Abstract
DNA extraction is a fundamental technique in molecular biology. For Chimonanthus praecox—a winter-flowering tree species—extensive and rapid DNA extraction is necessary to support genetic analyses. Currently, DNA extraction in C. praecox primarily relies on the traditional cetyltrimethylammonium bromide (CTAB) method, which is time-consuming and labor-intensive, hindering large-scale DNA extraction work. In this study, the different steps in the CTAB method are compared and evaluated to optimize the C. praecox leaf DNA extraction process. The water bath duration significantly impacts DNA extraction efficiency; the longer the water bath, the higher the DNA concentration. However, a 10-min water bath is sufficient to yield DNA of ideal concentration and purity. Additionally, a single extraction step is appropriate, with a 10-min precipitation at − 20 °C yielding high-quality DNA. Additionally, the pre-treatment step was modified by using a frozen pipette tip to crush samples directly in a centrifuge tube, reducing operational complexity and minimizing liquid nitrogen and sample consumption. Only 25 mg of sample is required, and high-quality DNA from C. praecox leaves can be extracted within 1 h. The amounts of required sample and liquid nitrogen were reduced by 75% and 90%, respectively. Moreover, the time required for the simplified extraction step was reduced by 77.14%. The applicability of the simplified scheme was evaluated using different C. praecox tissues, Calycanthaceae family members, and species of other families. The simplified scheme extracted DNA from the tepals and leaves of C. praecox with higher concentration purity. However, this protocol was biased toward the Chimonanthus family, Nicotiana tabacum, Populus tomentosa, and Lilium brownii. The proposed method enables the rapid and efficient extraction of high-quality DNA from 25 mg of plant leaves and is suitable for multiple species. This method reduces sample and liquid nitrogen consumption, lowering costs while significantly shortening the procedure time and enhancing extraction efficiency. This method is highly suitable for applications involving the extraction of large amounts of low-concentration DNA across various plant species.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-025-94822-4.
Keywords: DNA extraction, Chimonanthus family, CTAB method, Cost reduction, Efficiency improvement
Subject terms: Behavioural methods; Experimental organisms; Isolation, separation and purification
Introduction
Nucleic acid analysis has become a primary tool for botanists to address a wide range of scientific questions across myriad disciplines, including population genetics, biogeography, ecology, developmental biology, microbiology, physiology, and phylogenetics1–3. DNA extraction is a fundamental component of genetic research4. With the increased adoption of “next-generation” or “high-throughput” sequencing, associated costs have dropped significantly, leading to a surge in plant research utilizing DNA or RNA data5,6. Rapid and pure DNA extraction is a requisite for most advanced applications7,8 and functional genomics analyses9,10. The basic principles of DNA extraction typically involve breaking down plant tissue (through simple crushing or deep grinding); lysing cell membranes with chemical reagents or heat to release genomic DNA; removing histones bound to DNA through chemical reagents or centrifugation; precipitating nucleic acids using pre-chilled reagents like isopropanol, sodium acetate, or potassium acetate; purifying DNA samples; and isolating the plant genomic DNA11–13.
Various methods exist for isolating DNA from plant tissues; however, many yield DNA in low quantities or with inconsistent quality7. In particular, cetyltrimethylammonium bromide (CTAB) has been used to extract DNA from plants for over 70 years. Its application was promoted by Jeff and Jane Doyle, who demonstrated its effectiveness in achieving rapid, inexpensive, and relatively high-throughput DNA extraction with minimal input tissue while also outlining how to optimize it for different individual species14–17. While many commercial kits claim to rapidly extract high-purity DNA, they have been outperformed in some studies by CTAB, yielding higher quantities and, in most cases, higher-quality DNA11 with lower extraction costs per run18. Hence, the CTAB method remains the most reliable and cost-effective nucleic acid extraction method19. However, it is limited by the requirement for repeated centrifugation and precipitation, making the procedure cumbersome and time-consuming, taking 3 to 4 h. Moreover, the reagents used in this method are highly toxic, and prolonged exposure can cause varying degrees of harm to human health7,18,20,21.
Before DNA extraction, plant samples—whether fresh or preserved in other ways—typically need to be ground into a fine powder in liquid nitrogen to promote thorough lysis of the sample and increase DNA yield. In large-scale sample processing, this step requires a significant amount of liquid nitrogen and time. Moreover, manual grinding may result in sample loss or contamination. Although cryogenic grinding machines can reduce the workload, manual grinding remains the primary method due to economic constraints7,17.
Chimonanthus praecox is a rare and exceptional winter-flowering tree with a cultivation history that spans over a millennium, featuring a wide range of variations and numerous cultivars22,23. DNA extraction is an essential step in C. praecox molecular analyses24–26. Early studies on DNA extraction from C. praecox focused on optimizing the DNA quality without simplifying the operational process. Consequently, the extraction procedure remains cumbersome, time-consuming, and labor-intensive27–30.
The current study seeks to significantly simplify the CTAB experimental process by altering the plant sample pretreatment method and reducing the time spent on each step. To this end, the effects of different steps in the CTAB method on the quality and concentration of DNA extracted from C. praecox leaves are compared. The steps are then simplified, and the effectiveness of the simplified CTAB method is validated by comparing DNA extraction from different tissues of C. praecox, species within the Chimonanthaceae family, and plants from different families. This simplified protocol ensures the extraction of high-quality DNA while significantly lowering costs and operational complexity. Hence, this method is suitable for research involving some different plant materials and can serve as a reference for researchers conducting large-scale or long-term DNA extractions.
