Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Apr 17.
Published in final edited form as: Cell Rep. 2024 Dec 10;43(12):115054. doi: 10.1016/j.celrep.2024.115054

SPTLC3 regulates plasma membrane sphingolipid composition to facilitate hepatic gluconeogenesis

David Montefusco 1,*, Maryam Jamil 1, Daniel Canals 2, Siri Saligrama 1, Yang Yue 1, Jeremy Allegood 1, L Ashley Cowart 1,3,*
PMCID: PMC12004358  NIHMSID: NIHMS2061147  PMID: 39661520

SUMMARY

SPTLC3, an inducible subunit of the serine palmitoyltransferase (SPT) complex, causes production of alternative sphingoid bases, including a 16-carbon dihydrosphingosine, whose biological function is only beginning to emerge. High-fat feeding induced SPTLC3 in the liver, prompting us to produce a liver-specific knockout mouse line. Following high-fat feeding, knockout mice showed decreased fasting blood glucose, and knockout primary hepatocytes showed suppressed glucose production, a core function of hepatocytes. Stable isotope tracing revealed suppression of the gluconeogenic pathway, finding that SPTLC3 was required to maintain expression of key gluconeogenic genes via adenylate cyclase/cyclic AMP (cAMP)/cAMP response element binding protein (CREB) signaling. Additionally, by employing a combination of a recently developed lipidomics methodology, exogenous C14/C16 fatty acid treatment, and in situ adenylate cyclase activity, we implicated a functional interaction between sphingomyelin with a d16 backbone and adenylate cyclase at the plasma membrane. This work pinpoints a specific sphingolipid-protein functional interaction with broad implications for understanding sphingolipid signaling and metabolic disease.

Graphical Abstract

graphic file with name nihms-2061147-f0001.jpg

In brief

The key advances in Montefusco et al. demonstrate a novel function of the serine palmitoyl transferase subunit SPTLC3 in cyclic AMP-directed regulation of hepatic glucose production in the context of metabolic disease. It is shown that SPTLC3-derived sphingomyelin regulates adenylate cyclase activity at the plasma membrane.

INTRODUCTION

Sphingolipids have long been recognized as fundamental regulators of nutrient and energy metabolism that exert their effects through interaction with key proteins, including mammalian target of rapamycin (mTOR),1,2 protein kinase B (AKT),3,4 AMP-activated protein kinase (AMPK),57 peroxisome proliferator-activated receptors (PPARs),7 sterol regulatory binding proteins (SREBPs),8,9 cyclic AMP response element binding protein (CREB),10,11 and regulation of autophagy-related pathways.12,13 Sphingolipids have also been shown to mediate processes associated with diseases of overnutrition, such as non-alcoholic fatty liver disease (NAFLD) and type 2 diabetes (T2D).1418

The first step of de novo sphingolipid biosynthesis is catalyzed by the serine palmitoyl transferase (SPT) complex, which uses serine and palmitoyl-coenzyme A (CoA) as substrates to produce an 18-carbon sphingoid base. The constitutive SPT complex is a multi-subunit complex most commonly consisting of two large subunits, SPTLC1 and SPTLC2, and one or more small subunits (ssSPTa/ssSPTb) and the orosomucoid-like proteins (ORMDL) regulatory subunits. By far the most abundant sphingolipids incorporate the 18-carbon dihydrosphingosine (DHS), of which the fatty chain includes the16 carbons from palmitate plus 2 carbons from serine.

Though d18-DHS-based sphingolipids constitute the major sphingolipid pools, some substrate promiscuity has been reported in SPT, largely associated with disease states, large changes in substrate abundance, and inherited point mutations in SPTLC2 and ssSPTa.1923 However, substrate specificity is also substantially altered by substitution of the constitutively expressed SPTLC2 by its homolog, SPTLC3, which has low expression in most tissues. Inclusion of SPTLC3 in the SPT complex was initially reported by Hornemann et al. and has been shown to lead to production of a shorter 16-carbon sphingoid base, d16-DHS, derived from the 14-carbon myristoyl-CoA substrate and serine.24,25

The biological functions of SPTLC3 and its products in liver are not well understood. We have previously demonstrated a mechanistic link between high-fat diet, SPTLC3 upregulation in the heart, and increased d16-based sphingolipids, which exhibited proapoptotic effects in cultured primary cardiomyocytes.25 More recently, SPTLC3 has been found to be essential for function of the cardiomyocyte electron transport chain.26 However, most reports addressing SPTLC3 have been results from genomic screens evaluating the associations between SPTLC3 single-base genomic variants and circulating lipids and/or other disease markers.2744 Despite the descriptive nature of these studies, some have provided tantalizing clues as to physiological functions of SPTLC3, especially in metabolic disease and its hepatic manifestation, non-alcoholic fatty liver disease (NAFLD). For example, multiple studies have reported that variants within and distal to the SPTLC3 gene had a strong relationship with hepatic lipid content,42 circulating lipids, and or lipoproteins.3336,38,4346 Importantly, other studies suggest a breadth of involvement of SPTLC3 in metabolic health, including T2D,47 insulin resistance,36,38,41 NAFLD,42 and cardiovascular disease.33,44,46 Despite these clues, there is no mechanistic information as to how SPTLC3 regulates metabolic processes. Here we report that d16-DHS derived from SPTLC3 is readily incorporated by ceramide synthases into a set of d16-based ceramides and a corresponding set of d16-based complex sphingolipids, including sphingomyelins, which concentrate in the plasma membrane and regulate glucagon-stimulated adenylate cyclase activity, thereby facilitating gluconeogenesis.

RESULTS AND DISCUSSION

Ablation of hepatocyte SPTLC3 prevents increased fasting blood glucose with high-fat feeding

SPTLC3 has been shown previously to be induced in the liver with a high-fat diet.41,48 Additionally, genome-wide association studies showed a relationship between SPTLC3 and NAFLD, T2D, and atherosclerosis.40,49,50 To investigate potential roles of SPTLC3 in NAFLD, we generated a conditional SPTLC3 knockout by introducing loxP sites flanking exon 8 of the SPTLC3 gene. Exon 8 contains the sequence for the pyridoxal 5-phosphate binding domain, which has been well established as the active site through studies on SPTLC2, which bears over 65% homology to SPTLC3.23,51 The conditional knockout was then crossed with albumin-cre (B6.Cg-Speer6-ps1Tg(Alb-cre)21Mgn/J) to generate an SPTLC3 hepatocyte-specific knockout (SPT3-hKO). Modification of the gene was virtually 100%, which was demonstrated by amplification of genomic DNA surrounding exon 8 (Figure S1).

The numerous observations of SPTLC3 being induced by high-fat feeding41,48,50,52 led to the hypothesis that SPTLC3 plays a role in the development of metabolic disease. Since the hepatic manifestation of metabolic disease is NAFLD, we hypothesized that SPT3-hKO may be protected from NAFLD phenotypes. To address this, the SPT3-hKO mice were subjected to high-fat feeding and assessed for NAFLD and/or T2D-related phenotypes. Liver tissue homogenate of male albumin-cre (Alb-Cre) control mice showed induction of SPTLC3 with high fat diet (HFD) feeding, while no expression was detected in SPT3-hKO (Figure 1A), confirming that the CRE-loxP system used to deplete SPTLC3 was effective. We assessed several measures of NAFLD progression, including steatosis, total triglycerides (TGs), fasting blood glucose, glucose tolerance, and hepatic glycogen. H&E-stained sections showed no apparent differences in steatosis with HFD feeding, which was confirmed by scoring for incidence of macrosteatosis (Figures 1B, 1C, and S3F), and there was no indication of difference hepatomegaly (Figures 1D and S3E). Consistent with these findings, there was also no difference in TG levels between Alb-Cre and SPT3-hKO mice (Figures 1E and S3D). Glycogen accumulation can also contribute to a steatotic phenotype, and glycogenolysis is the major source of hepatic glucose during short-term fasting; thus, liver glycogen levels were also measured, and no significant difference was observed (Figure 1F). Markers of inflammation, which increase in NAFLD, were also evaluated. Monocyte chemoattractant protein 1 significantly increased with HFD feeding, but there was no change in SPT3-hKO mice (Figure S2). Together, these data suggested that SPTLC3 is not a major player in HFD-induced NAFLD pathology.

Figure 1. Male SPT3-hKO and Alb-Cre controls were placed on an HFD for 16 weeks and assessed for metabolic phenotype.

Figure 1.

(A) SPTLC3 expression in liver tissue homogenate of mice following high-fat diet (HFD) feeding versus low-glycemic control diet (CD) feeding. Expression was quantified by ΔΔcq method with a reference gene panel consisting of β-actin, Tbp1, and Hmbs1.

(B) Representative images of H&E staining of liver tissue. Scale bars: 200 μm.

(C) Quantification of macrosteatosis observed in histology images.

(D) Liver weight.

(E) TGs in liver homogenate.

(F) Liver glycogen following HFD feeding.

(G) Blood glucose following a 6 h fast.

(H) ipGTT.

(I) Area under the curve for the GTT.

(J) Serum insulin.

All graphical data are represented as mean ± SEM. The p values were calculated by Student’s t test. *p < 0.05, **p < 0.01, ****p < 0.001; n = 5 biological replicates.

To determine potential contributions of SPTLC3 to the overall HFD-induced T2D phenotype, an intraperitoneal glucose tolerance test (ipGTT) was performed following a 6-h fast. Prior to glucose injection, the Alb-Cre HFD group presented with elevated fasting blood glucose consistent with diet-induced metabolic disease (Figure 1G). In contrast, HFD-fed SPT3-hKO mice did not display elevated fasting blood glucose. Furthermore, after delivery of the glucose bolus, this difference persisted (Figures 1H and 1I). This suggested partial protection from the T2D phenotype, which may be analogous to reduced hepatic glucose production from antidiabetic drugs such as metformin.53 Though SPT3-hKO mice exhibited protection from HFD-induced elevated fasting glucose and impaired glucose clearance, HFD feeding elevated postprandial insulin similarly between genotypes (Figure 1J). Samples were taken postprandially due to experimental design. Suppression of elevated fasting blood glucose and differences in glucose tolerance were only observed in male mice (Figures S3AS3C), which is not surprising since female mice are protected relative to male mice in the context of several diabetes models.54,55 While these data indicate that SPTLC3 may play some role in metabolic adaptations of HFD feeding, they also indicate that the attenuation of HFD-induced elevated fasting blood glucose arose outside of the context of general protection from NAFLD.

