Skip to main content
Food Science & Nutrition logoLink to Food Science & Nutrition
. 2025 Apr 22;13(4):e70194. doi: 10.1002/fsn3.70194

Propolis Extract Reduces Doxorubucin‐Induced Brain Damage by Regulating Inflammation, ER Stress, Oxidative Stress, and Apoptosis

Volkan Gelen 1,✉, Mehmet Başeğmez 2, İnan Dursun 3,4,✉, Irfan Çinar 5, Adem Kara 6
PMCID: PMC12014397  PMID: 40270939

ABSTRACT

Doxorubicin (DOX) is the most widely used chemotherapeutic agent to treat various tumors. DOX treatment can damage many organs, including the brain, by causing oxidative stress. Several antioxidant substances can lessen the effects of DOX or make antioxidant defense systems work faster. Propolis (PROP) is a powerful agent with various healing effects, including antioxidant, antiproliferative, and anti‐inflammatory. The point of this study is to look at the histopathological changes, apoptosis, and antioxidant effects of DOX on brain damage in rats. To find out what kinds of phytochemicals were in PROP from the Karlıova region of Bingöl province, ultra‐high‐performance liquid chromatography (UHPLC‐Orbitrap‐HRMS) was used. Then, we made an ethanol extract of it. A total of 28 healthy male Wistar albino rats, each 12 weeks old and weighing between 220 and 250 g, were included in the study. Rats were divided into four groups: control, PROP, DOX, and PROP+DOX. We applied the relevant treatments to the determined groups. Following the application, we decapitated the rats under the appropriate conditions and collected blood and brain tissue samples. We examined oxidative stress parameters in blood samples and used brain tissue samples for histopathological, biochemical, and molecular analyses. We determined DOX levels in the brain tissue samples using UHPLC‐Orbitrap‐HRMS. The findings obtained showed that the PROP extract improved DOX‐induced brain tissue damage. In addition, PROP extract attenuated DOX‐induced brain tissue inflammation, ER stress, apoptosis, and oxidative stress.

Keywords: apoptosis, DOX, inflammation, oxidative stress, propolis extract, UHPLC‐Orbitrap‐HRMS


PROP demonstrated protective effects against DOX‐induced oxidative stress, inflammation, and apoptosis in brain tissue by reducing MDA levels while increasing GSH, SOD, and CAT activities. It also attenuated DOX‐induced increases in inflammatory and apoptotic markers such as TNF‐α, IL‐1β, IL‐6, NF‐kB, iNOS, and CASP‐3 while restoring PI3K, mTOR, AKT activity, and BCL2/BAX expression. Histopathological and molecular analyses confirmed that PROP alleviated neuronal degeneration and modulated key signaling pathways, highlighting its neuroprotective potential.

graphic file with name FSN3-13-e70194-g009.jpg

1. Introduction

Doxorubicin (DOX) is an anthracycline group antineoplastic agent used in various cancer treatments. Oxidative stress in multiple tissues limits the therapeutic use of the drug in cancer treatment. Free radicals, membrane lipid peroxidation, apoptosis, and inflammation have all been linked to DOX‐induced neurotoxicity (Cagel et al. 2017). The chemical structure of DOX increases oxidative stress and causes cell damage by allowing the formation of free radicals (Alavi and Varma 2020). Under normal conditions, reactive oxygen species produced by aerobic metabolism are constantly inhibited. The antioxidant defense systems in the organism carry out this work, preventing any pathological event from occurring. The organism is not hurt by free radicals as long as the balance between the rate of formation and the strength of the defense systems is not upset. When this balance is disrupted against the antioxidant systems, potential damage occurs, which is called ‘oxidative stress’ (Alavi and Varma 2020; Lesniak et al. 2005; Gu et al. 2021). DOX is one of the causes of the imbalance between free oxygen radicals and antioxidants (Vyas et al. 2020). Tissue damage is seen as protein oxidation and lipid peroxidation in the tissue (Vyas et al. 2020). This is because the oxidant and antioxidant systems are not working together properly. Free radicals and antioxidant enzymes are thought to play a part in DOX‐induced toxicity. This has led to plans to study antioxidant treatments (Sannasimuthu et al. 2019). Some antioxidative agents are used to reduce the possible side effects of anticancer drugs and the oxidative stress that may occur. Various studies (El‐Agamy et al. 2019) have reported the effects of some antioxidants on DOX‐induced damage. One of the most important antioxidant compounds is PROP extract, which contains multiple components. In the past few years, it has become more popular and important to use natural PROP extract to treat and prevent the side effects of chemotherapy (Morean et al. 2015). For this reason, researchers have started to search for natural substances with proven biological effects along with the tendency to use natural substances in this regard. PROP, a natural product that is gaining increasing importance today, is a sticky, dark‐colored resinous substance that honey bees collect from living parts of plants by adding salivary enzymes to them, mixing them with wax, and using them in the hive for various purposes. PROP is a popular medicine in folk medicine, apitherapy, cosmetics, and the pharmaceutical industry. It is used for many things because it has biological activities like anti‐inflammatory, antitumor, anti‐ulcerative, and immunostimulant properties, as well as antibacterial, antiviral, and antifungal properties (Zulhendri et al. 2022; Valverde et al. 2023). The point of this study is to look at how PROP, a naturally occurring substance that has many known biological effects and is easy to get, can protect the brains of rats that have been damaged by DOX. We will do this by using biochemical, molecular, and histopathological findings.

2. Materials and Methods

2.1. Propolis Extraction

Samples of PROP were purchased fresh directly from beekeepers in the Karlıova region of Bingöl province and stored at −80°C until extraction. PROP ethanol extract preparation involves freezing at −80°C to harden it, followed by grinding it into a powder using a laboratory mill. Subsequently, 500 g of PROP are placed in a 2.5 L amber glass bottle, to which 2 L of HPLC‐grade ethanol is added. After 30 min of ultrasonic treatment and stirring at 500 rpm with a magnetic stir bar at room temperature in the dark for 7 days, the solution is filtered through coarse filter paper and then through a blue band filter paper using a vacuum filtration system. We evaporate the resulting filtrate in a rotary evaporator at 40°C under a vacuum. We store the obtained PROP extract in amber glass containers at 4°C in the dark until use.