Methods
Plant materials
The plant materials used in this study were collected from 11 species and 1 hybrid, including Chimonanthus sp. from the Calycanthaceae family (Chimonanthus praecox, Chimonanthus salicifolia, and Chimonanthus nitens), the Calycanthus sp. (Calycanthus floridus, Calycanthus chinensis, and their hybrid Calycanthus × intermedius), model plants (Petunia hybrid, Arabidopsis thaliana, Populus tomentosa, and Nicotiana tabacum), and monocot plants (Lilium brownie and Caladium bicolor). All materials were cultivated in the Key Laboratory of Agricultural Biosafety and Green Production of the Upper Yangtze River (Ministry of Education) at Southwest University. Detailed information can be found in Table 1. In 2024, different tissues (young leaves, old leaves, young roots, old roots, young stems, old stems, petals) of C. praecox and old leaves from other plants were collected, cleaned, and directly used for DNA extraction.
Table 1.
Detailed information of plant materials.
| No | Individuals | Species name | Voucher No | Origin collection location | Longitude and latitude | Material class |
|---|---|---|---|---|---|---|
| 1 | S1 | Chimonanthus praecox | 2023_S1 | Beibei District, Chongqing City | N 29.766683 E 106.374561 | Cultivated |
| 2 | LIANG | Chimonanthus salicifolius | 2023_LIANG | Beibei District, Chongqing City | N 29.766683 E 106.374561 | Cultivated |
| 3 | LIU | Chimonanthus nitens | 2023_LIU | Beibei District, Chongqing City | N 29.766683 E 106.374561 | Cultivated |
| 4 | S10 | Calycanthus floridus | 2023_S10 | Beibei District, Chongqing City | N 29.766683 E 106.374561 | Cultivated |
| 5 | S21 | Calycanthus chinensis | 2023_S21 | Beibei District, Chongqing City | N 29.766683 E 106.374561 | Cultivated |
| 6 | S22 | Calycanthus × intermedius | 2023_S22 | Beibei District, Chongqing City | N 29.766683 E 106.374561 | Cultivated |
| 7 | S_PHY | Petunia hybrida | 2023_S_PHY | Beibei District, Chongqing City | N 29.766683 E 106.374561 | Cultivated |
| 8 | S_ATH | Arabidopsis thaliana | 2023_S_ATH | Beibei District, Chongqing City | N 29.766683 E 106.374561 | Cultivated |
| 9 | S_NTA | Nicotiana tabacum | 2023_S_NTA | Beibei District, Chongqing City | N 29.766683 E 106.374561 | Cultivated |
| 10 | S_PTO | Populus tomentosa | 2023_S_PTO | Beibei District, Chongqing City | N 29.766683 E 106.374561 | Cultivated |
| 11 | S_LBR | Lilium brownii | 2023_S_LBR | Beibei District, Chongqing City | N 29.766683 E 106.374561 | Cultivated |
| 12 | S_CBI | Caladium bicolor | 2023_S_CBI | Beibei District, Chongqing City | N 29.766683 E 106.374561 | Cultivated |
Reagents
CTAB extraction buffer: 100 mmol/L Tris–HCl (Shandong Keyuan Biochemical Co., Ltd.), 20 mmol/L EDTA (Bio-Rad Laboratories, Inc.), 1.4 mol/L NaCl (Chengdu Kelong Chemical Co., Ltd.), 2% CTAB (Shanghai Sangon Biotech Co., Ltd.), pH 8.0
β-mercaptoethanol (Chongqing Yuexiang Chemical Co., Ltd.)
Chloroform (Chongqing Yuexiang Chemical Co., Ltd.)
Isoamyl alcohol (Chongqing Yuexiang Chemical Co., Ltd.)
Isopropanol (Chongqing Yuexiang Chemical Co., Ltd.)
Anhydrous ethanol (Chongqing Yuexiang Chemical Co., Ltd.)
Agarose for electrophoresis (Shanghai Hengfei Biotechnology Co., Ltd.)
TAE buffer (Beijing BioLab Technology Co., Ltd.)
2000 bp DNA Marker (Dalian Takara Co., Ltd.)
ddH₂O (Nanjing Vazyme Biotech Co., Ltd.)
6 × DNA loading buffer (Beijing TIANGEN Biotech Co., Ltd.)
Nucleic acid stain (Beijing SBS Genetech Co., Ltd.)
Instruments and equipment
Water bath
High-speed centrifuge (Heraeus Pico 17)
Horizontal electrophoresis tank (Beijing Liuyi, DYCP-31CN)
Electrophoresis power supply (Beijing Liuyi, DYY-12)
Automatic gel imaging and analysis system (Tanon 3500)
Micro-volume spectrophotometer (Thermo NanoDrop 2000C)
Plant material pre-treatment
To simplify tissue preparation, the traditional plant tissue grinding with a mortar and pestle was replaced with a blue pipette tip to gently crush the plant tissue inside the centrifuge tube (Fig. 1)27,30. After removing the central vein of the fresh leaf, the leaf was cut into strips measuring 1–1.5 cm in length and 1–2 mm in width. The petals, stems, and roots were directly cut into pieces 1–2 mm wide. Next, 25 mg of fresh sample was weighed using an electronic balance and transferred into a 1.5-mL centrifuge tube. The sample was frozen in liquid nitrogen for 2–3 min, removed, and the lid was opened; the lower part of the blue pipette tip was then quickly frozen in liquid nitrogen for 3–5 s. The fresh sample was gently crushed in the centrifuge tube; this process was repeated three times for each sample before storing in liquid nitrogen for DNA extraction.
Fig. 1.
Sample preparation steps. (A) Traditional mortar grinding method. (B) Improved cryogenic pestle crushing method.
