Mutation of the Zinc-Binding Metalloprotease Motif Affects Bacteroides fragilis Toxin Activity but Does Not Affect Propeptide Processing

Abstract

To evaluate the role of the zinc-binding metalloprotease in Bacteroides fragilis toxin (BFT) processing and activity, the zinc-binding consensus sequences (H348, E349, H352, G355, H358, and M366) were mutated by site-directed-mutagenesis. Our results indicated that single point mutations in the zinc-binding metalloprotease motif do not affect BFT processing but do reduce or eliminate BFT biologic activity in vitro.

Enterotoxigenic Bacteroides fragilis (ETBF) strains are strongly linked epidemiologically to diarrheal disease in livestock, young children, and adults (24, 25, 26, 29, 30, 32, 36, 40). The only recognized virulence factor of ETBF is a secreted a 20-kDa zinc-dependent metalloprotease termed B. fragilis toxin (BFT) (21). BFT causes fluid accumulation in ligated intestinal loops of lambs, rats, rabbits, and calves (26, 27, 32). In vitro, BFT alters the morphology of certain human intestinal carcinoma cell lines, particularly HT29/C1 (3, 18, 33, 36). The mechanism of action of BFT is mediated by cleavage of the extracellular domain of the zonula adherens protein, E-cadherin (37). Recently, ETBF strains have also been associated with active inflammatory bowel disease in a small study (28). We and others (15, 31, 39) have shown that BFT stimulates interleukin-8 (IL-8) secretion by intestinal cells (HT29, T84, and Caco-2) in vitro.

Three highly related isotypes of BFT have been identified (termed BFT-1, BFT-2, and BFT-3) (4, 5, 14, 38). All BFTs appear to be structurally similar. BFT is synthesized as a 44-kDa precursor, which is processed to a 20-kDa mature protein (5, 17). BFT is predicted to be a member of the metzincin superfamily of zinc-dependent metalloprotease enzymes (21, 22). This superfamily contains an elongated zinc-binding metalloprotease motif (HEXXHXXGXXH) and presents a perfectly superimposable methionine residue close to the zinc-binding motif. BFT possesses the methionine residue 7 amino acids downstream of the zinc-binding metalloprotease motif, typical of the matrix metalloprotease family (23). The residues of this motif are essential to catalytic activity of the metzincin proteases (23); however, the role of the zinc-binding metalloprotease motif in BFT activity has not been determined.

Using vector pFD340 (34), we previously identified an expression system to produce large quantities of active BFT in nontoxigenic B. fragilis (NTBF) strains (7). In this system, the bft-2 gene (from ETBF 86-5443-2-2) and its ∼700-bp upstream region cloned in plasmid pFD340 (originating pFD340::P-bft) was introduced into pattern III NTBF strains. Pattern III strains (containing conjugative transposon 9343 [CTn9343]-like elements) but not pattern II strains (lacking CTn86- or CTn9343-like elements) (6, 8) containing plasmid pFD340::P-bft produced active BFT in quantities that exceed the highly toxigenic wild-type ETBF strain 86-5443-2-2. To evaluate the role of the zinc-binding metalloprotease motif in BFT activity, processing, and secretion, specific amino acid residues of the zinc-binding metalloprotease motif were substituted by nonconservative amino acids in pFD340::P-bft and expressed in pattern III strain NCTC 9343 (13).

Amino acid residues His (H)-348 was replaced by Asp (D), Glu (E)-349 by Ala (A), His-352 by Tyr (Y), Gly (G)-355 by Arg (R), His-358 by Tyr, and Met (M)-366 by Arg to originate mutant BFTs: BFT-H348D, BFT-E349A, BFT-H352Y, BFT-G355R, BFT-H358Y, and BFT-M366R. Mutants were created by site-directed mutagenesis (Quikchange site-directed mutagenesis kit; Stratagene Inc., La Jolla, CA) using complementary primers listed in Table 1. Mutated pFD340::P-bft was mobilized into NTBF NCTC 9343 by using the helper plasmid pRK231 as described previously (7, 10).

TABLE 1.

