound in Medicine and Engineering (Grant No. 2024KFKT020).

Author contributions

YZ, PfL and CbZ contributed to the conception or design of the work. YZ performed the bioinformatic analysis. YZ, PfL conducted the in vivo and in vitro experiment. YZ wrote the first draft of the manuscript and performed the interpretation of the results. YZ and PfL wrote the final version of the manuscript in collaboration, which was critically revised by CbZ, ChL, ZwZ, and RC. All authors gave final approval of the manuscript and agreed to be accountable for all aspects of the work.

Funding

The funding was supported by Foundation of State Key Laboratory of Ultrasound in Medicine and Engineering, 2024KFKT020, Chunbing Zhang.

Data availability

The original contributions presented in the study are included in the article; further inquiries can be directed to the corresponding authors.

Declarations

Conflict of interest

The authors declare no conflicts of interest.

Ethics statement

The animal study was reviewed and approved by the Ethical approval for the current study was obtained from the Institutional Animal Care and Use Committee at Nanjing University of Chinese Medicine (Nanjing, China).

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Yu Zhou, Pengfei Li and Zhongwen Zhi contributed equally to this work.

References

  1. Abd-Elhalem SS, Al-Doori MH, Hassen MT (2023) Macrophage polarization towards M2 phenotype by curcuminoids through NF-κB pathway inhibition in adjuvant-induced arthritis. Int Immunopharmacol 119:110231 [DOI] [PubMed] [Google Scholar]
  2. Aletaha D, Smolen JS (2018) Diagnosis and management of rheumatoid arthritis. JAMA 320(13):1360 [DOI] [PubMed] [Google Scholar]
  3. Arabaci TS, Eskiler GG, Ercan F (2024) Gastroprotective effect of vanillic acid against ethanol-induced gastric injury in rats: involvement of the NF-κB signalling and anti-apoptosis role. Mol Biol Rep 51(1):744 [DOI] [PubMed] [Google Scholar]
  4. Bai F, Fang L, Hu H et al (2019) Vanillic acid mitigates the ovalbumin (OVA)-induced asthma in rat model through prevention of airway inflammation. Biosci Biotechnol Biochem 83(3):531–537 [DOI] [PubMed] [Google Scholar]
  5. Brand DD, Latham KA, Rosloniec EF (2007) Collagen-induced arthritis. Nat Protoc 2(5):1269–1275 [DOI] [PubMed] [Google Scholar]
  6. Bu Y, Wu H, Deng R et al (2022) The anti-angiogenesis mechanism of Geniposide on rheumatoid arthritis is related to the regulation of PTEN. Inflammopharmacology 30(3):1047–1062 [DOI] [PubMed] [Google Scholar]
  7. Chen J, Huang C, Chang H et al (2017) Scutellaria baicalensis ameliorates acute lung injury by suppressing inflammation in vitro and in vivo. Am J Chin Med 45(01):137–157 [DOI] [PubMed] [Google Scholar]
  8. de Oliveira RG, Castilho GRD, Cunha ALD et al (2017) Dilodendron bipinnatum Radlk. inhibits pro-inflammatory mediators through the induction of MKP-1 and the down-regulation of MAPKp38/JNK/NF-κB pathways and COX-2 in LPS-activated RAW 264.7 cells. J Ethnopharmacol 202:127–137 [DOI] [PubMed] [Google Scholar]
  9. El-Waseef D (2020) A highlight on CD4(+) T-cells in the spleen in a rat model of rheumatoid arthritis and possible therapeutic effect of omega-3. Histological and immunofluorescence study. Int Immunopharmacol 81:106283 [DOI] [PubMed] [Google Scholar]
  10. Fraenkel L, Bathon JM, England BR et al (2021) 2021 American College of Rheumatology Guideline for the treatment of rheumatoid arthritis. Arthritis Rheumatol 73(7):1108–1123 [DOI] [PubMed] [Google Scholar]
  11. Gravallese EM, Firestein GS, Longo DL (2023) Rheumatoid arthritis-common origins, divergent mechanisms. N Engl J Med 388(6):529–542 [DOI] [PubMed] [Google Scholar]
  12. Guo W, Sun J, Jiang L et al (2012) Imperatorin attenuates LPS-induced inflammation by suppressing NF-κB and MAPKs activation in RAW 264.7 macrophages. Inflammation 35(6):1764–1772 [DOI] [PubMed] [Google Scholar]