Optimization of DNA extraction using the CTAB method
For all the following CTAB steps, each sample was subjected to extraction three times. First, CTAB extraction buffer was added to a 1.5-mL centrifuge tube containing a 25 mg sample and incubated in a 65 °C water bath to lyse the plant tissue cells. The tubes were then centrifugated at 12,000 rpm, and the supernatant was transferred to a new centrifuge tube. An equal volume of chloroform: isoamyl alcohol (24:1) was then added and mixed thoroughly before allowing the tube to rest for 10 min. Following centrifugation at 12,000 rpm, the supernatant was transferred to a new tube, to which an equal volume of pre-chilled isopropanol was added before gently inverting to mix. The DNA was then allowed to precipitate before centrifuging again at 12,000 rpm. The supernatant was discarded, and the pellet was washed twice with 75% ethanol and once with anhydrous ethanol. After thoroughly air-drying, 50 μL of ddH₂O was added to dissolve the DNA completely, making it ready for analysis.
Since factors such as lysis time, extraction frequency, precipitation temperature, and precipitation time in the CTAB extraction method can affect DNA extraction efficiency, a four-factor, three-level orthogonal design was adopted to develop nine experimental schemes (Table 2, Fig. 2). These schemes were compared to determine the simplest and most efficient method for directly extracting DNA from wintersweet leaves.
Table 2.
DNA quality assessment results of C. praecox extracted using different methods.
| Method | Water bath time | Number of extractions | Precipitation temperature | Precipitation time | DNA concentration (ng/μL) | A260/280 | A260/230 |
|---|---|---|---|---|---|---|---|
| 1 | 10 min | 1 | − 20 °C | 10 min | 266.44 ± 17.70bc | 2.03 ± 0.01ab | 2.18 ± 0.05bc |
| 2 | 10 min | 2 | 0 °C | 20 min | 248.44 ± 8.43ab | 2.03 ± 0.01ab | 2.09 ± 0.01c |
| 3 | 10 min | 3 | 25 °C | 30 min | 215.22 ± 3.42a | 2.01 ± 0.00ab | 2.12 ± 0.01bc |
| 4 | 30 min | 1 | 0 °C | 30 min | 352.99 ± 5.92ef | 2.03 ± 0.00ab | 1.97 ± 0.01bc |
| 5 | 30 min | 2 | 25 °C | 10 min | 325.22 ± 17.89de | 2.02 ± 0.01ab | 1.96 ± 0.02a |
| 6 | 30 min | 3 | − 20 °C | 20 min | 290.78 ± 10.94bcd | 2.01 ± 0.01a | 2.04 ± 0.03a |
| 7 | 60 min | 1 | 25 °C | 20 min | 357.55 ± 14.44ef | 2.04 ± 0.01ab | 2.05 ± 0.03ab |
| 8 | 60 min | 2 | − 20 °C | 30 min | 397 ± 0.96f | 2.03 ± 0.00ab | 2.09 ± 0.03ab |
| 9 | 60 min | 3 | 0 °C | 10 min | 306.33 ± 24.37cde | 2.04 ± 0.00b | 2.07 ± 0.02bc |
| k1 | 243.37 | 325.67 | 318.07 | 299.33 | |||
| k2 | 323.00 | 323.55 | 302.59 | 298.93 | |||
| k3 | 353.63 | 270.78 | 299.33 | 321.74 | |||
| R | 110.26 | 54.89 | 18.74 | 22.81 |
‘kn’ refers to the average concentration results corresponding to each factor when the gradient is n; 'R' represents the ‘range’.
The different letters indicate significant differences (p < 0.05) between different samples within the same indicator.
Fig. 2.
CTAB method experimental steps. Red font indicates experimental conditions set at different gradients for comparison.
DNA quality and quantity assessment
DNA concentration and purity were measured using a Nanodrop2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, MA, USA), recording the DNA concentration, A260/280, and A260/230 ratios. PCR amplification was performed on the wax plum DNA extracted using different methods, following the PCR system described by Liu24. The primer sequences used were: Forward primer GGTCATTCAGCTGCTGATGG, Reverse primer ACATGAGAGGGGAGAACTGGT. DNA quality and amplification products were assessed by 1% (w/v) agarose gel electrophoresis, and the results were recorded using an automated gel imaging system, and to ensure a tidy and aesthetically pleasing layout of the images, appropriate cropping and arrangement were made to the original images. The original images are provided in Supplementary information.
Data analysis
Each sample was extracted in triplicate, and the DNA concentration, A260/280, and A260/230 ratios were measured thrice. Use SPSS software to analyze the data results, and the data were presented as the mean ± standard error of the mean (SEM) and evaluated at a 5% significance level.
Results
DNA quality and concentration from different methods
By comparing the liquid nitrogen consumption required for processing single samples using the traditional mortar grinding method and the simplified direct crushing method, it was found that the traditional method consumes 20–30 mL of liquid nitrogen, while the simplified method requires less than 2–3 mL, reducing liquid nitrogen costs by at least 90%. To identify a more convenient DNA extraction method, a four-factor, three-level orthogonal experimental design was adopted to examine different water bath times, extraction frequencies, precipitation temperatures, and precipitation durations. A total of nine methods were designed to compare the effects of these factors on DNA extraction efficiency. The DNA concentration and purity obtained from different methods were analyzed using 1% gel electrophoresis and concentration measurements. Hence, DNA extracted by all methods appeared as a clear, bright single band on the 1% gel (Fig. 3), with DNA concentrations ranging from 215.22 to 397 ng/μL (Table 2). Furthermore, target bands were successfully amplified by PCR (Fig. 4), indicating that all nine methods extracted high-quality DNA from fresh, young, wintersweet leaves. Among them, methods 7, 8, and 9 yielded DNA concentrations above 300 ng/μL, with brighter bands on the gel than the other methods. Method 8 yielded the highest DNA concentration, significantly higher than that obtained by Methods 1, 2, 3, 5, 6, and 9. Method 3 produced the lowest DNA concentration, which, excluding Method 2, was significantly lower than the other methods (Table 2 and Fig. 5A).
Fig. 3.