Key regulators of gluconeogenesis are suppressed in SPT3-hKO primary hepatocytes

A critical function of the liver is to maintain blood glucose homeostasis during fasting through hepatic glucose production, which requires gluconeogenesis during long-term fasting. To recapitulate fasting in vitro, primary mouse hepatocytes isolated from Alb-Cre and SPT3-hKO were incubated for 6 h in glucose-free medium. During this time, Alb-Cre hepatocytes secreted enough glucose to accumulate to ~125 μM in medium, while SPT3-hKO produced only 50 μM, suggesting that glucose production may be impaired in SPT3-hKO hepatocytes (Figure 2A). Phosphoenolpyruvate carboxykinase (PCK1), which generates phosphoenolpyruvate, is the major rate-limiting enzyme in gluconeogenesis for substrates routed through the TCA cycle. Glucose-6-phosphatase (G6PC), which performs the final step in gluconeogenesis by dephosphorylating glucose-6-phosphate to release glucose, and GLUT2, which is the glucose channel through which hepatic glucose is exported, also play key roles in gluconeogenesis and/or maintenance of blood glucose levels during fasting, during which they are transcriptionally induced by glucagon signaling. To test whether induction of these genes was impaired in SPT3-hKO, we treated with 100 nM glucagon (GC) for 3 h. SPT3-hKO demonstrated very low basal expression of mRNA encoding these enzymes as compared to controls. Furthermore, while treatment with GC robustly induced these genes in control hepatocytes, message levels remained low in SPT3-hKO hepatocytes, suggesting impaired transcriptional induction (Figure 2B). Moreover, PCK1 protein increased notably with GC treatment in control cells but was markedly less in SPT3-hKO after GC (Figure 2C). PCK1, G6PC, and GLUT2 were not suppressed in post-prandial livers from diet mice (Figure S6); in vivo, it appears that onset of metabolic disease with fasting is required for an observable effect. CREB is among several signaling proteins that affect gene transcription in response to cyclic AMP (cAMP) levels. CREB is activated by phosphorylation at serine 133 in response to cAMP in response to GC. A GC dose response showed that P-CREB levels are suppressed in SPT3-hKO relative to Alb-Cre, approaching 100 nM (Figure 2D), implying that impaired cAMP signaling may be the cause of suppressed PCK1, G6PD, and GLUT2 expression.

Figure 2. Evaluation of gluconeogenesis in primary mouse hepatocytes isolated from SPT3-hKO and Alb-Cre mice.

Figure 2.

(A) Glucose levels in medium produced by Alb-Cre and SPT3-hKO primary hepatocytes after 6 h. *p < 0.05 by t test. n = 5 biological replicates.

(B) Expression by real-time qPCR of gluconeogenic genes following treatment with 100 nM glucagon (GC) for 3 h. Expression was measured by ΔΔcq method with a reference gene panel consisting of β-actin, Hmbs1, and Tbp1. Significance was determined by ANOVA. **p < 0.01, *p < 0.05. The dashed line indicates p < 0.01 for control versus GC for both Alb-Cre and SPT3-hKO. n = 3 biological replicates.

(C) Western blot showing expression of PCK1 protein with GC treatment. This blot is representative of triplicate measurements.

(D) Western blot showing P-CREB (Ser-133) phosphorylation in response to a GC dose of 0, 5, 10, 25, 50, or 100 nM. This blot is representative of triplicate measurements.

(E) Stable isotopic labeling of metabolites feeding gluconeogenesis via the TCA cycle. Hepatocytes isolated from Alb-Cre and SPT3-hKO mice were treated with 4 mM U13C-glutamine for 6 h in DMEM without glucose, glutamine, or phenol red. Universally labeled target metabolites were targeted for analysis to assess the first pass through the TCA cycle. Cellular metabolite levels are expressed relative to total protein. The p values were calculated by t test. *p < 0.05, n = 6 biological replicates.

(F) Expression of amino acid transporters in primary mouse hepatocytes by ΔΔcq method with a reference gene panel consisting of β-actin, Hmbs1, and Tbp1. Significance was determined by t test. **p < 0.01, n = 3 biological replicates. All graphical data are represented as mean ± SEM.

This impaired PCK1 expression led to the hypothesis that blocked PEP synthesis was the major metabolic bottleneck leading to suppressed glucose production. However, sphingolipids have been implicated previously in several aspects of nutrient supply and metabolic regulation, such as nutrient uptake, mTOR regulation, starvation signaling, autophagy and others. By mass, the major gluconeogenic substrates in vivo are lactate and glutamine,56 and additional studies indicate that glutamine is a primary substrate for GC-mediated gluconeogenesis and that glutamine utilization is acutely sensitive to cAMP signaling.57 Untargeted metabolomics revealed that several metabolites that can act as gluconeogenic substrates were elevated in SPT3-hKO hepatocytes relative to controls, including lysine and glutamine (Figure S4), but not lactate. However, this analysis represented a “snapshot” of metabolism, and these elevations could indicate either increased flux through gluconeogenesis or a block in downstream steps of gluconeogenesis, leading to accumulation of gluconeogenic substrates. Thus, we chose to assess gluconeogenic activity by metabolite tracing. Primary hepatocytes from control and SPT3-hKO mice were treated with universally labeled 13C-labeled glutamine (U13C-gln) in glucose-free medium to track the exchange of carbons through entry into and exit from the TCA cycle and into the gluconeogenesis pathway.56 Universally 13C-labeled target metabolites were selected to isolate the first pass through the TCA cycle in the forward direction and the exit to gluconeogenesis through generation of PEP. Indeed, the distribution of labeled metabolites with respect to genotype was consistent with blocked PEP synthesis in the SPT3-hKO hepatocytes (Figure 2E). Specifically, M+3 PEP accumulated to about half the level in SPT3-hKO hepatocytes relative to Alb-Cre. This difference in PEP labeling was reflected in the downstream metabolites M+6 G6P and fructose 1,6-bisphosphate. While this was not reflected in the level of M+6-labeled intracellular glucose, it should be noted that the amount of labeled intracellular glucose M+6 is less than 10% that of G6P M+6, indicating that, as expected, more than 90% of the labeled glucose was exported but did not accumulate to detectable levels in the medium. However, the data in Figure 2A demonstrate significant reduction in glucose production by SPT3-hKO under the same culture conditions in glucose-free medium,.

Another finding from untargeted metabolomics was the decrease in intracellular Gln M+5 levels, which may imply an impairment of cellular glutamine uptake. Suppression of amino acid uptake is consistent with suppressed cAMP signaling; Ortiz et al. have shown that expression of the amino acid transporter SNAT2 is highly sensitive to adenylate cyclase activity and cAMP levels.58 We noted, in fact, that SNAT2 was basally suppressed in SPT3-hKO (Figure 2F), However, because the amount taken up was enough to drive conversion to 2-oxoglutarate to similar levels as in the wild type, we speculate that glutamine uptake under these conditions is not impaired sufficiently to compromise the kinetics of the downstream steps in the pathway independent from the decrease in PCK1 and therefore deemed this further evidence of impaired cAMP production, but overall, a less impactful effect than impairment in GC-stimulated PCK1. Thus, in total, these findings indicated that SPT3-hKO had impaired gluconeogenesis primarily due to suppressed conversion of oxalacetate to PEP and downstream metabolites.

Hepatocyte SPTLC3 depletion impairs GC signaling by altering cAMP metabolism

GC is the major driver of hepatic gluconeogenesis acting through GC receptors at the cell surface. GC receptors interact with adenylate cyclases (ACs), which also reside in the plasma membrane. ACs are responsible for synthesis of the major second messenger cAMP from ATP substrate and are the main regulators of cAMP levels. To test whether GC signaling was impaired in the SPT3-hKO, levels of cAMP were measured in Alb-Cre and SPT3-hKO cell lysates following treatment by GC (Figure 3A). As expected, GC increased cAMP levels in control hepatocytes; however, the cAMP increase was impaired in SPT3-hKO, which, together with the blunted increase of mRNA encoding gluconeogenic proteins and attenuation of GC-mediated CREB phosphorylation in SPT3-hKO cells, suggested that hepatocytes require SPTLC3 for normal GC stimulation of AC activity. It should be noted that PCK1 and GLUT2 expression was basally lower in untreated control cells, indicating that AC activity may be proportionally suppressed in SPT3-hKO relative to Alb-Cre regardless of input from the GC signaling pathway. Because the first step in GC signaling is activation of cAMP production, we tested whether exogenous cAMP could bypass the putative GC signaling defect in SPT3-hKO hepatocytes. To this end, cells were treated with chlorophenylthiol (CPT)-cAMP, a cell-permeable cAMP derivative (Figure 3B). CPT-cAMP increased mRNA expression of PCK1, G6PC, and GLUT2 to a similar extent in SPT3-hKO and Alb-Cre, implying that the defect in GC signaling mediated by SPTLC3 may arise from impaired cAMP production at the plasma membrane.

Figure 3. Evaluation of GC-driven cyclic AMP signaling in primary hepatocytes isolated from SPT3-hKO and Alb-Cre mice.

Figure 3.

(A) cAMP levels measured by ELISA following treatment of primary mouse hepatocytes with 100 nM GC. Significance was determined by t test. **p < 0.01, ****p < 0.0001. n = 3 biological replicates.

(B) Expression by real-time qPCR of key gluconeogenic genes following treatment with cell-permeable cAMP chlorophenylthiol-cAMP (pCPT-cAMP). Expression was measured by ΔΔcq method with a reference gene panel consisting of β-actin, Hmbs1, and Tbp1. The dashed line indicates the level of significance between treated and control samples within each genotype. Significance was determined by ANOVA. *p < 0.05, ****p < 0.0001, n = 3 biological replicates.

(C) Successful isolation of PM from whole liver was validated by western blot of sodium-potassium ATPase (Na+, K+ ATPase) in lysate (Lys), supernatant (Sup), and plasma membrane (PM) fractions. Replicate low- and high-exposure images capture the Lys and PM fraction bands, respectively. This blot is representative of the 5 replicate PM extractions used to generate AC activity data shown in (E).

(D) In vitro AC activity was determined by measuring cAMP produced by partially purified PM extracts from whole liver. Positive control (PC) samples consisted of pooled PM extracts treated with an AC activator (24 μM forskolin). NC samples were prepared with PM extracts and no ATP substrate. Sample blanks (SBs) contained no PM extract. ****p < 0.0001; significance was determined by t test; n = 3 technical replicates.

(E) AC activity of partially purified PM fractions from isolated livers of 5 individual HFD-fed mice. *p < 0.05; significance was determined by t test; n = 5 biological replicates.

(F) In situ AC activity on hepatocytes isolated from Alb-Cre and SPT3-hKO littermate controls. Cells were pretreated for 24 h with 250 μM palmitate (PA), myristate (MA), or vehicle (0.25% DMSO in 2% fatty acid free BSA). Fatty acids were removed and replaced with 100 nM GC plus a phosphodiesterase/ATPase inhibitor cocktail. After a 30 min of pre-treatment with GC/inhibitors, 5 mM isotopically labeled ATP was added for an additional 30 min, and the reaction was quenched with 80% methanol. The isotopic cAMP product was quantified by LC-MS/MS, and specific activity was calculated using total protein. Significance was determined by individual t tests. **p < 0.01, n = 3 biological replicates.