2.2. Experimental Protocol

2.2.1. Animals and Experimental Model

The study was conducted under the authorization of the Pamukkale University Animal Experiments Local Ethics Committee, with reference number PAUHDEK‐2023/33. All animals were treated according to the Use of Animals and ARRIVE guidelines. A total of 28 healthy male Wistar albino rats, each 12 weeks old and weighing between 220 and 250 g, were included in the study. During the 10‐day study period, rats were housed in a 50%–55% humidity, 22°C ± 1°C temperature, and 12‐h light/dark environment under veterinary control. Rats in Group I (control group) were administered 0.5 mL of ethanol orally. Rats in Group II were administered PROP extract by gastric gavage at a dose of 200 mg/kg/day. Group III rats received DOX intraperitoneally at a dosage of 2 mg/kg, administered five times every other day. DOX was given to Group IV rats intraperitoneally five times every other day at a dose of 2 and 200 mg/kg of PROP extract was given by gastric gavage for 10 days (Table 1).

TABLE 1.

Groups and applications.

Group name Application
Control (n = 7) Rats in this group were administered 1 mL of 5% ethanol by gavage for 10 days
PROP (n = 7) The rats in this group were given PROP extract at a dose of 200 mg/kg by gavage for 10 days
DOX (n = 7) DOX was administered at a dose of 2 mg/kg I.P. 5 times every other day
DOX + PROP (n = 7) Rats in this group were administered PROP extract at a dose of 200 mg/kg via gavage for 10 days, as well as DOX at a dose of 2 mg/kg I.P. 5 times every second day

2.2.2. Collection of Blood and Tissue Samples

We took blood samples from the abdominal aorta of rats that had been asleep for 12 h on xylazine (0.01 mg/g per body weight) and ketamine (0.04 mg/g per body weight). Blood samples from the abdominal aorta were collected in anticoagulated EDTA tubes. Following the collection of blood samples, we sacrificed the rats and extracted brain tissue samples for biochemical, histopathological, and molecular analyses. Brain tissue samples were stored at −80°C until the day of analysis.

2.2.3. Preparation of Erythrocytes

We centrifuged the tubes at 3000 rpm for 15 min at 4°C, approximately 1 h after blood collection. We transferred the obtained plasma samples into Eppendorf tubes and stored them at −20°C until analysis. Phosphate buffer solution (PBS) (pH 7.4) was added to the red blood cell packet remaining at the bottom of the EDTA tube. Then, the tubes with PBS were centrifuged at 3500 rpm for 15 min at 4°C. Washing with a PBS solution and centrifugation were repeated three times. PBS solution was then added to the erythrocyte packs in a 1:1 volume ratio. The packs were then kept at −20°C until they were analyzed. Whole blood was used for MDA and GSH levels, and erythrocyte homogenate samples were used for SOD and CAT activity measurements.

2.2.4. Biochemical Analysis

2.2.4.1. Analysis of Oxidative Stress Parameters

The amount of malondialdehyde (MDA), which is a sign of oxidative damage, was measured in whole blood using the method of Draper and Hadley (1990) and given as nmol/mL. The amount of glutathione (GSH) in whole blood was found using spectrophotometry, as described by Beutler et al. (1963). The results were given as nmol/mL for whole blood. Superoxide dismutase (SOD) and catalase (CAT) antioxidant enzyme activities in erythrocyte homogenate were measured according to the methods of Sun et al. (1988) and Luck (1955) and expressed as U/gHb and k/gHb, respectively. The brain tissues were thoroughly washed with cold 0.9% sodium chloride (NaCl) solution. Following this, they were homogenized in 0.1 M phosphate buffer (pH = 7.4) at a ratio of 1:40 (w/v). The resulting homogenates were then centrifuged at 5000 rpm for 15 min, according to the method described by Acaroz et al. Following this, the levels of malondialdehyde (MDA), glutathione (GSH), superoxide dismutase (SOD), and catalase (CAT) were assessed in the supernatants obtained from the centrifuged brain tissue samples.

2.2.4.2. Measurement of PI3K/Akt/mTOR Parameters in Brain Tissue Samples by ELISA Method

We took samples from brain tissues stored at −80°C and weighed them. Tissue samples were homogenized by mixing with PBS. After homogenization, they were centrifuged in a refrigerated centrifuge at 3000 rpm for 20 min. The supernatants obtained were transferred to a separate tube. Samples taken from the prepared supernatants were measured according to the procedure in the commercial ELISA kit (PI3K (201‐11‐0439 Sunred), PKB (201‐11‐0202, Sunred), mTOR (201‐11‐4241, Sunred)), and the results were calculated.

2.2.5. Gene Expression Analysis

We used the Real‐Time PCR method to compare the levels of TNF‐α, IL‐1β, IL‐6, NF‐kB, nNOS, iNOS, Caspase‐3, and BCL2/BAX mRNA in the brain tissues from the different groups.

2.2.5.1. Real‐Time PCR Analysis
2.2.5.1.1. Quantitative Determination of mRNA Expression by Real‐Time PCR

Tissue samples (25–30 μg) were homogenized in a Tissuelyser II (Qiagen) device with liquid nitrogen. RNA extraction will continue in the QIAcube RNA isolation device as the manufacturer recommends (Qiagen, RNeasy Mini Kit, Cat no./ID. 74,104). Total RNA extraction and cDNA synthesis (Applied Biosystems, High‐Capacity cDNA Reverse Transcription Kit, Cat. No. 4368814) were performed according to the methods described in our previous studies [24]. According to the manufacturer's instructions, TNF‐α, IL‐1β, IL‐6, NF‐kB, nNOS, iNOS, Caspase‐3, BCL2/BAX, and β‐actin mRNA expression as a housekeeping gene were analyzed. It was used by synthesizing the gene identified through literature scanning and gene bank control. In addition, the primers used in the study are given in Table 2. Compared with the control group, all data were expressed as fold change in expression compared with the cell groups using the 2−ΔΔCt method.

TABLE 2.

Rat primers used for RT‐PCR.