Agarose gel electrophoresis results of DNA extracted from C. praecox using different methods.
Fig. 4.
PCR amplification results of DNA extracted by 9 different methods.
Fig. 5.
Comparison of different DNA extraction methods for C. praecox based on various indicators. Comparison of (A) DNA concentration, (B) A260/280 ratio, (C) A260/230 ratio, and (D) time spent on optimized steps. Note: The different letters indicate significant differences (p < 0.05) between different samples within the same indicator.
Analysis of the DNA purity showed that the A260/280 ratios ranged from 2.01 to 2.04. The A260/280 ratio of DNA extracted by Method 6 was significantly lower than that of Method 9 (Table 2, Fig. 5B). The A260/230 ratios ranged from 1.96 to 2.18, with Methods 5 and 6 yielding lower A260/230 ratios than Methods 1, 2, 3, 4, and 9 (Table 2, Fig. 5C). In addition, the total time required for the water bath, extraction, and precipitation steps was recorded. Method 1 had the shortest duration, requiring only 30 min, while Method 8 was the longest at 110 min (Fig. 5D). Range analysis revealed that the range value for water bath time was the largest, followed by that for extraction frequency. The range value for precipitation time was the smallest, and those for precipitation temperature and time were similar. These values indicate that water bath time had the greatest impact on the effectiveness of DNA extraction from wintersweet leaves, followed by extraction frequency, precipitation time, and precipitation temperature, respectively (Table 2).
Effects of different steps on DNA extraction efficiency
Analysis of DNA quality extracted at different steps showed significant differences in DNA concentration with varying water bath times and extraction frequencies. Meanwhile, there were no significant differences in DNA concentration with different precipitation temperatures or times (Table 2 and Fig. 6). As water bath time increased, DNA concentration gradually rose. The DNA concentration extracted after 10 min was significantly lower than that after 30 min, and the concentration after 30 min was significantly lower than that after 60 min. The DNA concentration from three extractions was significantly lower than that from one or two, with no significant difference between one and two extractions. Although DNA concentration showed no significant differences across precipitation temperatures, lower temperatures tended to yield higher DNA concentrations. Similarly, precipitation time did not significantly affect DNA concentration, but longer times tended yield higher DNA concentrations (Fig. 6).
Fig. 6.
Differential analysis of DNA extracted from C. praecox leaves at different levels of various factors. The significance of differences is limited to comparisons within individual factors. Note: The different letters indicate significant differences (p < 0.05) between different samples within the same indicator.
DNA extraction gel electrophoresis from different plant materials
Since all nine methods successfully extracted high-quality DNA from fresh young wintersweet leaves, Method 1, which had the shortest processing time, was selected to simplify the CTAB DNA extraction steps and verify its efficiency. This method was then applied to extract DNA from different wintersweet tissues, species within the Calycanthaceae family (Chimonanthus and Calycanthus genera), and other plant species. The 1% gel electrophoresis results showed that the DNA bands from roots (old and young), old stems, and glossy wintersweet were relatively faint, while those from other plant materials were brighter. Notably, the DNA bands from Chimonanthus praecox old leaves, Chimonanthus salicifolius, Nicotiana tabacum, and Populus tomentosa were very bright (Fig. 7).
Fig. 7.
Agarose gel electrophoresis results of DNA extracted from different plant materials using the simplified method.
DNA concentration from different plant materials
The DNA concentrations extracted from different wintersweet tissues using the simplified CTAB method showed significant differences. DNA concentrations from roots and stems did not differ significantly, both < 130.00 ng/μL, with old stems yielding the lowest concentration at 48.22 ng/μL. In contrast, DNA concentrations from leaves and petals were significantly higher than those from roots and stems, reaching 280.00 ng/μL and 373.22 ng/μL, respectively. The A260/280 values of DNA extracted from different tissues also differed significantly; those of DNA extracted from roots and stems were lower than those from leaves and petals. Apart from the significantly lower A260/280 value of DNA extracted from young roots compared to leaves, there were no other significant differences. Meanwhile, the A260/230 values for DNA extracted from roots and stems were all below 1.8 and were significantly lower than those for DNA extracted from leaves (2.21 respectively; Table 3, Fig. 8).
Table 3.
DNA quality assessment results from different plant materials.
| Classification | Plant materials | DNA concentration | A260/280 | A260/230 |
|---|---|---|---|---|
| The different tissues of Chimonanthus praecox | Young root | 48.22 ± 16.29a | 1.98 ± 0.03ab | 1.63 ± 0.14a |
| Old root | 75.33 ± 12.67a | 1.94 ± 0.043a | 1.5 ± 0.14a | |
| Young stem | 73.77 ± 6.28a | 1.96 ± 0.03ab | 1.58 ± 0.11a | |
| Old stem | 122.67 ± 5.06a | 2.02 ± 0.01ab | 1.76 ± 0.04ab | |
| Old leave | 280.00 ± 14.50b | 2.07 ± 0.01b | 2.21 ± 0.05c | |
| Petal | 373.22 ± 73.59b | 2.04 ± 0.01ab | 2.03 ± 0.01bc | |
| Calycanthaceae family | Chimonanthus salicifoliusloi | 231.00 ± 9.24a | 2.08 ± 0.00b | 2.05 ± 0.02bc |
| Chimonanthus nitens | 202.67 ± 23.82a | 2.04 ± 0.01b | 2.12 ± 0.01cd | |
| Calycanthus floridus | 235.67 ± 53a | 2.08 ± 0.00b | 2.14 ± 0.07d | |
| Calycanthus chinensis | 164.33 ± 24a | 2.00 ± 0.04b | 1.95 ± 0.05b | |
| Calycanthus × intermedius | 147.67 ± 27a | 1.68 ± 0.30a | 1.51 ± 0.29a | |
| Other Plants | Petunia hybrida | 167.00 ± 17.61ab | 2.12 ± 0.01a | 2.16 ± 0.02b |
| Arabidopsis thaliana | 75.11 ± 17.61a | 2.00 ± 0.07a | 1.72 ± 0.20a | |
| Nicotiana tabacum | 365.66 ± 48.94c | 2.08 ± 0.02a | 2.21 ± 0.02b | |
| Populus tomentosa | 290.11 ± 30.16bc | 2.08 ± 0.00a | 2.11 ± 0.03b | |
| Lilium brownii | 269.66 ± 36.97bc | 2.09 ± 0.01a | 2.22 ± 0.01b | |
| Caladium bicolor | 184.22 ± 22.08ab | 2.04 ± 0.00a | 1.92 ± 0.09ab |
The different letters indicate significant differences (p < 0.05) between different samples within the same indicator.