  13. Haque MA, Jantan I, Harikrishnan H (2018) Zerumbone suppresses the activation of inflammatory mediators in LPS-stimulated U937 macrophages through MyD88-dependent NF-κB/MAPK/PI3K-Akt signaling pathways. Int Immunopharmacol 55:312–322 [DOI] [PubMed] [Google Scholar]
  14. Hu Z, Jiao Q, Ding J et al (2011) Berberine induces dendritic cell apoptosis and has therapeutic potential for rheumatoid arthritis. Arthritis Rheum 63(4):949–959 [DOI] [PubMed] [Google Scholar]
  15. Huang WY, Sheu SJ (2006) Separation and identification of the organic acids in Angelicae Radix and Ligustici Rhizoma by HPLC and CE. J Sep Sci 17(29):2616–2624 [DOI] [PubMed] [Google Scholar]
  16. Kim M, Kim S, Kim D et al (2010) Vanillic acid inhibits inflammatory mediators by suppressing NF-κB in lipopolysaccharide-stimulated mouse peritoneal macrophages. Immunopharmacol Immunotoxicol 33(3):525–532 [DOI] [PubMed] [Google Scholar]
  17. Krenn V, Morawietz L, Haupl T et al (2002) Grading of chronic synovitis–a histopathological grading system for molecular and diagnostic pathology. Pathol Res Pract 198(5):317–325 [DOI] [PubMed] [Google Scholar]
  18. Li Z, Tan J, Wang L et al (2017) Andrographolide benefits rheumatoid arthritis via inhibiting MAPK pathways. Inflammation 40(5):1599–1605 [DOI] [PubMed] [Google Scholar]
  19. Lin W, Liu Y, Zhang S et al (2023a) Schisandrin treatment suppresses the proliferation, migration, invasion, and inflammatory responses of fibroblast-like synoviocytes from rheumatoid arthritis patients and attenuates synovial inflammation and joint destruction in CIA mice. Int Immunopharmacol 122:110502 [DOI] [PubMed] [Google Scholar]
  20. Lin YR, Zheng FT, Xiong BJ et al (2023b) Koumine alleviates rheumatoid arthritis by regulating macrophage polarization. J Ethnopharmacol 311:116474 [DOI] [PubMed] [Google Scholar]
  21. Linghu K, Ma QS, Zhao GD et al (2020) Leocarpinolide B attenuates LPS-induced inflammation on RAW264.7 macrophages by mediating NF-κB and Nrf2 pathways. Eur J Pharmacol 868:172854 [DOI] [PubMed] [Google Scholar]
  22. Liu W, Zhang Y, Zhu W et al (2018) Sinomenine inhibits the progression of rheumatoid arthritis by regulating the secretion of inflammatory cytokines and monocyte/macrophage subsets. Front Immunol. 10.3389/fimmu.2018.02228 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Liu X, Tao T, Yao H et al (2023) Mechanism of action of quercetin in rheumatoid arthritis models: meta-analysis and systematic review of animal studies. Inflammopharmacology 31(4):1629–1645 [DOI] [PubMed] [Google Scholar]
  24. Ma Q, Jiang J (2016) Functional components from nature-derived drugs for the treatment of rheumatoid arthritis. Curr Drug Targets 17(14):1673 [DOI] [PubMed] [Google Scholar]
  25. Ma Z, Huang Z, Zhang L et al (2021) Vanillic acid reduces pain-related behavior in knee osteoarthritis rats through the inhibition of nlrp3 inflammasome-related synovitis. Front Pharmacol 11:599022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Miyoshi M, Liu S (2018) Collagen-induced arthritis models. Methods Mol Biol 1868:3–7 [DOI] [PubMed] [Google Scholar]
  27. Ni J, Zhang L, Feng G et al (2024) Vanillic acid restores homeostasis of intestinal epithelium in colitis through inhibiting CA9/STIM1-mediated ferroptosis. Pharmacol Res 202:107128 [DOI] [PubMed] [Google Scholar]
  28. Oh YJ, Jin SE, Shin H et al (2023) Daeshiho-tang attenuates inflammatory response and oxidative stress in LPS-stimulated macrophages by regulating TLR4/MyD88, NF-κB, MAPK, and Nrf2/HO-1 pathways. Sci Rep 13(1):18891 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Shi Y, Shu H, Wang X et al (2020) Potential advantages of bioactive compounds extracted from traditional chinese medicine to inhibit bone destructions in rheumatoid arthritis. Front Pharmacol 11:561962 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Sk V et al (2022) Vanillic acid attenuates cell proliferation, xenobiotic enzyme activity, and the status of pulmonary mitochondrial enzymes in lung carcinoma. J Food Biochem 46(10):e14366 [DOI] [PubMed] [Google Scholar]