Target gene Primer sequence: 5′‐3′
TNF‐α F CCAGGAGAAAGTCAGCCTCCT
R TCATACCAGGGCTTGAGCTCA
IL‐6 F TCCTACCCCAACTTCCAATGCTC
R TTGGATGGTCTTGGTCCTTAGCC
IL‐1β F CACCTCTCAAGCAGAGCACAG
R GGGTTCCATGGTGAAGTCAAC
NFkB F ATCATCAACATGAGAAACGATCTGTA
R CAG CGG TCC AGA AGA CTC AG
nNOS F CGACCAATACTACTCATCCA
R CTCCTTGTTCACCTCCTC
iNOS F CACCACCCTCCTTGTTCAAC
R CAATCCACAACTCGCTCCAA
BAX F ACCAAGAAGCTGAGCGAGTG
R CCAGTTGAAGTTGCCGTCTG
BCL‐2 F CTGGTGGACAACATCGCTCT
R GCATGCTGGGGCCATATAGT
Caspase‐3 F GGAGCTTGGAACGCGAAGAA
R ACACAAGCCCATTTCAGGGT
β‐Actin F TGTTACAGGAAGTCCCTTGCC
R AATGCTATCACCTCCCCTGTG

2.2.6. Western Blot Analysis

We wanted to find out how much reticulum stress, apoptosis, and inflammatory marker protein were present in the brain tissue samples from the experimental groups. To prepare the brain tissue samples for western blot analysis, they were kept at −80°C in a deep freezer. The brain tissue samples were weighed and then crushed in nitrogen gas. They were then used for radioimmunoprecipitation with RIPA buffer (Ecotech Bio, Turkey) that had been strengthened with protease and phosphatase inhibitors. Next, we homogenized the samples using a tissue disruptor (Qiagen, USA) for 20 s at 30 Hz. It establishes the relative levels of ATF6, IRE1, and TLR4 protein expression. We established the overall protein content in the brain tissue. After 10% SDS‐PAGE was used to separate the proteins, 30 μg of protein was added to the PVDF membrane. Membranes were first blocked with 5% bovine serum albumin for 90 min at room temperature. We then left the membranes overnight at 4°C to treat them with the corresponding primary antibodies. PVDF membranes were treated with primary antibodies for 90 min at room temperature. After that, they underwent a TBST wash and were left to incubate with a secondary antibody linked to horseradish peroxidase for an additional 90 min. Protein bands were then identified and examined using the enhanced chemiluminescence reagent Western ECL substrate (Thermo, 3405), and images were captured (Image Lab Software, Bio‐Rad, Hercules, CA, USA). β‐actin was used for the normalization of protein expression levels. For this purpose, the normalization process was performed by dividing the intensity of the target protein by the intensity of β‐actin.

2.2.7. Histopathological Evaluation

The brain tissues of rats in all experimental groups were removed at the end of the experiment and were transferred to 10% neutral buffered formalin solution and fixed for 72 h. Brain tissue samples were dried out by running them through a series of increasing alcohol grades (70%, 80%, 96%, and 100%). The tissue was then cleaned with xylene and paraffin infiltrated to make tissue blocks. Then, a rotary microtome (Leica RM2125 RTS) was used to cut brain tissue blocks into 5 μm thick slices that were then put on slides. We stained the slides using Crossman's Modified Mallory's Triple Staining method for histopathological evaluations. Finally, the preparations were examined and photographed at 200x magnification using a light microscope (Zeiss AXIO Scope.A1) with a modified imaging system. Neuropathological damage in the cerebral cortex was reinterpreted using a scoring system from 0 to 4: 0 meant there was no change, 1 meant less than 10% of the affected area, 2 meant 20%–30% of the affected area, 3 meant 40%–60% of the affected area, and 4 meant more than 60% of the affected area (Ibrahim Fouad and Ahmed 2021).

2.2.8. Analysis of DOX in Brain Tissues and Phytochemical Content Analysis in PROP Extract Using Ultra‐High‐Performance Liquid Chromatography‐Orbitrap‐High‐Resolution Mass Spectrometry (UHPLC‐Orbitrap‐HRMS)

About 1 g of brain tissue samples was taken and put into 2 mL locked Eppendorf tubes so they could be prepared for DOX analysis. To these samples, 500 μL of pH 7.4 phosphate‐buffered saline (PBS) and 500 μL of methanol were added to ensure homogenization. This process was carried out for 15 min using steel beads in the Qiagen Tissue Lyser II device. The homogenized tissue samples were centrifuged at 15,000 rpm for 15 min at 4°C, and the resulting supernatant was stored for analysis. The stock PROP solution was diluted in a solution of 50% methanol and 50%, 0.5% acetic acid in water to adjust the concentration to 1 mg/mL. Before analysis, all samples were passed through a 0.22 μm pore size and 25 mm diameter PTFE (MARZ Shuller) syringe filter using a 10 mL syringe and transferred to 1.5 mL capped vials.

The analysis of DOX in brain tissues and the phytochemical content analysis of PROP extract were carried out using Thermo Fisher Scientific's Exactive Plus Orbitrap mass spectrometer. Chromatographic separation was achieved with the DIONEX UltiMate 3000 RS pump, DIONEX UltiMate 3000 RS autosampler, and DIONEX UltiMate 3000 RS column oven. A MerckPurosper STAR RP‐18 endcapped Hibar HR model UHPLC column (100 mm × 2.1 mm, 3 μm) was used, with the column oven temperature set at 30°C and a mobile phase flow rate of 0.3 mL/min. Mobile phase A consisted of 0.5% acetic acid in water, while mobile phase B was LC–MS grade methanol. The gradient elution was set as follows: 0–2 min: 100% A‐0% B; 2–15.5 min: 0% A‐98% B (ramp); 15.5–15.9 min: 98% B; 16–16.1 min: 100% A‐0% B; 16.1–19 min: 100% A‐0% B. The total method runtime was 20 min, with an injection volume of 20 μL. Mass detection was performed using the Exactive Plus mass spectrometer manufactured by Thermo Fisher Scientific Inc. (Waltham, MA, USA). Ionization was conducted with a heated electrospray ionization (HESI‐II) probe. The HRMS operated in negative electrospray ionization (‐ESI) mode with a mass scan range of 100 to 800 m/z, a negative mode spray voltage of 3.5 kV, a sheath gas flow rate of 35 units, an auxiliary gas flow rate of 7 units, a spare gas flow rate of 0 units, a capillary temperature of 350°C, an auxiliary gas temperature of 350°C, an S‐lens RF level of 50, and a maximum injection time (IT) set to 2 ms. Mass spectra were acquired using two distinct acquisition modes: (1) Full MS mode without fragmentation, with the high‐energy collisional dissociation (HCD) cell closed, and (2) All Ion Fragmentation (AIF) mode with MS/MS fragmentation and HCD open (collision energy = 25 eV). Automatic Gain Control (AGC) was set to 3 × 106. The resolution was 17,500 for both Full MS and AIF modes (Dursun et al. 2025).