All graphical data are represented as mean ± SEM.

Because SPTLC3 plays a role in biosynthesis of sphingolipids, which are essential membrane components, we speculated that an SPTLC3-derived sphingolipid may be required for production of cAMP at the plasma membrane. This idea is consistent with previous studies demonstrating that AC activity is sensitive to its membrane environment,5962 which, together with data thus far, led to the hypothesis that SPTLC3-derived sphingolipid products may contribute to the plasma membrane environment in a manner that facilitates AC activity. DHS, which is the first readily detectable product arising from the SPT complex, is a substrate for a family of ceramide synthases, which utilize acyl-CoA substates of between 14 and 26 carbons to generate dihydroceramides. Desaturation of these dihydroceramides generates a corresponding set of ceramides, which can then be incorporated into more complex sphingolipids, including sphingomyelin, which is abundant in the outer leaflet of the plasma membrane. Therefore, d16-DHS, derived from SPTLC3, could become incorporated into dihydroceramides, ceramides, and sphingomyelins with d16-sphingoid backbones, which may impact cell membrane properties, thereby affecting AC activity. To address this hypothesis, partially purified plasma membrane fractions were isolated from steatotic Alb-Cre and SPT3-hKO mouse livers.63 The plasma membrane marker sodium-potassium ATPase (Na+, K+ ATPase) was probed by western blot to demonstrate successful enrichment of the plasma membrane (Figure 3C). Endogenous AC activity was measured in these purified fractions by quantifying the production of cAMP following addition of ATP substrate.64 The positive control (PC), negative control (NC), and sample blanks (SBs) contained a combination of ATP substrate, plasma membrane (PM) fraction and/or AC activator forskolin (Figure 3D). Indeed, PM fractions obtained from the liver homogenates of HFD-fed mice were assayed, and the forskolin-induced production of cAMP from ATP was reduced by approximately 30% in SPT3-hKO relative to control hepatocytes, indicating impaired PM AC activity (Figure 3E). To further establish a dependence of cAMP production on SPTLC3, in situ cAMP activity was measured in Alb-Cre and SPT3-hKO hepatocytes. Cells were first pretreated with palmitate or myristate for 24 h to trigger an increase in d18.1 and d16.1 sphingolipids, respectively. As predicted, the level of AC activity was basally suppressed in SPT3-hKO treated with vehicle. Interestingly, myristate (MA) pretreatment led to the greatest increase in activity in Alb-Cre, with no significant increase in MA-treated SPT3-hKO. While palmitate (PA)-pretreated cells showed no changes in AC activity and no significant difference between genotypes (Figure 3F). Together, these data imply that SPTLC3-derived d16-based sphingolipids are key regulators of AC activity.

SPTLC3 generates d16-based PM sphingomyelins

AC activation requires dimerization, which is sensitive to the membrane environment.65,66 Sphingomyelin is a major component of the PM in many cell types, including hepatocytes, and has been linked to glucose metabolism in hepatocytes66,67 and other cell types67 and to nutrient and energy metabolism more generally.68 Sphingomyelins have also been associated with glucose metabolism in the context of metabolic disease.15,69,70 Therefore, we sought to assess SPTLC3-derived d16-based sphingomyelins.

While the backbone and side-chain composition of ceramides can easily be distinguished by liquid chromatography-tandem mass spectrometry (LC-MS/MS) methods (Figure 4A), this is less straightforward for sphingomyelins due to the diagnostic fragmentation pattern, which for SM relies on loss of the choline head group, leaving the intact ceramide as the product ion (Figure 4B). Though in the past it has often been assumed that the sphingoid backbone of sphingomyelin is 18 carbons, in practice it is difficult to pinpoint the backbone and side-chain length of specific SM regioisomers by LC-MS/MS. For each LC-MS/MS sphingomyelin peak, it is only possible to report the number of carbons and double bonds of the tail group fragment with confidence. This issue is discussed further in the STAR Methods.

Figure 4. Lipidomics analysis revealing sphingoid base composition of PM sphingomyelin pools in primary hepatocytes isolated from SPT3-hKO and Alb-Cre mice.

Figure 4.

(A) Structures of ceramides and sphingomyelin, highlighting the range of reported side chains incorporated into the d16 or d18 sphingoid backbone. Current methods for quantification of sphingomyelins do not distinguish between side chain versus backbone.

(B) Schematic of the MS/MS transition used to identify sphingomyelin peaks, illustrating the limitations of standard methods for determining backbone and side-chain composition. All illustrations were produced with BioRender.

(C) Schematic of bacterial sphingomyelinase (bSMase) post treatment, which allows the identification of the backbone and side-chain structures of PM sphingomyelin in primary mouse hepatocytes.

(D) Total sphingomyelin levels determined by LC-MS/MS on Alb-Cre and SPT3-hKO primary mouse hepatocytes with control or bSMase post treatment. Total cellular SM is shown in Alb-Cre and SPT3-hKO without post treatment. Alb-Cre+bSMase and SPT3-hKO+bSMase reveal the amount of SM after PM SM has been converted to ceramide. The difference between the two groups reveals the initial level of PM SM. Individual SM species are labeled by total carbons and double bonds.

(E) D16.1-based ceramide levels determined by LC-MS/MS on Alb-Cre and SPT3-hKO primary mouse hepatocytes with control or bSMase post treatment. The p values were determined by ANOVA. **p < 0.05, ****p < 0.0001. n = 5 biological replicates.

All data are represented as mean ± SEM.

To circumvent the challenges of accurate assignment of sphingoid base composition of sphingomyelins and to specifically target PM sphingomyelin, the method of Greene et al. was employed.71 In brief, cells were fixed and then treated with bacterial sphingomyelinase (bSMase), which hydrolyzes cell-surface sphingomyelins on the outer leaflet of the PM (Figure 4C). The bSMase treatment converts all outer-leaflet SM to ceramide. The liberated ceramide can then be measured using ceramide-specific LC-MS/MS methods, whereby the backbone/side-chain fragmentation pattern allows the backbone composition of the liberated ceramide to be readily identified. Prior to bSMase, the SM-specific LC-MS/MS method was only able to reveal that 40.1-SM showed a significant decrease in SPT3-hKO (Figure 4D). This SM species, identified as a peak in the LC-MS/MS chromatogram, likely arises largely from the sum of SM-d18.1/22 and SM-d16/24.1. However, bSMase treatment revealed that depletion of SPTLC3 reduced PM levels of d16.1/C16, d16.1/C24.1, and d16.1/C24 sphingomyelins (Figure 4E). While d18.1-ceramides were also decreased in SPT3-hKO (Figure S5), these data suggest that PM d16.1/C16, d16.1/C24.1, and d16.1/C24 sphingomyelins comprise the major SPTLC3 products and, thus, are likely to be major contributors to the PM lipid microenvironment required for GC-stimulated AC activity.

Limitations of the study

While these studies support the idea that SPTLC3 induction in HFD-induced obesity plays a role in elevated blood glucose in our mouse model, the relevance of this to humans is limited. However, several genome-wide association studies (GWASs) hint at a link between SPTLC3 and metabolic disease in patients as well as a role for SPTLC3 in supplying circulating sphingomyelins and ceramides. SPTLC3 has also been shown to be involved in the progression of patients from NAFLD to hepatocellular carcinoma.50 Furthermore, while we have linked alterations in PM sphingomyelin composition to AC function, it is likely that numerous membrane proteins require a precise membrane composition for homeostatic function. Therefore, the suitability of SPTLC3 as a therapeutic target to decrease GC-stimulated gluconeogenesis remains in question. However, though SPTLC1 and STPLC2, which comprise the constitutive SPT catalytic complex, are essential in mammals, constitutive SPTLC3 expression is low in most tissues, and, therefore, SPTLC3 may serve as an attractive target.23

While we demonstrated a correlation between altered PM sphingolipids and impaired AC activity, further molecular mechanistic details of how SPTLC3-generated sphingomyelins may interact directly with AC remain to be determined. Supporting a role for direct lipid-protein interaction for AC activity, mycobacterial Rv2212 AC is strongly activated by fatty acids,72 and the crystal structure of the closely related Rv1264 revealed a bound oleic acid.73 These bacterial enzymes are closely related to the mammalian class III ACs and support the possibility of a hydrophobic pocket in AC capable of binding the sphingoid base or side chain of a sphingomyelin molecule.

The mechanism of SPTLC3 induction during HFD feeding is still unknown. Single-base variants identified in humans that correlate to metabolic phenotypes occur distal to the SPTLC3 gene near putative transcription factor binding sites that regulate glucose metabolism. Specifically, SNPs rs364585 and rs6109681 are both linked to metabolic disease and are adjacent to a putative HNF4 binding site (Motifmap; https://motifmap.ics.uci.edu/). The mechanisms of SPTLC3 regulation and function of downstream sphingolipids under numerous pathological conditions are the subjects of current studies.

RESOURCE AVAILABILITY

Lead contact

Requests for further information, resources, and reagents should be directed to and will be fulfilled by the lead contact, L. Ashley Cowart (lauren.cowart@vcuhealth.org).

Materials availability

This study did not generate any unique reagents.

Data and code availability

  • The accession number for the raw untargeted metabolomics data can be found in the key resources table.

  • No new code was generated for this manuscript.

  • Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

KEY RESOURCES TABLE.