Fig. 8.
Differential analysis of DNA extracted from different plant materials based on various indicators.
The DNA concentrations extracted from the leaves of Chimonanthus and Calycanthus species using the simplified CTAB method did not differ significantly. DNA concentrations from Chimonanthus species all exceeded 200 ng/μL, while for Calycanthus species, they were below 200 ng/μL, excluding Calycanthus floridus. The A260/280 values of DNA extracted from different plants showed significant differences; the A260/280 value of DNA extracted from hybrid Calycanthus was below 1.8 and > 2.00 for all other plants. In contrast, the A260/230 values of DNA extracted from different plants also showed significant differences. The A260/230 values of DNA extracted from hybrid Calycanthus were significantly lower than other plants. Excluding the hybrid Calycanthus, which had an A260/230 value < 1.8, the A260/230 values of DNA extracted from all other plants exceeded 1.9 (Table 3, Fig. 8).
The DNA concentrations extracted from plants of other families and genera using the simplified CTAB method showed significant differences. The highest DNA concentration was from Nicotiana tabacum (365.66 ng/μL), while the lowest was from Arabidopsis thaliana (75.11 ng/μL). The DNA concentrations for the other plants were all above 160 ng/μL. The A260/280 values of the DNA extracted from different plants showed no significant differences, all exceeding 2.00. However, significant differences were observed in the A260/230 values; the lowest was from Arabidopsis thaliana, at 1.72, while those for all other plants were > 1.90 (Table 3, Fig. 8).
Simplification of the CTAB method
By combining the improved sample preprocessing method with Method 1, the traditional CTAB DNA extraction protocol was simplified (Fig. 9). Comparative analysis revealed that the simplified CTAB method comprised freezing the plant tissue in liquid nitrogen and directly crushing it in a centrifuge tube. The water bath, extraction, and incubation times were reduced to 10 min, while the centrifuge time was reduced to 5 min. The total time for the simplified procedure was 40 min, while the same steps in the traditional method require 175 min27,30. Hence, the simplified version reduced the time by 77.14% compared with the traditional method, improving efficiency nearly three-fold. Additionally, it reduced the consumption of liquid nitrogen and samples, lowered costs, and simplified the operation. The specific steps of the simplified method are shown in Fig. 9.
Fig. 9.
Specific steps of the simplified CTAB method for DNA extraction.
Discussion
DNA extraction is widely used in plant molecular biology research, especially in studies such as variety identification, genetic diversity assessment, phylogenetic analysis, and systematics, all of which require large-scale DNA isolation and purification work3,31,32. Several DNA extraction methods have been reported, including common techniques such as the CTAB method, SDS (sodium dodecyl sulfate) method, high-salt low pH method, and kit-based methods. Among these, the CTAB DNA extraction protocol is the most widely used due to its broad applicability, low cost, and high DNA yield and quality3,7,20,33. In C. praecox research, DNA extraction methods primarily include the CTAB method and commercial kit-based methods24,34,35. However, commercial kits are often expensive, while the CTAB method is nearly ten times cheaper than commercial kits19,36. Some researchers have also compared the SDS and CTAB methods and found that CTAB outperforms SDS in terms of both DNA quality and concentration28,37. In this study, using the CTAB method to extract DNA from C. praecox leaves resulted in DNA concentrations exceeding 200 ng/μL, with yields up to 400 μg/g before and after simplification. Additionally, the A260/280 ratios were > 2.00, and the A260/230 ratios were > 1.90, indicating high DNA quality. This suggests that the CTAB method is suitable for rapidly extracting DNA from C. praecox leaves.
Currently, the CTAB method used for DNA extraction from C. praecox largely references the traditional protocol26,33,38. Although this protocol is cost-effective and yields high-quality DNA, it is relatively complicated and time-consuming, making it labor-intensive when performing large-scale DNA extractions from C. praecox18,20. First, during sample preprocessing, tissue grinding requires a large amount of liquid nitrogen and manual labor. Second, the long processing times for different steps result in a lengthy experimental procedure. Additionally, toxic reagents are used during the process, and the extended handling times of different steps increase the likelihood of prolonged exposure to these toxic substances7,20. In some studies where large-scale DNA extraction is required, high DNA concentrations may not be necessary. For example, experiments such as molecular marker development, genotype identification, and fingerprinting often use DNA templates at lower concentrations39–41.
Many have modified the traditional CTAB method to improve extraction efficiency while ensuring high-quality DNA or to simplify the steps at the cost of lower DNA concentration and higher impurity levels11,42. However, to date, there has been no research on the impact of significantly shortening the CTAB protocol’s experimental steps on C. praecox DNA extraction. Regardless of whether plant samples are fresh or preserved in another manner, they are typically ground into a fine powder in liquid nitrogen before DNA extraction, as the grinding process impacts DNA extraction efficiency43. In the current study, frozen tips were used to crush the sample directly in a centrifuge tube, reducing sample loss and simplifying the process. Additionally, while mortar grinding typically requires 100 mg of sample, only 25 mg was needed in this study, effectively reducing the sample usage by 75% and lowering preprocessing costs.