2.3. Statistical Analysis

SPSS 27.0 (SPSS Inc., Chicago, IL, USA) was used for statistical analysis. GraphPad Prism 9.05 (GraphPad Software, San Diego, CA, USA) was used for graphical presentations. All results are expressed as the mean ± standard error of the mean (SEM). The normality of the data was found to be normally distributed by the Shapiro–Wilk test. In addition, the homogeneity of the data was demonstrated with the homogeneous variance test. To compare multiple groups, the one‐way ANOVA and Duncan test were utilized. The statistical significance level was determined as p < 0.05.

3. Results

3.1. Effects of PROP on Oxidative Stress Parameters in DOX‐Induced Brain Tissue

DOX (DOX) significantly raised MDA levels in whole blood (Table 3) compared to the control group (p < 0.05). PROP efficiently decreased the levels of MDA in the DOX + PROP groups (p < 0.05). DOX significantly decreased GSH levels compared to the control group (p < 0.05). PROP significantly raised GSH levels in the DOX + PROP group (p < 0.05). The level of SOD was considerably lower in the group administered DOX compared to the other groups in the study (p < 0.05). PROP supplementation significantly increased SOD levels in the PROP group compared to the other study groups (p < 0.05). DOX significantly reduced CAT levels compared to the control group and other study groups (p < 0.05). PROP significantly increased CAT enzyme activity in the DOX + PROP group (p < 0.05). Doxorubicin (DOX) significantly raised MDA levels in brain tissues (Table 4) compared to the control group (p < 0.05). Propolis (PROP) significantly decreased the levels of MDA in the DOX + PROP groups (p < 0.05). DOX considerably decreased GSH levels compared to the control group (p < 0.05). PROP significantly raised GSH levels in the DOX + PROP group (p < 0.05). DOX efficiently decreased SOD levels compared to the control group (p < 0.05). PROP increased SOD levels, but this did not reach statistical significance (p > 0.05). DOX substantially reduced CAT levels compared to the control group and other study groups (p < 0.05). PROP significantly increased CAT enzyme activity in the DOX + PROP group (p < 0.05).

TABLE 3.

Effects of DOX and PROP on malondialdehyde and glutathione levels in the whole blood and superoxide dismutase and catalase activities in the erythrocyte homogenate of rats.

Groups MDA (nmol/mL) GSH (nmol/mL) SOD (U/gHb) CAT (k/gHb)
Control 2.27 ± 0.36 bc 33.65 ± 1.53 b 18.80 ± 0.68 b 17.46 ± 0.45 a
PROP 2.05 ± 0.20 c 43.50 ± 3.07 a 29.31 ± 1.02 a 19.30 ± 0.74 a
DOX 4.56 ± 0.45 a 24.21 ± 2.06 c 13.14 ± 0.79 c 11.87 ± 0.74 c
DOX + PROP 3.14 ± 0.30 b 35.20 ± 2.10 b 16.73 ± 1.22 b 15.13 ± 0.98 b

Note: The values were expressed as means ± SEM (n: 7). a,b,cDifferent letters in the same column represent statistically significant differences (p < 0.05).

Abbreviations: CAT, catalase; GSH, glutathione; MDA, malondialdehyde; SOD, superoxide dismutase.

TABLE 4.

Effects of doxorubicin and propolis on malondialdehyde (MDA) and glutathione (GSH), superoxide dismutase (SOD), and catalase (CAT) levels in brain tissue of rats.

Groups MDA (nmol/g tissue) GSH (nmol/g tissue) SOD (U/μg protein) CAT (U/μg protein)
Control 0.27 ± 0.02 bc 18.13 ± 0.69 b 10.47 ± 1.72 ab 2.23 ± 0.14 ab
PROP 0.22 ± 0.03 c 23.64 ± 0.89 a 11.02 ± 1.86 a 2.47 ± 0.06 a
DOX 0.47 ± 0.05 a 12.38 ± 0.37 c 7.39 ± 1.57 c 1.81 ± 0.03 c
DOX + PROP 0.38 ± 0.04 b 16.62 ± 0.45 b 8.46 ± 1.65 bc 2.15 ± 0.06 bc

Note: The values were expressed as means ± SEM (n: 7). a,b,cDifferent letters in the same column represent statistically significant differences (p < 0.05).

Abbreviations: CAT, catalase; GSH, glutathione; MDA, malondialdehyde; SOD, superoxide dismutase.

3.2. Effects of PROP on PI3K, mTOR, and Akt Activities in DOX‐Induced Brain Tissue

After spectrophotometric analysis, we determined that PI3K and AKT activity and mTOR levels were decreased in brain tissue samples obtained from the DOX group. However, we determined that the PROP application attenuated the DOX‐induced decrease in PI3K, mTOR, and AKT activity (Figure 1; p < 0.05).

FIGURE 1.

FIGURE 1

PI3K (A) and AKT activity (B) and mTOR levels (C) in brain tissue samples obtained from experimental groups. Different letters indicate statistical differences between groups (p < 0.05).

3.3. Effects of PROP on Inflammation and Apoptosis Parameters in DOX‐Induced Brain Tissue

After real‐time PCR analyses, we determined that TNF‐α, IL‐1β, IL‐6, NF‐kB, iNOS, and CASP‐3 mRNA expression levels increased in brain tissue samples obtained from the DOX group. However, we determined that PROP application attenuated the DOX‐induced increase in TNF‐α, IL‐1β, IL‐6, NF‐kB, iNOS, and CASP‐3 mRNA expression levels (Figure 2; p < 0.05). On the other hand, we determined that nNOS and BCL2/BAX mRNA expression levels decreased in brain tissue samples obtained from the DOX group. However, we determined that PROP application attenuated the DOX‐induced decrease in nNOS and BCL2/BAX mRNA expression levels (Figure 3; p < 0.05).

FIGURE 2.

FIGURE 2

TNF‐α (A), IL‐1β (B), IL‐6 (C), and NF‐kB (D) mRNA expression levels in brain tissue samples obtained from experimental groups. Different letters indicate statistical differences between groups (p < 0.05).

FIGURE 3.

FIGURE 3

nNOS, iNOS, CASP‐3, and BCL2/BAX mRNA expression levels in brain tissue samples obtained from experimental groups. Different letters indicate statistical differences between groups (p < 0.05).

3.4. Western Blot Analysis Results

To evaluate the immune response and endoplasmic reticulum stress response in brain tissue samples obtained from experimental groups, TLR4, IRE1, and ATF6 protein expression was evaluated. We determined that TLR4, IRE1, and ATF6 protein expression levels increased in brain tissue samples obtained from the DOX group. However, we determined that PROP application attenuated the DOX‐induced increase in TLR4, IRE1, and ATF6 protein expression levels (Figure 4; p < 0.05).