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Phospho-Akt (Ser473) Antibody Cell Signaling Technology RRID:AB_329825
Phospho-AMPKα (Thr172) Cell Signaling Technology 5256
PCK1 (D12F5) Rabbit mAb Cell Signaling Technology RRID:AB_2687968
Phospho-CREB (Ser133) (87G3) Rabbit mAb Cell Signaling Technology RRID:AB_2561044
Na,K-ATPase α1 Cell Signaling Technology RRID:AB_2798866

Chemicals, peptides, and recombinant proteins

Glucagon Millipore/Sigma G2044
pCPT-cAMP Millipore/Sigma C3912
IBMX Millipore/Sigma I5879
Thapsigargin R&D Biothechne 1138
Digoxin R&D Biothechne 4583
Sphingomyelinase From Bacillus Cereus Millipore/Sigma S9396
Adenosine 5’-Triphosphate Millipore/Sigma A-2383
adenosine-13 C10,15N5, 5′-Triphosphate Millipore/Sigma 645702
cyclic AMP MedChemExpress HY-B1511S
ATP MedChemExpress 645702
U13C-Glutamine Cambridge Isotopes CLM-1822

Critical commercial assays

Liver Glycogen Abcam ab65620
Mouse Insulin ELISA kit Crystal Chem 90080
cAMP ELISA Cayman 581001

Deposited data

Raw data can be found at: Montefusco, David, 2024, “SPLTC3 in Fatty Liver Disease” Harvard Dataverse, V1. https://doi.org/10.7910/DVN/SMNKQP

Experimental models: Organisms/strains

Albumin Cre B6.Cg-Speer6-ps1Tg(Alb-cre)21Mgn/J Jackson Laboratories RRID:IMSR_JAX:003574
SPTLC3 conditional knockout mouse model Our laboratory SPTLC3-flox

Oligonucleotides

PCK1_forward Eurofins CTCAGCTGCATA ACGGTCTG
PCK1 reverse Eurofins CTTCAGCTTGCG GATGACAC
G6PC forward Eurofins TTGCATTCCTGTATGGTAGTGG
G6PC reverse Eurofins TAGGCTGAGGAGGAGAAAACTG
GLUT2 forward Eurofins AATGGTCGCCTCATTCTTTG
GLUT2 reverse Eurofins ATCAAGAGGGCTCCAGTCAA
SNAT2 forward Eurofins GCAGTGGAATCCTTGGGCTT
SNAT2 reverse Eurofins ATAAAGACCCTCCTTCATTGGCA
SNAT3 forward Eurofins TCGGCTACCTGGGTTACTC
SNAT3 reverse Eurofins GGGAACAGAACAATCGGAACTG
SNAT4 forward Eurofins CCTCGTGCCTACCAT CAAATAC
SNAT4 reverse Eurofins AGACCAAAGCCCCAATCTTC
TNFα forward Eurofins TTGCTCTGTGAAGGGAAATGG
TNFα reverse Eurofins CCTGAGCCATAATCCCCTTTC
MCP1 forward Eurofins TTAAAAACCTGGATCGGAACCAA
MCP1 reverse Eurofins GCATTAGCTTCAGATTTACGGGT
IL6 forward Eurofins TAGTCCTTCCTACCCCAATTTCC
IL6 reverse Eurofins TTGGTCCTTAGCCACTCCTTC
IL10 forward Eurofins TGAATTCCCTGGGTGAGAAGC
IL10 reverse Eurofins CACCTTGGTCTTGGA GCTTATT

STAR★METHODS

Detailed methods are provided in the online version of this paper and include the following:

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Generation of the SPT3-hKO mouse

The ‘floxed’ conditional knockout mouse was crossed with Albumin-Cre (B6.Cg-Speer6-ps1Tg(Alb-Cre)21Mgn/J) obtained from Jackson Laboratories. Successful excision was confirmed by amplification of the targeted region using two primers outside of the excised region, and a third within exon 8. This primer set resulted in a 616bp amplicon for the wild type gene, and a 343bp fragment following excision by the cre recombinase (Figure S1). The primer sequences are given in Figure S1. Once established, the colony was backcrossed with fresh male and then female albumin-cre mice obtained from Jackson Laboratory.

Approval of animal studies

All animal experiments conformed to the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were in accordance with Public Health Service/National Institutes of Health guidelines for laboratory animal usage.

High fat diet

The experimental groups consisted of male and female Albumin-Cre and SPT3-hKO C57BL/6 mice. Mice were group-housed in the animal facility at Virginia Commonwealth University. Food and water were provided ad libitum, animals were maintained on a 12:12 h light-dark cycle and ambient temperature was steadily 21°C. Littermate controls were randomized to a high saturated fat diet (HFD) (Envigo, TD.09766) (60% kcal provided by milkfat) or an isocaloric low-fat diet (CD) (Envigo, TD.120455) (17% kcal provided by lard) at 10 weeks of age, and diets were administered for 16 weeks (n = 5 per group). Mice were euthanized humanely by isoflurane (Hospira, Inc., Lake Forest, IL) followed by cardiac puncture. Cardiac blood was prepared for non-hemolyzed serum, aliquoted, and stored at −80°C. Tissues were collected accordingly as fresh fixed in 10% neutral buffered formalin or fresh snap-frozen in liquid nitrogen and stored at −80°C. All study methods were approved by the IACUC board of Virginia Commonwealth University.

METHOD DETAILS

Intraperitoneal glucose tolerance test

Mice were fasted for 6 h starting at 8 in the morning, and fasting blood glucose was measured prior to administration of glucose. Glucose was administered by intraperitoneal injection as a 20% glucose solution in saline with a volume determined based on 2 g of glucose/kg body mass. Blood was collected through a nick in the tip of the tail after disinfecting with 70% ethanol.

Liver triglyceride levels

A 50 mg tissue sample was dissolved in 6x volume of 2:1 ethanol/30% KOH at 60°C for 5 h, with periodic vortexing to improve digestion. A volume of 1.08 × the original volume of 1 M MgCl2 was added, vortexed, and chilled on ice for 10 min. The digest was centrifuged at 14 000 × g for 30 min at room temperature, and supernatant was collected and diluted 1:10 in water for use in the triglyceride assay. The supernatant was measured with the Triglyceride LiquiColor Test (Stanbio 2200-225).

Liver glycogen

A 50 mg section of tissue was homogenized in 1 mL of ddH2O, with 10–15 passes in a Dounce homogenizer. Homogenate was boiled for 10 min, centrifuged at 4°C, 10 min, 18 000 g. Supernatant was transferred to a new tube, and an aliquot was taken for BCA. Glycogen was quantified by the Abcam Assay Kit (ab65620).

Serum insulin

Blood was harvested by cardiac puncture under isoflurane anesthesia. Non-hemolyzed insulin was quantified by the mouse insulin ELISA kit from Crystal Chem (90080).

Isolation of primary mouse hepatocytes

Isolation was carried out based on the method of Poggel et al.74 Briefly, the inferior vena cava (IVC) was catheterized under isoflurane anesthesia, the IVC was clamped anterior to the heart, and then the liver was flushed from the portal vein with 3 mL of heparin saline, 25 mL of perfusate 1 containing EGTA, and then perfusate 2 containing collagenase. Hepatocytes were isolated by Percoll gradient and cultured in William’s E media (Gibco) with 10% FBS, and supplemented with insulin, dexamethasone, and pen/strep. Cells were plated on collagen coated dishes (Collagen solution, Cat. No. C8919), at 11–12 in the afternoon, and then media was exchanged 4 h after plating. Experiments were initiated the following morning at 8–10 a.m.

Hepatic glucose production

Primary hepatocytes isolated from Alb-Cre and SPT3-hKO littermate control mice were cultured normally in supplemented William’s E media. In the morning following harvest cells were serum starved for 3 h in DMEM after which media was aspirated, and cells were rinsed twice with DMEM containing no glucose, serum nor phenol after which this media was left on for 8 h. Glucose was quantified in the media by LC-MS/MS.

Cell treatments

Experiments on primary mouse hepatocytes were carried out in DMEM (Gibco,10-013-cv) with 10% FBS, and initiated at 8–10 the morning following isolation. Cells were treated with glucagon (Millipore/Sigma G2044), or pCPT-cAMP (Sigma C3912, 8-(4-Chlorophenylthio) adenosine 3′,5′-cyclic monophosphate sodium salt); all treatments were soluble in media with no need for additional vehicle.

Gene expression by qPCR

Cells were scraped from a 6-well dish into 0.2 mL Trizol, liver tissue was homogenized in 1 mL of Trizol per 20 mg of tissue. Tissue was homogenized by magnetic bead homogenizer at the maximum power setting for 3× 3min cycles, resting in an ice bath for 1 min between cycles. RNA was extracted by addition of 40 μL or 200 μL of chloroform for cells and tissue respectively. Sample mixtures were shaken 20 times by hand and then allowed to rest at room temperature for 3 min, and then centrifuged at 4°C for 10 min at 12 000 × g. The top layer containing extracted RNA was removed and cleaned up using the Qiagen RNAeasy kit, and then reverse transcribed using the Biorad iScript kit. A Sybr green protocol with a 58°C annealing temperature for 40 cycles was used with primers listed in the key resources table. Mean normalized expression was calculated relative to a reference gene panel consisting of βActin, TBP1 and HMBS1 using the ΔΔcq method.

Western blot

RIPA buffer containing Pierce protease and phosphatase inhibitors was added to liver tissues (50 mg/mL) or primary mouse hepatocytes (0.2 mL per well). Liver samples were homogenized with a magnetic bead homogenizer at the maximum power setting for 3× 3min cycles, resting in an ice bath for 1 min between cycles. Cell or tissue proteins were quantified by BCA and prepared in 4x Laemelli buffer at 1 mg/mL, and 15 μg was loaded per well of a 26-lane 4–15% BioRad Criterion gradient gel. Nitrocellulose membranes were blocked and then blotted in TBST with 5% milk or 5% BSA according to manufacturer’s recommended protocol at 1:1000 dilution. The following primary antibodies were acquired from Cell Signaling Technology: P-AKT (9271), P-AMPKα (#2535), PCK1 (D12F5, #12940), P-CREB (#9198). Anti-Rabbit mAb 12940 secondary antibody was used for all primaries at a 1:5000 dilution in TBST with 5% BSA.

Cyclic-AMP measurements

Cyclic AMP (cAMP) was measured in primary mouse hepatocytes by ELISA. Media was aspirated and 1mL of 0.1 M HCl was added per well, and then incubated 20 min at RT, scraped and collected, homogenized by pipet, and then centrifuged 1000 × g for 10min. Supernatants (750 μL) were collected, 1 mL of ELISA buffer was added, an aliquot was removed for quantification of protein by BCA, and then samples were stored at −80°C. Measurements were performed with an ELISA kit (Cayman 581001).

Plasma membrane isolation

Partially purified plasma membrane extracts were generated based on Suski et al.63 A set of 10, 100 mg liver sections from Alb-Cre and SPT3-hKO HFD mice were washed twice with 1 mL ice-cold starting buffer (250 mM mannitol, 75 mM sucrose, 30 mM Tris-HCl, pH 7.4), and then homogenized with 8–10 strokes in a manual Dounce homogenizer in 400 μL of isolation buffer (starting buffer plus 0.5% BSA and 0.5 mM EGTA). Homogenates were centrifuged at 800 × g for 5 min, the supernatant was collected in spun again at 800 × g for 5 min, and then an aliquot was collected and labeled ‘lysate’ for validation by Western blot. The supernatants were centrifuged at 10 000 × g for 10 min, the supernatant was collected in spun again at 10 000 × g for 10 min. Supernatants were then centrifuged at 25 000 × g for 20 min, resuspended in 400 μL of starting buffer, and then centrifuged again at 25 000 × g for 20 min. The supernatant was collected ‘supernatant’ sample for validation by Western blot The pellet was resuspended in 200 μL of Buffer A (100 mM Tris), and an aliquot was collected for ‘plasma membrane’ sample for validation by Western blot. Total protein was measured by BCA assay, and protein concentrations were equalized by dilution with Buffer A.