The main steps of the CTAB method for DNA extraction include (1) preprocessing: mechanical force is used to break plant cells; (2) lysis: CTAB buffer is added to dissolve the DNA; (3) extraction: organic solvents are used to remove impurities like proteins, polysaccharides, and phenolic compounds; and (4) precipitation: isopropanol is added to precipitate and isolate the DNA12,13,44. In this study, a four-factor, three-level orthogonal experiment was designed to explore the effects of water bath time, extraction cycles, precipitation temperature, and precipitation time on DNA extraction from C. praecox. The results showed significant differences in time spent for different treatments, with DNA concentration, A260/280 ratio, and A260/230 ratio all exhibiting significant variation. DNA concentrations ranged from 215.22 to 397.00 ng/μL, while the A260/280 and A260/230 ratios exceeded 1.8, indicating good DNA purity.
During the lysis step, the samples were incubated at 65 °C to promote tissue degradation and cell lysis. Different incubation temperatures and times can affect DNA extraction efficiency45. Herein, water bath time significantly impacted DNA extraction efficiency. The longer the water bath time within 60 min, the higher the C. praecox DNA concentration. However, since DNA concentrations of up to 200 ng/μL were obtained with a 10-min water bath, for cases where high DNA concentrations are not required and large-scale DNA extraction is needed, the water bath time can be shortened to 10 min. In the extraction step, the DNA is physically separated from other cellular components produced during the lysis process. The mixture separates into two phases, with DNA in the upper aqueous phase. When the aqueous phase is turbid, the extraction step is typically repeated, applying a two-step extraction42. The current study found that extracting once or twice had no significant impact on C. praecox DNA yield, but extracting three times significantly reduced the DNA concentration. Therefore, a single extraction is the optimal choice for C. praecox DNA extraction. During the DNA precipitation step, the precipitation time and temperature can affect DNA extraction efficiency11,46. However, within 30 min, neither precipitation time nor temperature significantly impacted DNA extraction in the current study. Nevertheless, DNA concentrations were highest when precipitation was performed at − 20 °C for 30 min. The lack of significant differences might be due to the short precipitation time. Therefore, for the simplified C. praecox DNA extraction process, a precipitation step at − 20 °C for 10 min is optimal.
The CTAB method is widely applicable and can be used for DNA extraction from different tissues of the same plant or different plant species19,42,47. Based on the simplified steps, this study extracted DNA from different tissues of C. praecox species, plants from the family Calycanthaceae, and other plant species from different families to evaluate the effectiveness of the simplified protocol. The simplified method effectively extracted DNA from all plant materials tested, though the extraction efficiency varied significantly. Compared to old leaves, roots, fruits, and stems, the DNA concentration and purity extracted from young leaves are higher11. For C. praecox, the highest DNA concentration was achieved in the petals, followed by the leaves, while DNA concentrations in roots and stems were lower, with significantly lower purity compared to the petals and leaves, consistent with previous studies. Additionally, in the simplified protocol, the preprocessing step used a frozen tip to crush the plant tissue. However, after freezing roots and stems in liquid nitrogen, it was more difficult to crush the tissue, which might have reduced DNA extraction efficiency.
Since secondary metabolites in different plant species have unique compositions, a single CTAB protocol is unlikely to be universally applicable, especially for materials with high levels of interfering substances such as polysaccharides, proteins, polyphenols, and secondary metabolites17,48. These impurities are difficult to remove during extraction and often remain in the final DNA solution in water-insoluble forms or as other complexes, decreasing the DNA quality17,48. In this study, the simplified protocol was applied to DNA extraction from plants of the Calycanthaceae family and some other species, and extraction from Chimonanthus species resulted in higher DNA concentrations and quality. However, the purity of DNA extracted from Calycanthus species was generally low, and the DNA concentration and purity of hybrid Calycanthus were lower. For plants from other families, the DNA concentration from leaves varied significantly, with Arabidopsis thaliana having the lowest concentration (75.11 ng/μL), yet it was still suitable for common molecular applications, such as transgenic identification. Considering these findings, the simplified protocol seems particularly suitable for DNA extraction from the leaves of Chimonanthus species, Nicotiana tabacum, Populus tomentosa, and Lilium brownii.
Conclusions
This study successfully simplified the CTAB DNA extraction protocol for C. praecox species; this protocol is also applicable to other Chimonanthus species and plants from some other families. Compared to the traditional CTAB method, the simplified protocol requires only 25 mg of sample and allows for high-quality DNA extraction from C. praecox leaves within 1 h. The sample amount is reduced by 75%, the amount of liquid nitrogen is reduced by 90%, and the total extraction time is shortened by 77.14% compared with the traditional method. This simplified protocol enables rapid and efficient DNA extraction from small sample sizes and reduces processing time and costs while improving the efficiency of DNA extraction from Chimonanthus and other plants. This approach has significant practical value for experiments involving large-scale DNA extractions, such as studies on genetic diversity, molecular markers, genetic mapping, fingerprinting, and transgenic identification.
Electronic Supplementary Material
Below is the link to the electronic supplementary material.
Acknowledgements
The authors are grateful to the Key Laboratory of Agricultural Biosafety and Green Production of Upper Yangtze River (Ministry of Education) for providing an experimental platform.
Author contributions
BL and SZS conceived the study and designed the experiments. BL and HFW performed the experiments. YZC, GPM, XWZ, HXZ and XRS helped with data analysis. The manuscript was written and revised by BL and HFW. All authors read and approved the final version of the manuscript.
Funding
This study was funded by the Special Key Project for Technological Innovation and Application Development in Chongqing (Grant No. CSTB2023TIAD-KPX0039).