FIGURE 4.

FIGURE 4

Relative protein expression of TLR4, IRE1, and ATF6 in brain tissue samples obtained from experimental groups. Different letters indicate statistical differences between groups (p < 0.05).

3.5. Histopathological Findings

No histopathological changes were detected in the control and PROP groups, and the brain tissues had a normal histological appearance. It was observed that most pyramidal neurons in the cerebral cortex areas in the DOX group were degenerated and vacuolated. In the DOX + PROP group, neuronal degeneration and vacuolation were significantly reduced and remained quite limited compared to the group exposed to DOX (Figure 5). It was determined that neuronal damage scores increased in the DOX group compared to the other groups. It was noted that the application of PROP together with DOX reduced neuronal damage scores. Sample images of all findings are presented in Figure 5, and the graph of histopathological scoring is presented in Figure 6.

FIGURE 5.

FIGURE 5

Rat brain tissue, frontal cortex histopathology, Crossman's Modified Mallory's Triple Stain, ×200 magnification, scale bar 50 μm. Arrow: Degenerated neurons and perineuronal vacuolization.

FIGURE 6.

FIGURE 6

Evaluation of neuronal damage in the cerebral cortex. Values are given as mean ± SD (n = 7) and analyzed by one‐way ANOVA followed by Tukey's test. Asterisk indicates statistically significant differences between groups (*p < 0.05; **p < 0.001; ns: Insignificant).

3.6. Method Validation and Results Obtained for the Analysis of DOX in Brain Tissues Using UHPLC‐Orbitrap‐HRMS

The analysis of DOX in samples was conducted using UHPLC‐Orbitrap‐HRMS. A DOX standard stock solution was prepared in methanol at 1000 μg/kg. Spikes were added to control samples without DOX to prepare matrix‐effect calibration for the analysis of DOX in brain tissue samples. The DOX standard was then diluted in 50% methanol‐50%, 0.5% acetic acid in an ultrapure water mixture to obtain 10, 20, 40, 60, 80, and 100 μg/kg concentrations. These prepared standard mixtures were analyzed using UHPLC‐Orbitrap‐HRMS to create matrix‐effect calibration curves. The Quan Peak (Parent Ion) and Fragment Ions (m/z) (Confirming Ion) chromatograms for 10 μg/kg were presented in matrix‐effect calibration Figure 7. In contrast, those for 100 μg/kg were shown in the matrix‐effect calibration 100 μg/kg Figure 8. Brain tissue samples were evaluated based on the prepared calibration graphs.

FIGURE 7.

FIGURE 7

UHPLC‐Orbitrap‐HRMS Quan Peak (Parent Ion), Confirming Ion (m/z) (Fragment Ions) Chromatograms, and Matrix‐Affected Calibration Curve for DOX at a Concentration of 10 μg/kg.

FIGURE 8.

FIGURE 8

UHPLC‐Orbitrap‐HRMS Quan Peak (Parent Ion), Confirming Ion (m/z) (Fragment Ions) chromatograms and matrix effect calibration curve of DOX at a concentration of 100 μg/kg.

The Quan Peak (Parent Ion) and Confirming Ions (Fragment Ions) of DOX, retention time (RT), concentration ranges, determination coefficient (R 2) of the calibration curve, limit of detection (LOD) (μg/kg), limit of quantification (LOQ) (μg/kg), recovery, and recovery RSD (%) analytical parameters were determined by spiking six control samples without DOX with a concentration of 10 μg/kg. These parameters are presented in Table 5.

TABLE 5.

Analytical parameters for the UHPLC‐Orbitrap‐HRMS analysis of DOX.

Compound RT Quan Peak (m/z) Fragment Ions (m/z) Linear range (ng/mL) R 2 LOD (μg/kg) (n = 6) LOQ (μg/kg) (n = 6) % Recovery (n = 6) a % Recovery RSD (n = 6) ME b (n = 6) ME RSD
Parent Ion (m/z) Confirming Ion (m/z)
DOX 11.76 542.16678 395.07858 10–100 0,9968 0.59 1.97 96.82 2.04 0,972 3.240

Abbreviations: LOD, limit of detection; LOQ, limit of quantification; ME, matrix effect; R 2, correlation coefficient.

a

Percent recovery was calculated by multiplying the ratio of the average peak area of the analyte added before extraction to the average peak area of the analyte added after extraction by 100 (n = 6).

b

The matrix effect was determined by calibration curves obtained from a matrix solution spiked with DOX into brain tissue and a brain tissue solution without DOX matrix.

According to the results of DOX analysis performed on brain tissues using UHPLC‐Orbitrap‐HRMS; in the analysis where 10 μg/kg DOX concentration (Control +10 μg/kg DOX spike) was spiked to the control group for the accuracy and reliability of the analysis, 9.72 μg/kg DOX was detected and 97.2% recovery was achieved. In contrast, DOX was not detected in the control group or the other groups.

3.7. Method Validation and Results for the Analysis of Phytochemicals in PROP Extract by UHPLC‐Orbitrap‐HRMS

Method validations were conducted for UHPLC‐Orbitrap‐HRMS analyses to determine the 70 phytochemical profiles in the PROP extract. For the phytochemical compounds to be analyzed, retention time (RT), Quan Peak (m/z), ion mode (polarity), Confirming Ions (m/z), the correlation coefficient of calibration curves (R 2), and linear range (concentration ranges) (μg/L) were determined. One of the prepared PROP extracts was selected, and the analytes to be analyzed were diluted to a non‐signal level in the extract prepared by diluting the extract. Standard concentrations were prepared by adding 3 standard additions to determine the limit of detection (LOD) (μg/L) and limit of quantification (LOQ) (μg/L). The recovery percentage and recovery percentage RSD value were determined by spiking the sample at concentrations of 10 μg/L, and the analytical parameters were calculated and presented in Table 6. The TIC profile of phytochemical standard compounds in the PROP extract is shown in Figure 9.

TABLE 6.

Analytical parameters for UHPLC‐Orbitrap‐HRMS analysis of phytochemicals and identification of phytochemicals in PROP extract.