In vitro adenylate cyclase activity

Adenylyl cyclase activity in plasma membrane extracts was measured based on Marchmont et al.62 Cyclic-AMP was generated from ATP substrate in plasma membrane extracts with equalized protein concentration. The reaction buffer consisted of 2 mM MgCl2, 0.5 mM NaF, 2 mM pan-phosphodiesterase inhibitor 3-Isobutyl-1-methylxanthine (IBMX). Reactions were initiated by addition of 5 mM ATP, incubated at 37°C for 30 min, and then quenched by boiling for 1 min. Positive control, negative control, and sample blank (PC, NC, SB) were first prepared to measure the level of background and establish the dynamic range of the assay. The sample blank contained ATP substrate with no PM fraction, the NC contained PM fraction (pooled from all liver samples) with no substrate, and the PC contained the PM fraction, ATP, and the AC activator forskolin (Figure 3D). Positive and negative control samples were prepared using pooled plasma membrane extracts with 24 μM Forsklin with or without ATP substrate respectively. Sample blanks were prepared with reaction buffer components and ATP without PM extracts. Protein was precipitated in methanol and cAMP was quantified by LC-MS/MS.

In situ adenylate cyclase activity

Albumin-cre and SPTLC3-hKO littermate control mice were selected for primary hepatocyte isolation on day 0 of the treatment course. On day 1 cells were treated with 250 μM palmitate, myristate or the equivalent vehicle volume. Fatty acid stocks were prepared by conjugating to fatty acid free BSA. Fatty acid or vehicle (0.25% DMSO) were added to a 2% BSA solution and then sonicated in a bath sonicator for 15 min at 45°C. After 24 h of fatty acid treatment, fatty acid media was replaced with fresh media and inhibitors plus glucagon were added. Inhibitors were added to maintain the pool of fresh cAMP to ensure that the level of isotopically labeled cAMP was reflective of adenylate cyclase activity. The inhibitor cocktail consisted of the phosphodiesterase inhibitor 3-Isobutyl-1-methylxanthine (IBMX), and ATPase inhibitors digoxin and thapsigargin. Glucagon was delivered at 100 nM and inhibitors were delivered at 2 mM, 2 μM, and 200 nM respectively. Following a 30 min pre-treatment with glucagon plus inhibitors, 5 mM isotopically labeled ATP (adenosine-13C10,15N5, 5′-Triphosphate) was added for 30 min. The reaction was quenched by adding 80% methanol. Cells were scraped into 80% methanol and protein precipitate was collected for normalization by total protein. Isotopically labeled cAMP was quantified by LC-MS/MS.

Quantification of labeled cAMP by LC-MS/MS

Chemicals and reagents: Isotope labeling of cyclic AMP internal standard (HY-B1511S) and ATP (Cat 645702) were purchased from MedChemExpress (Monmouth Junction, NJ) and Sigma Aldrich (St. Louis, MO) with the minimal 95% purity or the highest available purity. Solvents used for metabolites extraction and liquid chromatography including hexafluora-2-isopropanol (HFLP), triethylamine (TEA), formic acid, acetonitrile, methanol and water were LC-MS grade from Fisher Scientific (Minneapolis, MN). Sample Treatment. A total of 450 μL cold methanol was added into 150 μL reaction solution, the protein was removed after centrifuge at 4°C for 10 min at 13000 rpm. The supernatant was dried in speed-vac concentrator (SPD 2010 Savant, Thermo) and reconstituted with 100 μL H2O. 5 μL was injected into the LC-MS/MS system. LC-MS/MS Measurement. The analysis of cyclic AMP, AMP, ADP and ATP were operated on an AB SCIEX (Foster City, CA) QTRAP 6500 system, which consists of an SHIMADZU Nexera ultra high-performance liquid chromatography system coupled with a hybrid triple quadrupole and ion trap mass spectrometer. Analyst 1.6 software was used for system control and data acquisition, and MultiQuant 3.0 software was used for data processing and quantitation. Cyclic AMP was separated with reverse-phase LC with Thermo Accucore Vanquish C18+ column (2.1 mm × 150 mm, 1.5μm). The Isocratic method was used with the mobile phase of 0.2% formic acid in water: acetonitrile (80 : 20) at the flow rate of 0.13 mL/min at 35°C for 6 min. Ion-paring method was applied to separate AMP, ADP and ATP with an Atlantis T3 column (2.1 mm × 100 mm, 3.0μm) at the flow rate of 0.5 mL/min at 30°C. 100 mM HFIP and 8.6 mM TEA in water (final pH, 8.3 ± 0.1) was optimized as mobile phase A, and 10% acetonitrile in mobile phase A was used as mobile phase B. LC gradients starts at 0% B for 0.5 min, reached 10% B at 8 min, ramped to 100% B at 13 min, hold for 1 min and dropped to initial 0% B at 14.1 min. A quality control of 1 μM standard was used to monitor the intensity variation of every 10 injections of samples. The mass spectrometric parameters of ionization polarity, product ion, collision energy (CE), decluttering potential (DP) and cell exit potential (CXP) of all metabolites were manually tuned and optimized for best sensitivity by direct infusion (below table). Multiple reaction monitoring (MRM) mode with the above optimal parameter were used for analysis with Ion Spray (IS) potential of 4500 V for negative mode with nebulizer gas (GS1) and bath gas (GS2) at 40 psi and 25 psi respectively. Curtain gas (CUR) was 30 psi, and collision gas (CAD) was set to medium level; source temperature (TEM) was 450°C. The dwell time for each transition was optimized ranging from 150 to 200 ms.75

MS/MS transitions and instrument parameters for key analytes

Metabolite Quadrupole 1 Quadrupole 3 Declustering Potential Collision Energy Collision Cell Exit Potential

cAMP 328.1 134.1 −80 −37 −10
Isotope cAMP from13C10,15N5 ATP 343.1 144.1 −80 −37 −10
13C5 cAMP internal standard 333.1 134.1 −80 −37 −10
ATP 506.1 407.8 −34 −32 −15
13C10,15N5 ATP 521.1 422.8 −34 −32 −15
ADP 426 327.8 −65 −24 −22
Isotope ADP from13C10,15N5 ATP 441 342.8 −65 −24 −22
AMP 346 78.8 −130 −70 −10
Isotope AMP from13C10,15N5 ATP 361 78.8 −130 −70 −10

Untargeted metabolomics

Primary mouse hepatocytes isolated from Alb-Cre and SPT3-hKO littermate controls were plated overnight and then harvested in ice-cold methanol and homogenized by sonication. The protein precipitate was removed by centrifugation and used for normalization. Metabolomics were carried out on a Thermoscientific Q Exactive HF OrbiTrap with a HILIC column, and data analysis was performed using Compound Discoverer software.

U13C-glutamine-labeled targeted metabolomics

Cells were serum starved for 3 h in DMEM after which media was aspirated, and cells were rinsed twice with DMEM containing no glucose, serum, glutamine or phenol. Cells were then treated with the same media containing 4 mM U13C-Glutamine for 8 h. Cells were harvested in 1 mL ice-cold methanol and then processed according to.76 Key metabolites were then assessed by LC-MS/MS according to.77

Post-treatment with bacterial sphingomyelinase

Primary hepatocytes were post-treated in 6 well dishes. Media was aspirated and replaced with 0.5 mL of 4% PFA, and fixed for 10 min at 37°C. Cells were then washed once with serum-free DMEM, and then treated with 1 mL of serum free DMEM or DMEM containing ≥0.1 units of bacterial sphingomyelinase (bSMase) and reacted for 10 min at 37°C. Media or bSMase was aspirated and then cells were harvested in ice-cold methanol according to the protocol for sphingolipid extraction.

Measurement of sphingolipids by LC-ESI-MS/MS

For tissue, 50 mg was homogenized in methanol by magnetic bead homogenizer at the maximum power setting for 3× 3 min cycles, resting in an ice bath for 1 min between cycles. Aliquots were removed diluted 10-fold in PBS for quantification by BCA assay. Protein content was equalized for all samples and then diluted into 2 mL of methanol. For hepatocytes, an equal number of cells isolated from Alb-Cre and SPT3-hKO littermate controls were harvested from 6-well tissue culture dishes. First, they were washed with ice-cold PBS and then harvested in 1 mL of ice-cold methanol and transferred to 13 × 100 mm borosilicate tubes containing 1 mL of ice-cold methanol. Internal standards are purchased from Avanti Polar Lipids (Alabaster, AL). An internal standard cocktail containing 250 pmol of sphingoid bases and sphingoid base 1-phosphates are 17-carbon chain length analogs: C17-sphingosine, (2S,3R,4E)-2-aminoheptadec-4-ene-1,3-diol (d17:1-So); C17-sphinganine, (2S,3R)-2-aminoheptadecane-1,3-diol (d17:0-Sa); C17-sphingosine 1-phosphate, heptadecasphing-4-enine-1-phosphate (d17:1-So1P); and C17-sphinganine 1-phosphate, heptadecasphinganine-1-phosphate (d17:0-Sa1P). Standards for N-acyl sphingolipids are C12-fatty acid analogs: C12-Cer, N-(dodecanoyl)-sphing-4-enine (d18:1/C12:0); C12-Cer1-phosphate, N-(dodecanoyl)-sphing-4-enine-1-phosphate (d18:1/C12:0-Cer1P); C12-sphingomyelin, N-(dodecanoyl)-sphing-4-enine-1-phosphocholine (d18:1/C12:0-SM); and C12-glucosylceramide, N-(dodecanoyl)-1-β-glucosyl-sphing-4-eine was added. Add 1 mL of CHCl3 was added to achieve methanol:chloroform at 2:1. Sphingolipids were measured by LC-ESI-MS/MS with a Sciex 5500 QTRAP (ABSciex, Farmingham, MA) equipped with a Supelco 2.1 (i.d.) × 50 mm Ascentis Express C18 column (Sigma, St. Louis, MO) as previously described.78 Following LC-MS/MS analysis total inorganic phosphate content of the final extract was quantified for normalization according to.79

Ceramides are readily identified by LC-MS/MS due to fact that first, there are few endogenous metabolites with overlapping mass to charge that coextract with ceramide, which simplifies separation by LC. Second, ceramide readily fragments at moderate collision energies at the sidechain linkage so that the d16 and d18-sphingoid bases illustrated in blue and orange respectively, fragment during tandem MS to reveal the identity of the sidechains illustrated in black and red (Figure 4A). Sphingomyelin however contains a choline group linked by a relatively unstable phosphodiester bond, which is cleaved at low MS/MS collision energies creating a product ion with a mass to charge potentially equal to two or more common ceramide regioisomers. This resulting product ion does not permit resolution of the backbone/sidechain regioisomer combination (Figure 4B). Additionally, taking full advantage of chromatographic separation to aid in accurate sphingomyelin peak identification is complicated by overlapping mass to charge with other abundant and readily ionizable lipid species, especially phosphatidylcholine. For routine measurement of the abundant and easily ionizable d18-based sphingomyelins, these limitations are not a major obstacle especially for samples where non-canonical sphingolipid products can be neglected. However, to identify key SPTLC3-dependent species accurate quantification of the less abundant d16-sphingomyelins is critical. One work-around is a pseudo MS3 approach.80 By taking advantage of the ion trapping capability of the Qtrap instrument cleavage products are produced that yield backbone information. However, the limitations of this approach are that first it is not routinely employed, and thus requires additional validation. The second and the major limitation is that there is a substantial loss of sensitivity, and loss of sensitivity is a major obstacle for study of the generally the lower abundance d16-sphingomyelins.