Data availability
The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.
Declarations
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Mitchell, N., McAssey, E. V. & Hodel, R. G. J. Emerging methods in botanical DNA/RNA extraction. Appl. Plant Sci.11, e11530. 10.1002/aps3.11530 (2023). [Google Scholar]
- 2.Carey, S. J., Becklund, L. E., Fabre, P. P. & Schenk, J. J. Optimizing the lysis step in CTAB DNA extractions of silica-dried and herbarium leaf tissues. Appl. Plant Sci.11, e11522. 10.1002/aps3.11522 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Dairawan, M. & Shetty, P. J. The evolution of DNA extraction methods. Am. J. Biomed. Sci. Res.8, 39–45. 10.34297/AJBSR.2020.08.001234 (2020). [Google Scholar]
- 4.Ma, Y. et al. An optimal genomic DNA extraction method for shoots of four Dendrocalamus species based on membership function analysis. Biotechniques76, 94–103. 10.2144/btn-2023-0087 (2024). [DOI] [PubMed] [Google Scholar]
- 5.Egan, A. N., Schlueter, J. & Spooner, D. M. Applications of next-generation sequencing in plant biology. Am. J. Bot.99, 175–185. 10.3732/ajb.1200020 (2012). [DOI] [PubMed] [Google Scholar]
- 6.Yan, W. J., Pendi, F. H. & Hussain, H. Improved CTAB method for RNA extraction of thick waxy leaf tissues from sago palm (Metroxylonsagu Rottb). Chem. Biol. Techn. Agricult.9(1), 63. 10.1186/s40538-022-00329-9 (2022). [Google Scholar]
- 7.Abdel-Latif, A. & Osman, G. Comparison of three genomic DNA extraction methods to obtain high DNA quality from maize. Plant Methods13, 1. 10.1186/s13007-016-0152-4 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Wang, H. Y. & Liu, H. K. Comparison of different DNA extraction methods and analysis of its applicability in tomato. Acta Agric Boreali-Occidentalis Sin.31, 1560–1567 (2022). [Google Scholar]
- 9.Santosa, D. A. Rapid extraction and purification of environmental DNA for molecular cloning applications and molecular diversity studies. Mol. Biotechnol.17, 59–64. 10.1385/MB:17:1:59 (2001). [DOI] [PubMed] [Google Scholar]
- 10.Chen, X. et al. Whole-genome resequencing using next-generation and nanopore sequencing for molecular characterization of T-DNA integration in transgenic poplar 741. BMC Genomics22, 329. 10.1186/s12864-021-07625-y (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Schenk, J. J., Becklund, L. E., Carey, S. J. & Fabre, P. P. What is the “modified” CTAB protocol? Characterizing modifications to the CTAB DNA extraction protocol. Appl. Plant Sci.11, e11517. 10.1002/aps3.11517 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Doyle, J. DNA protocols for plants. In Molecular Techniques in Taxonomy, 283–293. (Springer, 1991).
- 13.Bashalkhanov, S. & Rajora, O. P. [Protocol] Protocol: A high-throughput DNA extraction system suitable for conifers. Plant Methods4, 20. 10.1186/1746-4811-4-20 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Dutta, S. K., Jones, A. S. & Stacey, M. The separation of desoxypentosenucleic acids and pentosenucleic acids. Biochim. Biophys. Acta10, 613–622. 10.1016/0006-3002(53)90305-9 (1953). [DOI] [PubMed] [Google Scholar]
- 15.Murray, M. G. & Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res.8, 4321–4325. 10.1093/nar/8.19.4321 (1980). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Saghai-Maroof, M. A., Soliman, K. M., Jorgensen, R. A. & Allard, R. W. Ribosomal DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal location, and population dynamics. Proc. Natl. Acad. Sci. USA81, 8014–8018. 10.1073/pnas.81.24.8014 (1984). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Doyle, J. J. & Doyle, J. L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull.19, 11–15 (1987). [Google Scholar]
- 18.Hale, H., Gardner, E. M., Viruel, J., Pokorny, L. & Johnson, M. G. Strategies for reducing per-sample costs in target capture sequencing for phylogenomics and population genomics in plants. Appl. Plant Sci.8, e11337. 10.1002/aps3.11337 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Mark, D. et al. Assessing the effect of sample storage time on viral detection using a rapid and cost-effective CTAB-based extraction method. Plant Methods20, 64. 10.1186/s13007-024-01175-6 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Vilanova, S. et al. Silex: A fast and inexpensive high-quality DNA extraction method suitable for multiple sequencing platforms and recalcitrant plant species. Plant Methods16, 110. 10.1186/s13007-020-00652-y (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Ali, N., Rampazzo, Rd. C. P., Costa, A. D. T. & Krieger, M. A. Current nucleic acid extraction methods and their implications to point-of-care diagnostics. BioMed. Res. Int.2017, 9306564 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Shen, Z. et al. The red flower wintersweet genome provides insights into the evolution of magnoliids and the molecular mechanism for tepal color development. Plant J.108, 1662–1678. 10.1111/tpj.15533 (2021). [DOI] [PubMed] [Google Scholar]
- 23.Zhu, T. et al. Optimizing DUS testing for Chimonanthus praecox using feature selection based on a genetic algorithm. Front Plant Sci.14, 1328603. 10.3389/fpls.2023.1328603 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Liu, B., Wu, H. F., Cao, Y. Z., Yang, X. M. & Sui, S. Z. Establishment of novel simple sequence repeat (SSR) markers from Chimonanthus praecox transcriptome data and their application in the identification of varieties. Plants (Basel).13, 2131. 10.3390/plants13152131 (2024). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Yang, J. et al. Genetic diversity and structure of wintersweet (Chimonanthus praecox) revealed by EST-SSR markers. Sci. Hortic150, 1–10. 10.1016/j.scienta.2012.11.004 (2013). [Google Scholar]
- 26.Zhao, K. G., Zhou, M. Q., Chen, L. Q., Zhang, D. L. & Robert, G. W. Genetic diversity and discrimination of Chimonanthus praecox (L.) Link germplasm using ISSR and RAPD markers. Hortic Sci.42, 1144–1148. 10.21273/HORTSCI.42.5.1144 (2007). [Google Scholar]
- 27.Jing, X. M. et al. Effects of different sample preserving methods on genomic DNA sample preserving methods on genomic DNA. Mol. Plant Breed.02, 387–392 (2008). [Google Scholar]
- 28.Zhou, M. Q. DNA extraction from Chimonanthus praecox by CTAB and SDS. J. Yangtze Univ. (Nat. Sci. Ed.) 6, 42–4 + 112 (2009).