Primers used in this study

Primer	Sequence (5′ to 3′)	Primer 5′ position	Accession no. (reference)
P4	GATACATCAGCTGGGTTGTAGACATCCCA	1,027-bp bft sequence	U90931 (7)
PbftF	CGCGGCATTATTAGCTGCATGTTCTAATG	36-bp bft sequence	U90931 (7)
Mutmet1	CCCGGGGTGATGGCAGACGAACTAGGGCATA	1,026-bp bft sequence	U90931
Mutmet2	TATGCCCTAGTTCGTCTGCCATCACCCCGGG	1,057-bp bft sequence	U90931
MutE349F	GGGGTGATGGCACACGCACTAGGGCATATATTG	1,029-bp bft sequence	U90931
MutE349R	CAATATATGCCCTAGTGCGTGTGCCATCACCCC	1,061-bp bft sequence	U90931
MutH352F	GGCACACGAACTAGGGTATATATTGGGTGCTAG	1,037-bp bft sequence	U90931
MutH352R	CTAGCACCCAATATATACCCTAGTTCGTGTGCC	1,069-bp bft sequence	U90931
MutG355F	GAACTAGGGCATATATTGAGTGCTAGGCATGCGGATG	1,044-bp bft sequence	U90931
MutG355R	CATCCGCATGCCTAGCACTCAATATATGCCCTAGTTC	1,080-bp bft sequence	U90931
MutH358F	CATATATTGGGTGCTAGGTATGCGGATGATCCAAAAG	1,053-bp bft sequence	U90931
MutH388R	CTTTTGGATCATCCGCATACCTAGCACCCAATATATG	1,089-bp bft sequence	U90931
MutM366F	GCGGATGATCCAAAAGATTTGAGGTATTCTAAATATACGGG	1,074-bp bft sequence	U90931
MutM366R	CCCGTATATTTAGAATACCTCAAATCTTTTGGATCATCCGC	1,114-bp bft sequence	U90931
16S1	GCGCACGGGTGAGTAACACGTAT	79 B. fragilis 16S rRNA	X83943
16S2	CGTTTACTGTGTGGACTACCAGG	789 B. fragilis 16S rRNA	X83943

^aThe underlined nucleotide in primers Mutmet1/Mutmet2, MutE349F, MutE349R, MutH352F, MutH352R, MutG355F, MutG355R, MutH358F, MutH358R, MutM366F, and MutM366R shows the nucleotide that was substituted to mutate specific amino acid residues of the zinc binding metalloprotease motif and conserved methionine residue. Primers P4 and PbftF were used in RT-PCR analyses to test expression of wild-type and mutant bfts genes.

Mutation of the zinc-binding metalloprotease motif does not affect BFT processing.

Reverse transcription (RT)-PCR analysis showed that similar to the case with wild-type bft expressed by pFD340::P-bft, all mutants overexpress bft compared to bft expression in ETBF 86-5443-2-2 (Fig. 1). Polyacrylamide gel electrophoresis using the system of Laemmli (19) and Western blot analysis of whole-cell lysate preparations of strain NCTC 9343 expressing wild-type and mutant bft genes revealed that BFT is processed to a 20-kDa mature BFT in all mutants (Fig. 2). However, the 44-kDa unprocessed and 20-kDa mature BFT in mutants BFT-H348D and BFT-M366R were detected in smaller amounts than wild-type P-BFT. Given that RT-PCR analysis showed that expression of all mutant proteins is similar to that of the recombinant wild-type BFT (P-BFT) (Fig. 1), the smaller amounts of BFT-H348D and BFT-M366R detected suggest that these mutations might further alter the structure of the protein affecting the solubility and stability of the protein. When BFT-H348D was expressed in Escherichia coli using the pET expression system (Novagen Inc., Madison, WI), we found that most of the expressed mutant BFT formed insoluble inclusion bodies (data not shown). Similarly, mutational studies of protease C from Erwinia chrysanthemi indicated that nonconservative mutations of the Met residue analogous to M366 in BFT affect the stability of the protein (12).

FIG. 1.

RT-PCR analysis of bft mRNA synthesis in NCTC 9343 strains expressing recombinant bft compared to ETBF 86-5443-2-2. Lanes: 1, ETBF 86-5443-2-2; 2, P-BFT; 3, BFT-H348D; 4, BFT-E349A; 5, BFT-H352Y; 6, BFT-G355R; 7, BFT-H358Y; and 8, BFT-M366R. Synthesis of 16S rRNA was used as a control.

FIG. 2.

Immunoblot analysis of whole-cell lysate preparations of NCTC 9343 strain expressing P-BFT (lane 1), BFT-H348D (lane 2), BFT-E349A (lane 3), BFT-H352Y (lane 4), BFT-G355R (lane 5), BFT-H358Y (lane 6), and BFT-M366R (lane 7). A whole-cell lysate preparations of NCTC 9343 containing plasmid pFD340 was included as the negative control (lane 8). Similar amounts (50 μg) of whole-cell lysate preparations were analyzed by Western blotting using a rabbit polyclonal anti-BFT serum.

Mutation of the zinc-binding metalloprotease motif affects BFT activity.

Biologic activity analysis on HT29/C1 cells showed that cell-free culture supernatants of NCTC 9343 expressing wild-type P-BFT had significantly higher levels of toxin activity than ETBF 86-5443-2-2 (P = 0.008); however, cell-free culture supernatants of NCTC 9343 expressing mutants BFT-H348D, BFT-E349A, BFT-H352Y, BFT-H358Y, and BFT-M366R did not have toxin activity on HT29/C1 cells (Table 2). Cell-free culture supernatants of NCTC 9343 expressing BFT-G355R had toxin activity on HT29/C1 cells, but this was significantly lower than that of NCTC 9343 expressing P-BFT (P = 0.006).