  31. Smolen JS, Aletaha D, McInnes IB (2016) Rheumatoid arthritis. Lancet 388(10055):2023–2038 [DOI] [PubMed] [Google Scholar]
  32. Tak PP, Firestein GS (2001) NF-κB: a key role in inflammatory diseases. J Clin Investig 107(1):7–11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Tak PP, Gerlag DM, Aupperle KR et al (2001) Inhibitor of nuclear factor kappa B kinase beta is a key regulator of synovial inflammation. Arthritis Rheum 44(8):1897–1907 [DOI] [PubMed] [Google Scholar]
  34. Taqvi S, Ahmed Bhat E, Sajjad N et al (2021) Protective effect of vanillic acid in hydrogen peroxide-induced oxidative stress in D.Mel-2 cell line. Saudi J Biol Sci 28(3):1795–1800 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Tardito S, Martinelli G, Soldano S et al (2019) Macrophage M1/M2 polarization and rheumatoid arthritis: A systematic review. Autoimmun Rev 11(18):102397 [DOI] [PubMed] [Google Scholar]
  36. Udalova IA, Mantovani A, Feldmann M (2016) Macrophage heterogeneity in the context of rheumatoid arthritis. Nat Rev Rheumatol 12(8):472–485 [DOI] [PubMed] [Google Scholar]
  37. Wang Y, Han C, Cui D et al (2017) Is macrophage polarization important in rheumatoid arthritis? Int Immunopharmacol 50:345–352 [DOI] [PubMed] [Google Scholar]
  38. Wang D, Wu Z, Zhao C et al (2021a) KP-10/Gpr54 attenuates rheumatic arthritis through inactivating NF-κB and MAPK signaling in macrophages. Pharmacol Res 171:105496 [DOI] [PubMed] [Google Scholar]
  39. Wang R, Li DF, Hu YF et al (2021b) Alleviated monocytes/macrophages-mediated inflammation in rats with adjuvant-induced arthritis by disrupting their interaction with (Pre)-adipocytes through PPAR-Gamma signaling. Drug Des Devel Ther 15:3105–3118 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Wang L, Li P, Zhou Y et al (2023) Magnoflorine ameliorates collagen-induced arthritis by suppressing the inflammation response via the NF-κB/MAPK signaling pathways. J Inflamm Res 16:2271–2296 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Weber BN, Giles JT, Liao KP (2023) Shared inflammatory pathways of rheumatoid arthritis and atherosclerotic cardiovascular disease. Nat Rev Rheumatol 19(7):417–428 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Xu H, Cai L, Zhang L et al (2018) Paeoniflorin ameliorates collagen-induced arthritis via suppressing nuclear factor-κB signalling pathway in osteoclast differentiation. Immunology 154(4):593–603 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Yang X, Qian H, Meng J et al (2023) Lonicerin alleviates the progression of experimental rheumatoid arthritis by downregulating M1 macrophages through the NF-κB signaling pathway. Phytother Res 37(9):3939–3950 [DOI] [PubMed] [Google Scholar]
  44. Yao X, Jiao S, Qin M et al (2020) Vanillic acid alleviates acute myocardial hypoxia/reoxygenation injury by inhibiting oxidative stress. Oxid Med Cell Longev 2020:1–12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Yu J, Zhou P (2020) The advances of methotrexate resistance in rheumatoid arthritis. Inflammopharmacology 28(5):1183–1193 [DOI] [PubMed] [Google Scholar]
  46. Yurteri A, Mercan N, Kilic M et al (2024) Does vanillic acid affect fracture healing? An experimental study in a rat model of femur fracture. J Appl Biomed 22(2):67–73 [DOI] [PubMed] [Google Scholar]
  47. Ziadlou R, Barbero A, Martin I et al (2020) Anti-inflammatory and chondroprotective effects of vanillic acid and epimedin C in human osteoarthritic chondrocytes. Biomolecules 10(6):932 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The original contributions presented in the study are included in the article; further inquiries can be directed to the corresponding authors.

Articles from Inflammopharmacology are provided here courtesy of Springer

RESOURCES