- 29.Ye, L. J., Lu, J. X. & Yang, Q. S. Extraction of genomic DNA of Chimonanthus praecox petals and optimization of its RAPD-PCR system. J Shanxi Agric Sci.39, 299–303 (2011). [Google Scholar]
- 30.Yang, Y. R. Studies on genomic DNA extraction methods of wild Chimonanthus praecox flower and leaf in Baokang country. J. Anhui Agric. Sci. 43, 33–4 + 50 (2015).
- 31.Mavrodiev, E. V. et al. A new, simple, highly scalable, and efficient protocol for genomic DNA extraction from diverse plant taxa. Appl. Plant Sci.9, e11413. 10.1002/aps3.11413 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Gouker, F. E., Guo, Y. & Pooler, M. R. Using acetone for rapid PCR-amplifiable DNA extraction from recalcitrant woody plant taxa. Appl Plant Sci.8, e11403. 10.1002/aps3.11403 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Doyle, J. J. & Doyle, J. J. Isolation of plant DNA from fresh tissue. Focus12, 13–15 (1990). [Google Scholar]
- 34.Dai, P. F. et al. Genetic diversity and differentiation in Chimonanthus praecox and Ch. Salicifolius (Calycanthaceae) as revealed by inter-simple sequence repeat (ISSR) markers. Biochem. Syst. Ecol.44, 149–156. 10.1016/j.bse.2012.04.014 (2012). [Google Scholar]
- 35.Jiang, Y. M. et al. Genetic patterns investigation of wild Chimonanthus grammatus MC Liu by using SSR markers. Acta Ecol. Sin.35, 203–209. 10.1016/j.chnaes.2015.07.007 (2015). [Google Scholar]
- 36.Anderson, C. B. et al. [Protocol]: A versatile, inexpensive, high-throughput plant genomic DNA extraction method suitable for genotyping-by-sequencing. Plant Methods.14, 1–10 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Hu, X. Q., Chen, H. & Lv, S. Q. Research on different methods of genomic DNA extraction from several resource plants in Huangshan. Chin. Agric. Sci. Bull.28, 169–176 (2012). [Google Scholar]
- 38.Lu, Y. J., Chen, C., Wang, R. H., Egan, A. N. & Fu, C. X. Effects of domestication on genetic diversity in Chimonanthus praecox: Evidence from chloroplast DNA and amplified fragment length polymorphism data. J. Syst. Evol.53, 239–251. 10.1111/jse.12134 (2015). [Google Scholar]
- 39.Ramesh, P. et al. Advancements in molecular marker technologies and their applications in diversity studies. J. Biosci.45, 1–15 (2020). [PubMed] [Google Scholar]
- 40.Dida, M. M. et al. Novel sources of resistance to blast disease in finger millet. Crop. Sci.61, 250–262. 10.1002/csc2.20378 (2021). [Google Scholar]
- 41.Joshi, B. K., Joshi, D. & Ghimire, S. K. Genetic diversity in finger millet landraces revealed by RAPD and SSR markers. Nepal J. Biotechnol.8, 1–11. 10.3126/njb.v8i1.30204 (2020). [Google Scholar]
- 42.Aboul-Maaty, N.A.-F. & Oraby, H.A.-S. Extraction of high-quality genomic DNA from different plant orders applying a modified CTAB-based method. Bull. Natl. Res. Cent.43, 1–10 (2019). [Google Scholar]
- 43.Drábková, L., Kirschner, J. & Vlĉek, Ĉ. Comparison of seven DNA extraction and amplification protocols in historical herbarium specimens of Juncaceae. Plant Mol. Biol. Rep.20, 161–175. 10.1007/BF02799431 (2002). [Google Scholar]
- 44.Ramya, K. R. et al. A modified DNA isolation protocol for high-quality DNA and long-term storability in grasspea (Lathyrussativus L.). Indian J. Genet Plant Breed.83, 602–604. 10.31742/ISGPB.83.4.16 (2023). [Google Scholar]
- 45.Pal, D. & Dey, N. PCR compatible MiniPrep DNA isolation in rice using microwave and dry bath based heating devices. Braz. J. Bot.47, 1–5. 10.1007/s40415-024-01023-w (2024). [Google Scholar]
- 46.Li, Y. et al. A systematic investigation of key factors of nucleic acid precipitation toward optimized DNA/RNA isolation. BioTechniques.68, 191–199. 10.2144/btn-2019-0109 (2020). [DOI] [PubMed] [Google Scholar]
- 47.Berendzen, K. et al. A rapid and versatile combined DNA/RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col-0 and Landsberg erecta. Plant Methods1, 4. 10.1186/1746-4811-1-4 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Esfandani-Bozchaloyi, S., Sheidai, M. & Kalalegh, M. H. Comparison of DNA extraction methods from Geranium (Geraniaceae). Acta Bot. Hung.61, 251–266. 10.1556/034.61.2019.3-4.3 (2019). [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.