TABLE 2.

Toxin activity on HT29/C1 cells of B. fragilis strain NCTC 9343 expressing wild-type and mutant BFT compared to ETBF 86-5443-2-2

BFT	Toxin activity on HT29/C1 cellsa
	Supernatants	Whole-cell lysates
ETBF 86-5443-2-2	1,200 ± 462	600 ± 231
P-BFT	5,600 ± 1,600b	1,000 ± 400d
BFT-H348D	No activity	No activity
BFT-E349A	No activity	No activity
BFT-H352Y	No activity	No activity
BFT-G355R	1,400 ± 400c	810 ± 200e
BFT-H358Y	No activity	No activity
BFT-M366R	No activity	No activity

^aBFT activity was measured as the inverse of the maximum dilution with ability to alter the morphology of HT29/C1 cells and expressed as the mean ± standard deviation of results from four experiments. Statistical analyses were analyzed by the Student's t test (paired); a P value of <0.05 was considered statistically significant.

^bP = 0.008 versus cell-free culture supernatants of ETBF 86-5443-2-2.

^cP = 0.006 versus cell-free supernatants of NCTC 9343 expressing P-BFT.

^dP = 0.03 versus whole-cell lysate of ETBF 86-5443-2-2.

^eP = 0.21 versus whole-cell lysate of NCTC 9343 expressing P-BFT.

To determine if the absence or decrease of biologic activity in the culture supernatants might be due to an unrecognized secretion defect in strains containing mutant BFTs, we also evaluated the toxin activity of whole-cell lysate preparations of the strains expressing mutant BFTs. Again, we observed that, in contrast to whole-cell lysate preparations of ETBF 86-5443-2-2 and 9343(pFD340::P-bft), preparations of NCTC 9343 expressing BFT-H348D, BFT-E349A, BFT-H352Y, BFT-H358Y, and BFT-M366R did not have toxin activity on HT29/C1 cells. Whole-cell lysate preparations of NCTC 9343 expressing mutant BFT-G355R had toxin activity similar to preparations of NCTC 9343 expressing P-BFT (P = 0.21) (Table 2).

We next determined whether mutation of the zinc-binding metalloprotease motif and conserved methionine residue (M366) affect cleavage of E-cadherin. By use of the method described by Wu et al. (37), no cleavage of intact 120-kDa E-cadherin was detected in HT29/C1 cells treated with cell-free culture supernatants of NCTC 9343 expressing BFT-H348D, BFT-E349A, BFT-H352Y, BFT-H358Y, and BFT-M366R. In contrast, similar to the case with cells treated with cell-free culture supernatants of NCTC 9343 expressing P-BFT, near complete loss of intact E-cadherin immunostaining was observed in cells treated with cell-free culture supernatants of NCTC 9343 expressing mutant BFT-G355R (Fig. 3).

FIG. 3.

Cleavage of E-cadherin after 1 h of treatment with cell-free culture supernatants of NCTC 9343 expressing P-BFT (lane 1), BFT-H348D (lane 2), BFT-E349A (lane 3), BFT-H352Y (lane 4), BFT-G355R (lane 5), BFT-H358Y (lane 6), and BFT-M366R (lane 7). Untreated HT29/C1 cells (lane 8) were included as the negative control. Similar amounts of HT29/C1 cell lysate preparations (10 μg) were analyzed by Western blotting using antibodies against E-cadherin (Decma antibody; Sigma). The housekeeping protein actin revealed approximately equal amounts of protein concentration in all lanes.

Lastly, we assessed the role of the zinc-binding metalloprotease motif in the induction of IL-8 secretion. The levels of IL-8 in HT29/C1 cell culture supernatants were determined by enzyme-linked immunosorbent assay as previously described (39). Cell-free culture supernatants of NCTC 9343 expressing wild-type BFT (P-BFT) stimulated significantly more IL-8 secretion than cell-free culture supernatants of ETBF 86-5443-2-2 (P < 0.001) (Fig. 4). However, even though mutant BFTs are expressed similarly to P-BFT (Fig. 1), cell-free culture supernatants of NCTC 9343 expressing BFT-H348D, BFT-E349A, BFT-H352Y, BFT-H358Y, and BFT-M366R yielded IL-8 secretion similar to the negative controls (i.e., HT29/C1 cells stimulated with cell-free culture supernatants of NCTC 9343 containing vector pFD340 and untreated cells). Cell-free culture supernatants of NCTC 9343 expressing BFT-G355R stimulated IL-8 secretion by HT29/C1 cells but at a significantly lower level than cell-free culture supernatants of NCTC 9343 expressing P-BFT (P = 0.005).