No Target compounds RT Parent Ion (m/z) Fragment Ions (m/z) Ion mode R 2 Liner range (μg/kg) 10 ng/mL (n = 3) μg/g PROP extract
Quan Peak (m/z) Confirming Ions (m/z) LOD (μg/kg) LOQ (μg/kg) % Recovery % Recover RSD
1 Benzoic acid 8.93 121.02950 121.02950 — 0.9913 10–1000 0.70 2.33 103.80 2.24 990.17
2 4‐Hydroxybenzoic acid 6.15 137.02442 93.03471 — 0.9921 10–100 1.92 6.39 112.48 5.68 60.73
3 Salicylic acid 9.9 137.02442 93.03468 — 0.9946 10–100 1.85 6.17 111.69 5.52 N.D.
4 3‐hydroxybenzoic acid 6.93 137.02442 93.03471 — 0.9926 10–100 1.55 5.15 109.45 4.71 N.D.
5 3‐hydroxyphenylacetic acid 6.79 151.04007 107.05045 — 0.9923 10–100 2.38 7.93 106.71 7.43 N.D.
6 Syringic acid 7.48 197.04555 197.04555 — 0.9949 10–100 1.53 5.09 108.09 4.71 N.D.
7 Gallic acid 0.79 169.01425 125.02461 — 0.9903 10–100 2.32 7.73 112.73 6.86 29.361
8 Protocatechuic acid 4.26 153.01933 109.02949 — 0.9908 10–100 2.46 8.19 83.59 9.80 N.D.
9 Protocatechuic acid ethyl ester 9.14 181.05063 108.02187 — 0.9905 10–100 4.58 15.26 70.58 21.62 N.D.
10 3,4‐dihydroxybenzaldehyde 5.64 137.02442 136.01671 — 0.9909 10–100 3.54 11.80 76.00 15.53 390.85
11 2.4‐dihydroxybenzoic acid 7.12 153.01933 67.01888 — 0.9935 10–100 1.48 4.92 109.00 4.51 N.D.
12 Vanillic acid 7.09 167.03498 108.02173 — 0.9938 10–100 1.82 6.07 111.39 5.45 65.3
13 Vanillin 7.6 151.04007 108.02178 — 0.9913 10–100 2.16 7.21 108.27 6.66 235.9
14 Gentisic acid 6.45 153.01933 153.01933 — 0.9913 10–100 0.66 2.22 103.06 2.15 N.D.
15 Trans Cinnamic acid 10.28 147.04515 147.04515 — 0.9952 10–100 1.82 6.06 102.10 5.94 435.91
16 p‐Coumaric acid 8.26 163.04007 119.05027 — 0.9928 10–1000 1.12 3.73 98.96 3.77 1612.25
17 Caffeic acid 7.21 179.03498 135.04509 — 0.9917 10–1000 1.16 3.88 107.04 3.62 3625.28
18 Caffeic acid phenhyl ester 11.99 283.09758 135.04526 — 0.9980 10–1000 1.94 6.46 101.78 6.34 2224.27
19 Ferulic acid 8.52 193.05063 134.03751 — 0.9933 10–1000 0.87 2.89 101.60 2.84 466.1
20 Sinapic acid 8.54 223.06120 193.01436 — 0.9934 10–100 1.32 4.39 105.72 4.15 17.17
21 Chlorogenic acid 7.03 353.08781 191.05624 — 0.9976 10–100 0.97 3.23 104.04 3.11 25.54
22 Quinic acid 1.24 191.05611 85.02962 — 0.9939 10–100 0.95 3.17 104.01 3.05 96.23
23 3‐(4‐Hydroxyphenyl) PROPionic acid 7.6 165.05572 108.02195 — 0.9927 10–100 2.35 7.83 95.49 8.20 54.91
24 α‐Cyano‐4‐hydroxycinnamic acid 9.26 188.03532 93.03470 — 0.9925 10–100 0.67 2.23 101.56 2.20 N.D.
25 Catechin 6.38 289.07176 109.02975 — 0.9943 10–100 1.40 4.65 108.28 4.30 N.D.
26 Chrysin 12.18 253.05063 253.05063 — 0.9907 10–1000 0.97 3.23 105.36 3.07 4830.50
27 Apigenin 11.28 269.04555 117.03464 — 0.9932 10–1000 1.42 4.72 105.45 4.48 1421.03
28 Acacetin 12.39 283.06120 268.03717 — 0.9911 10–100 2.48 8.27 111.99 7.39 328.24
29 Vicenin 2 7.83 593.15119 473.10941 — 0.9945 10–100 2.02 6.73 111.78 6.02 N.D.
30 Apigenin 7‐glucuronide 10.37 445.07763 269.04535 — 0.9923 10–100 1.36 4.52 103.63 4.37 N.D.
31 Apigenin 7‐glucoside 9.57 431.09837 269.04544 — 0.9947 10–100 1.45 4.83 108.28 4.46 N.D.
32 Genkwanin 12.39 283.06120 268.03745 — 0.9911 10–100 0.67 2.23 102.66 2.18 320.43
33 Apiin 9.44 563.14063 269.04498 — 0.9923 10–100 2.02 6.72 111.75 6.01 N.D.
34 Vitexin 8.69 431.09837 311.05603 — 0.9939 10–100 1.15 3.83 106.57 3.60 N.D.
35 Schaftoside 8.33 563.14063 443.09949 — 0.9908 10–100 1.81 6.05 105.55 5.73 N.D.
36 Rutin 9.23 609.14611 300.02777 — 0.9912 10–100 1.40 4.67 100.49 4.65 29.12
37 Luteolin 10.75 285.04046 175.04039 — 0.9932 10–1000 1.35 4.52 97.87 4.61 821.24
38 Luteolin‐7‐O‐glucuronide 9.76 461.07255 285.04056 — 0.9938 10–100 0.74 2.45 96.90 2.53 N.D.
39 Diosmetin 11.32 299.05611 122.90711 — 0.9954 10–1000 1.99 6.62 112.49 5.88 1200.8
40 Luteoloside 10.39 447.09328 285.04059 — 0.9946 10–100 1.20 3.99 101.24 3.94 N.D.
41 Luteolin 7‐rutinoside 8.99 593.15119 285.04065 — 0.9923 10–100 0.83 2.76 103.99 2.65 N.D.
42 Galangin 12.32 269.04555 269.04555 — 0.9936 10–1000 0.98 3.27 96.05 3.41 2500.91
43 Isoquercitrin 9.23 463.08820 300.02768 — 0.9939 10–100 0.75 2.49 104.33 2.39 3.6
44 Quercetin 10.47 301.03538 151.00342 — 0,9900 10–1000 0.73 2.42 97.04 2.49 1182.84
45 Narcissin 9.8 623.16176 315.05139 — 0.9918 10–100 1.36 4.53 99.85 4.54 16.5
46 Quercetin 3‐rutinoside 7‐glucoside 7.43 287.05536 135.04512 — 0.9934 10–100 0.23 0.77 98.86 0.78 N.D.
47 Isorhamnetin 11.25 315.05103 300.02780 — 0.9958 10–100 0.54 1.80 97.64 1.84 875.4
48 Kaempferol 9.23 285.04046 136.01686 — 0.9924 10–100 0.58 1.94 97.21 1.99 4.4
49 Afzelin 10.27 431.09837 285.04028 — 0.9951 10–100 1.43 4.77 97.78 4.88 N.D.
50 Kaempferide 10.28 299.05611 284.03265 — 0.9973 10–100 0.75 2.49 95.74 2.60 N.D.
51 Nicotiflorin 9.73 593.15119 285.04041 — 0.9915 10–100 0.90 3.00 96.67 3.10 7.32
52 Astragalin 9.76 447.09328 284.03281 — 0.9936 10–100 1.58 5.28 99.41 5.31 < LOQ
53 Leucoside 9.8 287.05536 151.00372 — 0.9934 10–100 0.52 1.73 100.70 1.72 174.6
54 Fisetin hydrate 9.88 285.04046 135.00900 — 0.9913 10–80 0.97 3.24 104.76 3.09 15.52
55 Naringenin 10.50 271.06120 119.05035 — 0.9946 10–1000 1.01 3.38 104.16 3.25 4310.7
56 Sakuranetin 11.7 285.07685 119.05032 — 0.9921 10–100 1.28 4.27 104.16 4.10 209.11
57 Narirutin 8.83 579.17193 271.06107 — 0.9926 10–100 1.39 4.63 103.35 4.48 N.D.
58 Liquiritigenin 9.85 255.06628 255.06592 — 0.9943 10–100 0.69 2.30 96.84 2.37 N.D.
59 Daidzin 8.05 415.10346 253.05191 — 0.9947 10–100 1.09 3.62 103.48 3.50 N.D.
60 Formononetin 11.38 267.06628 252.04263 — 0.9917 10–100 0.94 3.14 95.10 3.30 14.9
61 Ellagic acid 9.43 300.99899 300.99872 — 0.9943 10–100 1.11 3.71 106.75 3.47 75.8
62 Esculin hydrate 6.24 339.07216 177.01930 — 0.9960 10–100 1.18 3.94 104.58 3.77 6.9
63 Phloridzin 9.36 435.12967 273.07648 — 0.9924 10–100 1.64 5.48 108.91 5.03 N.D.
64 Rosmarinic acid 9.52 359.07724 161.02451 — 0.9935 10–100 0.82 2.75 104.66 2.62 N.D.
65 Glabridin 12.88 323.12888 135.04533 — 0.9967 10–100 0.90 3.00 102.28 2.94 10.93
66 Arbutin 0.79 271.08233 108.02180 — 0.9904 10–100 1.22 4.06 99.29 4.08 N.D.
67 Emodin 13.44 269.04555 225.05573 — 0.9909 10–100 0.70 2.34 97.21 2.40 N.D.
68 Etoposide 9.89 611.17351 405.09308 — 0.9906 10–100 1.49 4.98 97.86 5.09 N.D.
69 DOX Hydrchloride 11.76 542.16678 395.07828 — 0.9929 10–100 2.16 7.18 92.67 7.75 N.D.
70 Ethylgallate 7.83 197.04555 124.01682 — 0.9920 10–100 0.72 2.39 96.27 2.49 N.D.