Normalization of lipidomics

One-fourth of the Bligh Dyer lipid was placed it in a clean glass tube. Sample were ashed overnight at 160°C in 600 μL of ashing solution alongside standards. Total phosphate was quantified by OD600 following addition of 0.9 mL water, 0.5 mL 0.9% ammonium molybdate, 200 μL 9.0% ascorbic acid and then incubating at 45°C for 30 min.

QUANTIFICATION AND STATISTICAL ANALYSIS

P-values, where indicated, were calculated by a 2-tailed Student’s t-test or ANOVA followed by Dunnett’s multiple comparisons test, where multiple groups were present. Mouse weight data fitted with a linear mixed model with 8 groups defined by combinations of gender, mutation, and diet and interactions of these groups with weeks. P-values for estimated differences in slope were corrected for multiple testing via Tukey correction.

Supplementary Material

1

Highlights.

  • A hepatic SPTLC3 knockout (SPTLC3-hKO) is found to have suppressed hepatic gluconeogenesis

  • SPTLC3-hKO is depleted in d16-based sphingomyelin at the plasma membrane (PM)

  • SPTLC3 expression is required to sustain wild-type levels of PM adenylate cyclase activity

ACKNOWLEDGMENTS

The authors would like to acknowledge the following funding sources: the McGuire Institute and Virginia Commonwealth University joint pilot program award to D.M., which led to the awarding of NIAAA R21AAs029518 to D.M. and L.A.C, 5R01HL117233 awarded to L.A.C, and I01BX0002000-12A1 and IK6BX006315-02 awarded to L.A.C by Veterans’ Affairs. Graphics were produced using BioRender.

Footnotes

DECLARATION OF INTERESTS

The authors declare no competing interests.

SUPPLEMENTAL INFORMATION

Supplemental information can be found online at https://doi.org/10.1016/j.celrep.2024.115054.