FIG. 4.

IL-8 secretion by HT29/C1 cells stimulated with supernatants of NCTC 9343 expressing wild-type and mutant BFT. HT29/C1 cells were stimulated for 16 h. The results are shown as the means ± standard errors of three experiments. The P value for cell-free culture supernatants of NCTC 9343 expressing wild-type P-BFT versus mutant BFT-G355R was 0.005; the P value for cell-free culture supernatants of NCTC 9343 expressing mutant BFT-G355R versus cell-free culture supernatants of ETBF 86-5443-2-2 was 0.008; the P value for cell-free culture supernatants of NCTC 9343 expressing wild-type P-BFT versus ETBF 86-54-43-2-2 was 0.0004; the P value for cell-free culture supernatants of ETBF 86-5443-2-2 versus NCTC 9343 containing pFD340 was 0.0003.

Our results indicated that BFT processing does not require an active catalytic domain. Thus, processing of BFT mutants is hypothesized to occur via other intracellular B. fragilis proteases and not by an autoproteolytic mechanism. Similar results indicate that processing and secretion of the LasA protease of Pseudomonas aeruginosa does not require an intact protease catalytic domain (11). The inactivity of the BFT mutants was not attributable to an expression and/or secretion defect, since mutant and wild-type bft genes were overexpressed in NCTC 9343 compared to bft expression by the highly toxigenic strain 86-5443-2-2 (Fig. 1), and neither cell-free culture supernatants nor whole-cell lysate preparations of B. fragilis expressing mutant BFT had toxin activity on HT29/C1 cells (Table 2). Mutation of the zinc-binding metalloprotease motif must affect zinc-binding and/or hydrolysis of the substrate. X-ray crystallographic analyses of members of the thermolysin and metzincin superfamilies showed that the three His (H) residues of the zinc-binding metalloprotease motif serve as ligands for zinc (9, 20, 35). Thus, mutations in these amino acid residues are predicted to affect zinc binding. Mutations in analog His residues (H-686 and H-690) in anthrax toxin lethal factor fully inactivate biologic activity (16). Similarly, a mutation in the His (H-120) residue in the LasA protease of P. aeruginosa blocks enzymatic activity without affecting processing or secretion of the protein (11). The Glu residue in the zinc-binding metalloprotease motif is believed to transfer hydrogen atoms and to polarize a zinc-bound water molecule for nucleophilic attack on the scissile peptide-bound substrate. Mutation in this amino acid residue is predicted to result in loss of activity due to interference with this hydrolysis step and not due to a change in the binding of the substrate or zinc (20, 35). Replacement of Glu with Ala (similar to our mutation) in pregnancy-associated plasma protein A, a metalloprotease that has an elongated zinc-binding metalloprotease motif similar to that of BFT, also causes a complete loss of activity (2). The Gly residue and the Met residue located 7 amino acid residues downstream of the motif give an appropriate conformation (Gly turn and Met turn) stabilizing the zinc ligand (20, 35). Our results show that, in contrast to the Met mutation as well as mutation of the three His and Glu residues, BFT containing a mutated Gly (G355) has residual activity to cleave E-cadherin, alter the morphology of HT29/C1 cells and induce IL-8 secretion by these cells. In contrast to cell-free culture supernatants, whole-cell lysate preparations of NCTC 9343 expressing BFT-G355R had a similar level of toxin activity as whole-cell lysates of NCTC 9343 expressing wild-type P-BFT. In addition to giving the appropriate conformation to the zinc-binding motif, the conserved methionine residue in the metzincin superfamily has also been shown to increase the hydrophobicity in the catalytic site that enhances zinc binding to the His residues (1). Thus, replacement of the hydrophobic Met by a basic amino acid (Arg) may also affect zinc binding.

Analysis of the three-dimensional structures of representative members of the MMPs showed that the first half of the elongated zinc-binding metalloprotease motif forms consensus α helices termed the active-site helix, suggesting that this structure is important to the protein activity (9). Secondary structure analysis of wild-type versus mutant BFTs by using the sequence analysis software DNAMAN version 5.2.9 (Lynnon BioSoft, Quebec, Canada) predicts that only the tyrosine replacement of H352 does not affect the structure of the putative active-site helix (http://www.jhu.edu/etbf/table3.htm). However, substitution at all other conserved amino acid residues alters the length of the active-site helix or modifies its structure. Even though replacement of H352 with Tyr does not predict any structural changes in the active-site helix, this mutation blocks all BFT biologic activity in vitro.

In conclusion, our results with the B. fragilis expression system indicate that single-point mutations in the zinc-binding metalloprotease motif do not affect BFT processing but do reduce or eliminate BFT biologic activity in vitro. Future studies will focus on defining the structure-function relationships of the C- and N-terminal domains of BFT.