Abbreviations: Confirming Ions, fragment ions (m/z) of phytochemical compound standards; LOD, limit of detection; LOQ, limit of quantification; N.D., not detected; Quan Peak, parent Ion (m/z) of phytochemical compound standards; R 2, correlation coefficien; RSD, relative standard deviation; RT, retention time.

FIGURE 9.

FIGURE 9

TIC profile of phytochemical standard compounds of PROP extract.

A total of 38 phytochemicals were identified, including benzoic acid, 4‐hydroxybenzoic acid, gallic acid, 3,4‐dihydroxybenzaldehyde, vanillic acid, vanillin, trans‐cinnamic acid, coumaric acid, caffeic acid, caffeic acid phenyl ester, ferulic acid, sinapic acid, chlorogenic acid, quinic acid, 3‐(4‐hydroxyphenyl) PROPionic acid, chrysin, apigenin, acacetin, genkwanin, rutin, luteolin, diosmetin, galangin, isoquercitrin, quercetin, narcissin, isorhamnetin, kaempferol, nicotiflorin, astragalin, leucoside, fisetin hydrate, naringenin, sakuranetin, formononetin, ellagic acid, esculin hydrate, and glabridin. Among these, chrysin was found at 4830.50 μg/g, naringenin at 4310.7 μg/g, caffeic acid at 3625.28 μg/g, galangin at 2500.91 μg/g, caffeic acid phenyl ester at 2224.27 μg/g, coumaric acid at 1612.25 μg/g, apigenin at 1421.03 μg/g, diosmetin at 1200.8 μg/g, quercetin at 1182.84 μg/g, benzoic acid at 990.17 μg/g, isorhamnetin at 875.4 μg/g, and luteolin at 821.24 μg/g, indicating these phytochemicals as dominant.

4. Discussion

With their cytotoxic actions, the majority of medications used in cancer treatment stop malignant cells from growing and proliferating and instead induce their death (Abd El‐Gany et al. 2016). DOX, a member of the anthracycline group of chemotherapeutic agents, is useful in the treatment of cancer but has several negative consequences (Arivalagan et al. 2018). Sarcoma, lymphoma, prostate cancer, thyroid, lung, and breast carcinomas are among the hematological malignancies for which it is most commonly used (Abd El‐Gany et al. 2016). The primary worry when using chemotherapy medications is their potential for toxicity. Numerous chemotherapeutic medications have been linked to neurotoxicity, according to studies. One way that DOX may harm brain tissue is significant lipid peroxidation in the heart, kidney, liver, ovary, and testicular tissues (Kiyomiya et al. 2001).