REFERENCES

  • 1.Zama K, Mitsutake S, Okazaki T, and Igarashi Y (2018). Sphingomyelin in microdomains of the plasma membrane regulates amino acid-stimulated mTOR signal activation. Cell Biol. Int. 42, 823–831. 10.1002/CBIN.10941. [DOI] [PubMed] [Google Scholar]
  • 2.Kim MH, Park JW, Lee EJ, Kim S, Shin SH, Ahn JH, Jung Y, Park I, and Park WJ (2018). C16-ceramide and sphingosine 1-phosphate/S1PR2 have opposite effects on cell growth through mTOR signaling pathway regulation. Oncol. Rep. 40, 2977–2987. 10.3892/OR.2018.6689. [DOI] [PubMed] [Google Scholar]
  • 3.Teruel T, Hernandez R, and Lorenzo M (2001). Ceramide mediates insulin resistance by tumor necrosis factor-alpha in brown adipocytes by maintaining Akt in an inactive dephosphorylated state. Diabetes 50, 2563–2571. 10.2337/DIABETES.50.11.2563. [DOI] [PubMed] [Google Scholar]
  • 4.Sajan MP, Ivey RA, Lee MC, and Farese RV (2015). Hepatic insulin resistance in ob/ob mice involves increases in ceramide, aPKC activity, and selective impairment of Akt-dependent FoxO1 phosphorylation. J. Lipid Res. 56, 70–80. 10.1194/JLR.M052977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zanieri F, Levi A, Montefusco D, Longato L, De Chiara F, Frenguelli L, Omenetti S, Andreola F, Luong TV, Massey V, et al. (2020). Exogenous Liposomal Ceramide-C6 Ameliorates Lipidomic Profile, Energy Homeostasis, and Anti-Oxidant Systems in NASH. Cells 9, 1237. 10.3390/CELLS9051237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Lee TY, Lu WJ, Changou CA, Hsiung YC, Trang NTT, Lee CY, Chang TH, Jayakumar T, Hsieh CY, Yang CH, et al. (2021). Platelet autophagic machinery involved in thrombosis through a novel linkage of AMPK-MTOR to sphingolipid metabolism. Autophagy 17, 4141–4158. 10.1080/15548627.2021.1904495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Sharma AX, Quittner-Strom EB, Lee Y, Johnson JA, Martin SA, Yu X, Li J, Lu J, Cai Z, Chen S, et al. (2018). Glucagon Receptor Antagonism Improves Glucose Metabolism and Cardiac Function by Promoting AMP-Mediated Protein Kinase in Diabetic Mice. Cell Rep. 22, 1760–1773. 10.1016/J.CELREP.2018.01.065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Makdissy N, Haddad K, Mouawad C, Popa I, Younsi M, Valet P, Brunaud L, Ziegler O, and Quilliot D (2015). Regulation of SREBPs by Sphingomyelin in Adipocytes via a Caveolin and Ras-ERK-MAPKCREB Signaling Pathway. PLoS One 10, e0133181. 10.1371/JOURNAL.PONE.0133181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Worgall TS (2011). Sphingolipid synthetic pathways are major regulators of lipid homeostasis. Adv. Exp. Med. Biol. 721, 139–148. 10.1007/978-1-4614-0650-1_9. [DOI] [PubMed] [Google Scholar]
  • 10.Lucki N, and Sewer MB (2009). The cAMP-responsive element binding protein (CREB) regulates the expression of acid ceramidase (ASAH1) in H295R human adrenocortical cells. Biochim. Biophys. Acta 1791, 706–713. 10.1016/J.BBALIP.2009.03.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Mathieson FA, and Nixon GF (2006). Sphingolipids differentially regulate mitogen-activated protein kinases and intracellular Ca2+ in vascular smooth muscle: effects on CREB activation. Br. J. Pharmacol. 147, 351–359. 10.1038/SJ.BJP.0706600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Edinger AL (2009). Starvation in the midst of plenty: making sense of ceramide-induced autophagy by analysing nutrient transporter expression. Biochem. Soc. Trans. 37, 253–258. 10.1042/BST0370253. [DOI] [PubMed] [Google Scholar]
  • 13.Pilátová MB, Solárová Z, Mezencev R, and Solár P (2023). Ceramides and their roles in programmed cell death. Adv. Med. Sci. 68, 417–425. 10.1016/J.ADVMS.2023.10.004. [DOI] [PubMed] [Google Scholar]
  • 14.Kartsoli S, Kostara CE, Tsimihodimos V, Bairaktari ET, and Christodoulou DK (2020). Lipidomics in non-alcoholic fatty liver disease. World J. Hepatol. 12, 436–450. 10.4254/WJH.V12.I8.436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Pagadala M, Kasumov T, McCullough AJ, Zein NN, and Kirwan JP (2012). Role of ceramides in nonalcoholic fatty liver disease. Trends Endocrinol. Metab. 23, 365–371. 10.1016/J.TEM.2012.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Bikman BT, and Summers SA (2011). Sphingolipids and hepatic steatosis. Adv. Exp. Med. Biol. 721, 87–97. 10.1007/978-1-4614-0650-1_6. [DOI] [PubMed] [Google Scholar]
  • 17.Li Y, Lu Z, Ru JH, Lopes-Virella MF, Lyons TJ, and Huang Y (2018). Saturated fatty acid combined with lipopolysaccharide stimulates a strong inflammatory response in hepatocytes in vivo and in vitro. Am. J. Physiol. Endocrinol. Metab. 315, E745–E757. 10.1152/AJPENDO.00015.2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Choi S, and Snider AJ (2015). Sphingolipids in High Fat Diet and Obesity-Related Diseases. Mediators Inflamm. 2015, 520618. 10.1155/2015/520618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Clark AJ, Kugathasan U, Baskozos G, Priestman DA, Fugger N, Lone MA, Othman A, Chu KH, Blesneac I, Wilson ER, et al. (2021). An iPSC model of hereditary sensory neuropathy-1 reveals L-serine-responsive deficits in neuronal ganglioside composition and axoglial interactions. Cell Rep. Med. 2, 100345. 10.1016/J.XCRM.2021.100345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wilson LMQ, Saba S, Li J, Prasov L, and Miller JML (2023). Specific Deoxyceramide Species Correlate with Expression of Macular Telangiectasia Type 2 (MacTel2) in a SPTLC2 Carrier HSAN1 Family. Genes 14, 931. 10.3390/GENES14040931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Saba S, Chen Y, Maddipati KR, Hackett M, Hu B, and Li J (2020). Demyelination in hereditary sensory neuropathy type-1C. Ann. Clin. Transl. Neurol. 7, 1502–1512. 10.1002/ACN3.51110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Srivastava S, Shaked HM, Gable K, Gupta SD, Pan X, Somashekarappa N, Han G, Mohassel P, Gotkine M, Doney E, et al. (2023). SPTSSA variants alter sphingolipid synthesis and cause a complex hereditary spastic paraplegia. Brain 146, 1420–1435. 10.1093/BRAIN/AWAC460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Merrill AH (1983). Characterization of serine palmitoyltransferase activity in Chinese hamster ovary cells. Biochim. Biophys. Acta 754, 284–291. 10.1016/0005-2760(83)90144-3. [DOI] [PubMed] [Google Scholar]
  • 24.Hornemann T, Penno A, Rütti MF, Ernst D, Kivrak-Pfiffner F, Rohrer L, and von Eckardstein A (2009). The SPTLC3 subunit of serine palmitoyltransferase generates short chain sphingoid bases. J. Biol. Chem. 284, 26322–26330. 10.1074/JBC.M109.023192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Russo SB, Tidhar R, Futerman AH, and Cowart LA (2013). Myristate-derived d16:0 sphingolipids constitute a cardiac sphingolipid pool with distinct synthetic routes and functional properties. J. Biol. Chem. 288, 13397–13409. 10.1074/JBC.M112.428185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kovilakath A, Mauro AG, Valentine YA, Raucci F, Jamil M, Carter C, Thompson J, Chen Q, Gisela B, Yue Y, et al. (2024). SPTLC3 Is Essential for Complex I Activity and Contributes to Ischemic Cardiomyopathy. Circulation 150, 622. 10.1161/CIRCULATIONAHA.123.066879/SUPPL_FILE/CIRC_CIRCULATIONAHA-2023-066879_SUPP3.PDF. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lee S, Kim SA, Kim Y, Kim J, Hong G, Hong J, Choi K, Eom CS, Baik S, Lee MK, and Lee KR (2022). Genetic Variants Associated with Elevated Plasma Ceramides in Individuals with Metabolic Syndrome. Genes 13, 1497. 10.3390/GENES13081497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Xing J, Wang Y, Zhao X, Li J, Hou R, Niu X, Yin G, Li X, and Zhang K (2022). Variants in PRKCE and KLC1, Potential Regulators of Type I Psoriasis. Clin. Cosmet. Investig. Dermatol. 15, 1237–1245. 10.2147/CCID.S371719. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Chai T, Wang Z, Yang X, Qiu Z, and Chen L (2022). PSRC1 May Affect Coronary Artery Disease Risk by Altering CELSR2, PSRC1, and SORT1 Gene Expression and Circulating Granulin and Apolipoprotein B Protein Levels. Front. Cardiovasc. Med. 9, 763015. 10.3389/FCVM.2022.763015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Piccolo BD, Graham JL, Kang P, Randolph CE, Shankar K, Yeruva L, Fox R, Robeson MS, Moody B, LeRoith T, et al. (2021). Progression of diabetes is associated with changes in the ileal transcriptome and ileal-colon morphology in the UC Davis Type 2 Diabetes Mellitus rat. Physiol. Rep. 9, e15102. 10.14814/PHY2.15102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Harshfield EL, Fauman EB, Stacey D, Paul DS, Ziemek D, Ong RMY, Danesh J, Butterworth AS, Rasheed A, Sattar T, et al. (2021). Genome-wide analysis of blood lipid metabolites in over 5000 South Asians reveals biological insights at cardiometabolic disease loci. BMC Med. 19, 232. 10.1186/S12916-021-02087-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Luo C, Liu H, Wang X, Xia L, Huang H, Peng X, Xia C, and Liu L (2021). The associations between individual plasma SFAs, serine palmitoyl-transferase long-chain base subunit 3 gene rs680379 polymorphism, and type 2 diabetes among Chinese adults. Am. J. Clin. Nutr. 114, 704–712. 10.1093/AJCN/NQAB102. [DOI] [PubMed] [Google Scholar]
  • 33.McGurk KA, Williams SG, Guo H, Watkins H, Farrall M, Cordell HJ, Nicolaou A, and Keavney BD (2021). Heritability and family-based GWAS analyses of the N-acyl ethanolamine and ceramide plasma lipidome. Hum. Mol. Genet. 30, 500–513. 10.1093/HMG/DDAB002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Cresci S, Zhang R, Yang Q, Duncan MS, Xanthakis V, Jiang X, Vasan RS, Schaffer JE, and Peterson LR (2020). Genetic Architecture of Circulating Very-Long-Chain (C24:0 and C22:0) Ceramide Concentrations. J. Lipid Atheroscler. 9, 172–183. 10.12997/JLA.2020.9.1.172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Tabassum R, Rämö JT, Ripatti P, Koskela JT, Kurki M, Karjalainen J, Palta P, Hassan S, Nunez-Fontarnau J, Kiiskinen TTJ, et al. (2019). Genetic architecture of human plasma lipidome and its link to cardiovascular disease. Nat. Commun. 10, 4329. 10.1038/S41467-019-11954-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Teng W, Li Y, Du M, Lei X, Xie S, and Ren F (2019). Sulforaphane Prevents Hepatic Insulin Resistance by Blocking Serine Palmitoyltransferase 3-Mediated Ceramide Biosynthesis. Nutrients 11, 1185. 10.3390/NU11051185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Shahin MH, Gong Y, Frye RF, Rotroff DM, Beitelshees AL, Baillie RA, Chapman AB, Gums JG, Turner ST, Boerwinkle E, et al. (2017). Sphingolipid Metabolic Pathway Impacts Thiazide Diuretics Blood Pressure Response: Insights From Genomics, Metabolomics, and Lipidomics. J. Am. Heart Assoc. 7, e006656. 10.1161/JAHA.117.006656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Dong YQ, Zhang XZ, Sun LL, Zhang SY, Liu B, Liu HY, Wang X, and Jiang CT (2017). Omega-3 PUFA ameliorates hyperhomocysteinemia-induced hepatic steatosis in mice by inhibiting hepatic ceramide synthesis. Acta Pharmacol. Sin. 38, 1601–1610. 10.1038/APS.2017.127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Zhang QH, Yin RX, Gao H, Huang F, Wu JZ, Pan SL, Lin WX, and Yang DZ (2017). Association of the SPTLC3 rs364585 polymorphism and serum lipid profiles in two Chinese ethnic groups. Lipids Health Dis. 16, 1. 10.1186/s12944-016-0392-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Lemaitre RN, King IB, Kabagambe EK, Wu JHY, McKnight B, Manichaikul A, Guan W, Sun Q, Chasman DI, Foy M, et al. (2015). Genetic loci associated with circulating levels of very long-chain saturated fatty acids. J. Lipid Res. 56, 176–184. 10.1194/jlr.M052456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Cinar R, Godlewski G, Liu J, Tam J, Jourdan T, Mukhopadhyay B, Harvey-White J, and Kunos G (2014). Hepatic cannabinoid-1 receptors mediate diet-induced insulin resistance by increasing de novo synthesis of long-chain ceramides. Hepatology 59, 143–153. 10.1002/HEP.26606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Mirkov S, Myers JL, Ramírez J, and Liu W (2012). SNPs affecting serum metabolomic traits may regulate gene transcription and lipid accumulation in the liver. Metabolism 61, 1523–1527. 10.1016/J.METABOL.2012.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Illig T, Gieger C, Zhai G, Römisch-Margl W, Wang-Sattler R, Prehn C, Altmaier E, Kastenmüller G, Kato BS, Mewes HW, et al. (2010). A genome-wide perspective of genetic variation in human metabolism. Nat. Genet. 42, 137–141. 10.1038/NG.507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Hicks AA, Pramstaller PP, Johansson A, Vitart V, Rudan I, Ugocsai P, Aulchenko Y, Franklin CS, Liebisch G, Erdmann J, et al. (2009). Genetic determinants of circulating sphingolipid concentrations in European populations. PLoS Genet. 5, e1000672. 10.1371/JOURNAL.PGEN.1000672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Demirkan A, van Duijn CM, Ugocsai P, Isaacs A, Pramstaller PP, Liebisch G, Wilson JF, Johansson Å, Rudan I, Aulchenko YS, et al. (2012). Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. PLoS Genet. 8, e1002490. 10.1371/JOURNAL.PGEN.1002490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Willer CJ, Schmidt EM, Sengupta S, Peloso GM, Gustafsson S, Kanoni S, Ganna A, Chen J, Buchkovich ML, Mora S, et al. (2013). Discovery and refinement of loci associated with lipid levels. Nat. Genet. 45, 1274–1283. 10.1038/NG.2797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Chew WS, Torta F, Ji S, Choi H, Begum H, Sim X, Khoo CM, Khoo EYH, Ong WY, Van Dam RM, et al. (2019). Large-scale lipidomics identifies associations between plasma sphingolipids and T2DM incidence. JCI Insight 5, e126925. 10.1172/JCI.INSIGHT.126925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Yoshimine Y, Uto H, Kumagai K, Mawatari S, Arima S, Ibusuki R, Mera K, Nosaki T, Kanmura S, Numata M, et al. (2015). Hepatic expression of the Sptlc3 subunit of serine palmitoyltransferase is associated with the development of hepatocellular carcinoma in a mouse model of nonalcoholic steatohepatitis. Oncol. Rep. 33, 1657–1666. 10.3892/or.2015.3745. [DOI] [PubMed] [Google Scholar]
  • 49.Hicks AA, Pramstaller PP, Johansson A, Vitart V, Rudan I, Ugocsai P, Aulchenko Y, Franklin CS, Liebisch G, Erdmann J, et al. (2009). Genetic determinants of circulating sphingolipid concentrations in European populations. PLoS Genet. 5, e1000672. 10.1371/journal.pgen.1000672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Ijuin S, Oda K, Mawatari S, Taniyama O, Toyodome A, Sakae H, Tabu K, Kumagai K, Kanmura S, Tamai T, et al. (2022). Serine palmitoyltransferase long chain subunit 3 is associated with hepatocellular carcinoma in patients with NAFLD. Mol. Clin. Oncol. 16, 55. 10.3892/MCO.2021.2488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Federiuk C, and Shafer J (1981). Inactivation of D-serine dehydratase by alkylamines via a transimination of enzyme-linked cofactor. J. Biol. Chem. 256, 7416–7423. [PubMed] [Google Scholar]
  • 52.Arendt BM, Comelli EM, Ma DWL, Lou W, Teterina A, Kim T, Fung SK, Wong DKH, Mcgilvray I, Fischer SE, and Allard JP (2015). Altered hepatic gene expression in nonalcoholic fatty liver disease is associated with lower hepatic n-3 and n-6 polyunsaturated fatty acids. Hepatology 61, 1565–1578. 10.1002/HEP.27695. [DOI] [PubMed] [Google Scholar]
  • 53.Natali A, and Ferrannini E (2006). Effects of metformin and thiazolidinediones on suppression of hepatic glucose production and stimulation of glucose uptake in type 2 diabetes: a systematic review. Diabetologia 49, 434–441. 10.1007/S00125-006-0141-7. [DOI] [PubMed] [Google Scholar]
  • 54.Franconi F, Seghieri G, Canu S, Straface E, Campesi I, and Malorni W (2008). Are the available experimental models of type 2 diabetes appropriate for a gender perspective? Pharmacol. Res. 57, 6–18. 10.1016/J.PHRS.2007.11.007. [DOI] [PubMed] [Google Scholar]
  • 55.Rees DA, and Alcolado JC (2005). Animal models of diabetes mellitus. Diabet. Med. 22, 359–370. 10.1111/J.1464-5491.2005.01499.X. [DOI] [PubMed] [Google Scholar]
  • 56.Jang C, Chen L, and Rabinowitz JD (2018). Metabolomics and Isotope Tracing. Cell 173, 822–837. 10.1016/J.CELL.2018.03.055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Xu H, Wang Y, Kwon H, Shah A, Kalemba K, Su X, He L, and Wondisford FE (2022). Glucagon changes substrate preference in gluconeogenesis. J. Biol. Chem. 298, 102708. 10.1016/J.JBC.2022.102708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Ortiz V, Alemán G, Escamilla-Del-Arenal M, Recillas-Targa F, Torres N, and Tovar AR (2011). Promoter characterization and role of CRE in the basal transcription of the rat SNAT2 gene. Am. J. Physiol. Endocrinol. Metab. 300, E1092–E1102. 10.1152/ajpendo.00459.2010. [DOI] [PubMed] [Google Scholar]
  • 59.Zaccolo M, Zerio A, and Lobo MJ (2021). Subcellular Organization of the cAMP Signaling Pathway. Pharmacol. Rev. 73, 278–309. 10.1124/PHARMREV.120.000086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Salesse R, and Garnier J (1984). Adenylate cyclase and membrane fluidity. The repressor hypothesis. Mol. Cell. Biochem. 60, 17–31. 10.1007/BF00226298. [DOI] [PubMed] [Google Scholar]
  • 61.Whetton AD, Needham L, Margison GP, Dodd NJ, and Houslay MD (1984). Dimethylnitrosamine inhibits the glucagon-stimulated adenylate cyclase activity of rat liver plasma membranes and decreases plasma membrane fluidity. Biochim. Biophys. Acta 773, 106–112. 10.1016/0005-2736(84)90555-8. [DOI] [PubMed] [Google Scholar]
  • 62.Gordon LM, Sauerheber RD, Esgate JA, Dipple I, Marchmont RJ, and Houslay MD (1980). The increase in bilayer fluidity of rat liver plasma membranes achieved by the local anesthetic benzyl alcohol affects the activity of intrinsic membrane enzymes. J. Biol. Chem. 255, 4519–4527. [PubMed] [Google Scholar]
  • 63.Suski JM, Lebiedzinska M, Wojtala A, Duszynski J, Giorgi C, Pinton P, and Wieckowski MR (2014). Isolation of plasma membrane-associated membranes from rat liver. Nat. Protoc. 9, 312–322. 10.1038/NPROT.2014.016. [DOI] [PubMed] [Google Scholar]
  • 64.Huang C, Hepler JR, Chen LT, Gilman AG, Anderson RG, and Mumby SM (1997). Organization of G proteins and adenylyl cyclase at the plasma membrane. Mol. Biol. Cell 8, 2365–2378. 10.1091/MBC.8.12.2365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Dipple I, and Houslay MD (1978). The activity of glucagon-stimulated adenylate cyclase from rat liver plasma membranes is modulated by the fluidity of its lipid environment. Biochem. J. 174, 179–190. 10.1042/BJ1740179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Hurley JH (1998). The adenylyl and guanylyl cyclase superfamily. Curr. Opin. Struct. Biol. 8, 770–777. 10.1016/S0959-440X(98)80097-3. [DOI] [PubMed] [Google Scholar]
  • 67.Van Sluijters DA, Van Woerkom GM, Aerts JM, and Meijer AJ (1999). Sphingomyelinase treatment of rat hepatocytes inhibits cell-swelling-stimulated glycogen synthesis by causing cell shrinkage. Eur. J. Biochem. 266, 653–659. 10.1046/J.1432-1327.1999.00914.X. [DOI] [PubMed] [Google Scholar]
  • 68.Li Z, Zhang H, Liu J, Liang C-P, Li Y, Li Y, Teitelman G, Beyer T, Bui HH, Peake DA, et al. (2011). Reducing plasma membrane sphingomyelin increases insulin sensitivity. Mol. Cell Biol. 31, 4205–4218. 10.1128/MCB.05893-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Nikolova-Karakashian M (2018). Sphingolipids at the Crossroads of NAFLD and Senescence. Adv. Cancer Res. 140, 155–190. 10.1016/BS.ACR.2018.05.002. [DOI] [PubMed] [Google Scholar]
  • 70.Sydor S, Sowa JP, Megger DA, Schlattjan M, Jafoui S, Wingerter L, Carpinteiro A, Baba HA, Bechmann LP, Sitek B, et al. (2017). Acid sphingomyelinase deficiency in Western diet-fed mice protects against adipocyte hypertrophy and diet-induced liver steatosis. Mol. Metab. 6, 416–427. 10.1016/J.MOLMET.2017.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Greene M, Hernandez-Corbacho MJ, Ostermeyer-Fay AG, Hannun YA, and Canals D (2023). A simple, highly sensitive, and facile method to quantify ceramide at the plasma membrane. J. Lipid Res. 64, 100322. 10.1016/J.JLR.2022.100322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Abdel Motaal A, Tews I, Schultz JE, and Linder JU (2006). Fatty acid regulation of adenylyl cyclase Rv2212 from Mycobacterium tuberculosis H37Rv. FEBS J. 273, 4219–4228. 10.1111/J.1742-4658.2006.05420.X. [DOI] [PubMed] [Google Scholar]
  • 73.Findeisen F, Linder JU, Schultz A, Schultz JE, Brügger B, Wieland F, Sinning I, and Tews I (2007). The structure of the regulatory domain of the adenylyl cyclase Rv1264 from Mycobacterium tuberculosis with bound oleic acid. J. Mol. Biol. 369, 1282–1295. 10.1016/J.JMB.2007.04.013. [DOI] [PubMed] [Google Scholar]
  • 74.Poggel C, Adams T, Janzen R, Hofmann A, Hardt O, Roeb E, Schröder SK, Tag CG, Roderfeld M, and Weiskirchen R (2022). Isolation of Hepatocytes from Liver Tissue by a Novel, Semi-Automated Perfusion Technology. Biomedicines 10, 2198. 10.3390/BIOMEDICINES10092198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Yue Y, Bao X, Jiang J, and Li J (2022). Evaluation and correction of injection order effects in LC-MS/MS based targeted metabolomics. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 1212, 123513. 10.1016/J.JCHROMB.2022.123513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Lu W, Su X, Klein MS, Lewis IA, Fiehn O, and Rabinowitz JD (2017). Metabolite Measurement: Pitfalls to Avoid and Practices to Follow. Annu. Rev. Biochem. 86, 277–304. 10.1146/ANNUREV-BIOCHEM-061516-044952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Hui S, Ghergurovich JM, Morscher RJ, Jang C, Teng X, Lu W, Esparza LA, Reya T, Zhan L, Yanxiang Guo J, et al. (2017). Glucose feeds the TCA cycle via circulating lactate. Nature 551, 115–118. 10.1038/NATURE24057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Shaner RL, Allegood JC, Park H, Wang E, Kelly S, Haynes CA, Sullards MC, and Merrill AH Jr. (2009). Quantitative analysis of sphingolipids for lipidomics using triple quadrupole and quadrupole linear ion trap mass spectrometers. J. Lipid Res. 50, 1692–1707. 10.1194/jlr.D800051-JLR200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Van Veldhoven PP, and Bell RM (1988). Effect of harvesting methods, growth conditions and growth phase on diacylglycerol levels in cultured human adherent cells. Biochim. Biophys. Acta 959, 185–196. 10.1016/0005-2760(88)90030-6. [DOI] [PubMed] [Google Scholar]
  • 80.Chen Y., Allegood J., Liu Y., Wang E., Cachón-Gonzalez B., Cox TM., Merrill AH., and Sullards MC. (2008). Imaging MALDI mass spectrometry using an oscillating capillary nebulizer matrix coating system and its application to analysis of lipids in brain from a mouse model of Tay-Sachs/Sandhoff disease. Anal. Chem. 80, 2780–2788. 10.1021/AC702350G. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

Data Availability Statement

  • The accession number for the raw untargeted metabolomics data can be found in the key resources table.

  • No new code was generated for this manuscript.

  • Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

KEY RESOURCES TABLE.

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Phospho-Akt (Ser473) Antibody Cell Signaling Technology RRID:AB_329825
Phospho-AMPKα (Thr172) Cell Signaling Technology 5256
PCK1 (D12F5) Rabbit mAb Cell Signaling Technology RRID:AB_2687968
Phospho-CREB (Ser133) (87G3) Rabbit mAb Cell Signaling Technology RRID:AB_2561044
Na,K-ATPase α1 Cell Signaling Technology RRID:AB_2798866

Chemicals, peptides, and recombinant proteins

Glucagon Millipore/Sigma G2044
pCPT-cAMP Millipore/Sigma C3912
IBMX Millipore/Sigma I5879
Thapsigargin R&D Biothechne 1138
Digoxin R&D Biothechne 4583
Sphingomyelinase From Bacillus Cereus Millipore/Sigma S9396
Adenosine 5’-Triphosphate Millipore/Sigma A-2383
adenosine-13 C10,15N5, 5′-Triphosphate Millipore/Sigma 645702
cyclic AMP MedChemExpress HY-B1511S
ATP MedChemExpress 645702
U13C-Glutamine Cambridge Isotopes CLM-1822

Critical commercial assays

Liver Glycogen Abcam ab65620
Mouse Insulin ELISA kit Crystal Chem 90080
cAMP ELISA Cayman 581001

Deposited data

Raw data can be found at: Montefusco, David, 2024, “SPLTC3 in Fatty Liver Disease” Harvard Dataverse, V1. https://doi.org/10.7910/DVN/SMNKQP

Experimental models: Organisms/strains

Albumin Cre B6.Cg-Speer6-ps1Tg(Alb-cre)21Mgn/J Jackson Laboratories RRID:IMSR_JAX:003574
SPTLC3 conditional knockout mouse model Our laboratory SPTLC3-flox

Oligonucleotides

PCK1_forward Eurofins CTCAGCTGCATA ACGGTCTG
PCK1 reverse Eurofins CTTCAGCTTGCG GATGACAC
G6PC forward Eurofins TTGCATTCCTGTATGGTAGTGG
G6PC reverse Eurofins TAGGCTGAGGAGGAGAAAACTG
GLUT2 forward Eurofins AATGGTCGCCTCATTCTTTG
GLUT2 reverse Eurofins ATCAAGAGGGCTCCAGTCAA
SNAT2 forward Eurofins GCAGTGGAATCCTTGGGCTT
SNAT2 reverse Eurofins ATAAAGACCCTCCTTCATTGGCA
SNAT3 forward Eurofins TCGGCTACCTGGGTTACTC
SNAT3 reverse Eurofins GGGAACAGAACAATCGGAACTG
SNAT4 forward Eurofins CCTCGTGCCTACCAT CAAATAC
SNAT4 reverse Eurofins AGACCAAAGCCCCAATCTTC
TNFα forward Eurofins TTGCTCTGTGAAGGGAAATGG
TNFα reverse Eurofins CCTGAGCCATAATCCCCTTTC
MCP1 forward Eurofins TTAAAAACCTGGATCGGAACCAA
MCP1 reverse Eurofins GCATTAGCTTCAGATTTACGGGT
IL6 forward Eurofins TAGTCCTTCCTACCCCAATTTCC
IL6 reverse Eurofins TTGGTCCTTAGCCACTCCTTC
IL10 forward Eurofins TGAATTCCCTGGGTGAGAAGC
IL10 reverse Eurofins CACCTTGGTCTTGGA GCTTATT

RESOURCES