It is accepted that DOX directly or indirectly alters the gene expression of different enzymes at transcriptional or translational stages through the production of free radicals, which leads to changes in the activity of antioxidant enzymes (Denard et al. 2011; Kara et al. 2016). According to some studies, nitric oxide (NO), superoxide, and hydroxyl radicals are the free radicals responsible for pathogenesis. In addition, antioxidant enzymes such as superoxide dismutase (SOD) and catalase (CAT) are reduced by lipid peroxidation products such as MDA, which are produced by free radicals and damage cells (Gündoğdu et al. 2023; Karaman et al. 2006; Hirai et al. 2006). Antioxidant treatment trials have attracted attention due to studies showing the role of free radicals and antioxidant enzymes in the pathophysiology of DOX‐associated toxicity (Tulubas et al. 2015). Oxidative stress is one of the main mechanisms of DOX‐induced neurotoxicity. In our study, it was determined that PROP strengthens antioxidant defense by increasing SOD and CAT levels, reduces lipid peroxidation by decreasing MDA levels, and protects cellular redox balance by increasing GSH levels. These findings parallel the study conducted by Elbaz et al. (2010). In the said study, PROP was shown to suppress oxidative stress in brain tissue and increase antioxidant enzyme activity. Similarly, Wang et al. (2020) reported that PROP reduces oxidative stress in neurodegenerative diseases. In addition, da Silva et al. (2018) stated that the antioxidant capacity of PROP increases thanks to its flavonoid components and that these components have a protective effect against oxidative damage. In addition, the regulation in nNOS and iNOS levels suggests that PROP has a neuroprotective effect by supporting nitric oxide homeostasis. This was also stated in the study by Kitamura (2019), and it was stated that PROP protects cell health by reducing neuronal oxidative stress.

Numerous chronic diseases, including cancer, diabetes, heart disease, and neurological disorders, are linked to inflammation. On the other hand, oxidative stress has been documented to activate various transcription factors, including p53, NFkB, and AP‐1 (Karamese et al. 2016). By increasing the levels of pro‐inflammatory cytokines and decreasing the levels of anti‐inflammatory cytokines, DOX causes inflammation (Ujah et al. 2021). DOX administration triggered the inflammatory response, increasing the levels of NFκB, TLR4, IL‐6, IL‐1β, and TNF‐α. However, PROP extract reduced inflammation by suppressing these parameters. In the literature, Zulhendri et al. (2022) showed that PROP reduced the production of inflammatory cytokines by inhibiting the NfκB and TLR4 signaling pathways. Furthermore, Oršolić and Jazvinšćak Jembrek (2022) reported that PROP suppressed inflammation in brain tissue by decreasing the levels of IL‐6 and TNF‐α. Our study is consistent with these results and supports the idea that PROP has a neuroprotective effect by inhibiting the activity of NfκB, a central regulator of inflammation. In addition, Nattagh‐Eshtivani et al. (2022) reported that PROP suppresses inflammatory processes by reducing IL‐1β and TNF‐α levels and inhibits microglial activation.

ER is an organelle with a high threshold to both intracellular and external stimuli (Flessa et al. 2022). p‐PERK, IRE1α, and ATF6 are three transmembrane proteins that assemble unfolded proteins and dissociate from GRP78 when ER stress is induced for any reason, leading to an increase in the amount of unfolded or misfolded proteins in the cell (Kara et al. 2023). ER stress is characterized by an increase in the expression levels of GRP78, CHOP, ATF6, p‐IRE1, sXBP1, and p‐PERK. In our study, DOX application triggered ER stress by increasing ATF6 and p‐IRE1 activity. PROP administration was observed to suppress these parameters. Similarly, Scorza et al. (2024) reported that PROP maintains cellular homeostasis by inhibiting ER stress pathways. In addition, Chen et al. (2023) showed that PROP maintains cellular protein balance by reducing ER stress and reducing apoptotic cell death.

The majority of the pyramidal neurons in the DOX group's cerebral cortex regions were shown to have deteriorated in our histological analyses, along with signs of brain injury such as vacuolation. According to animal studies, DOX application results in cortical injury, which is in line with our findings (Kosoko et al. 2017). Furthermore, our results demonstrate that PROP extract mitigates the histologically induced brain damage caused by DOX. According to several recent studies, ROS are necessary to initiate the apoptotic process of the cell (Gelen et al. 2023; Gür et al. 2022; Sengul et al. 2023). Caspase‐3 and Bcl‐2 are two members of the Bcl‐2/Bax protein family, which initiate a pathway in which apoptotic mechanisms occur (Gelen et al. 2021; Chen et al. 2019). Ujah et al. (2021) found that when rats were exposed to DOX‐induced testicular toxicity, the expression of Bcl‐2 decreased, and the expression of Caspase‐3 increased in the toxicity group. In our study, DOX induced apoptosis by increasing Bax levels and decreasing Bcl‐2 levels. However, PROP reversed these ratios and suppressed the apoptotic process. Similar findings were reported in the study by Abdel‐Rahman et al. (2020), which showed that PROP reduced apoptotic cell death in brain tissue. In addition, activation of the PI3K/Akt/mTOR pathway was identified as one of the mechanisms by which PROP protects cell health. Forma and Bryś (2021) indicated that PROP affects the PI3K/Akt pathway. Additionally, Chen et al. (2022) showed that PROP controls autophagy by regulating mTOR signaling in neurons, thereby modulating cellular stress responses.

PROP contains numerous phenolic compounds that have positive effects on human health. Phenolic compounds also prevent oxidation and enhance the chemical stability of food products (Koksal and Gulcin 2008). Most of the biological effects of PROP are provided by flavonoids and other polyphenols; this group includes flavones, flavonols, flavanones, and dihydroflavonols (Guzelmeric et al. 2021). Among the components of PROP are benzoic acid, gallic acid, 4‐hydroxybenzoic acid, p‐coumaric acid, chlorogenic acid, quinic acid, caffeic acid, caffeic acid phenethyl ester, gallic acid, chrysin, apigenin, acacetin, rutin, luteolin, galangin, quercetin, nicotiflorin, astragalin, naringenin, kaempferol, rutin, quercetin, naringenin, and isoquercitrin. These components enhance the effectiveness of the digestive system, antioxidant capacity, and metabolic, physiological, and immune functions of body tissues (Apak et al. 2022). The phytochemicals identified in PROP, as mentioned in the literature, were found to be consistent with the phytochemicals detected in the PROP extract used in the study. Among the components of PROP, more than 300 compounds have been identified in various types of PROP, including phenolic acids and esters, flavonoids, triterpenes, alcohols, aromatic aldehydes, fatty acids, stilbenes, steroids, lignans, amino acids, and sugars (Oleggrio et al. 2019). In the literature, there are numerous studies on the chemical profile of natural products using UHPLC‐Orbitrap‐HRMS (Dursun et al. 2025; Ceylan et al. 2024). In this context, this report is an important study in terms of determining the chemical profile of PROP and the impact of the phytochemicals it contains. Phenolic compounds found in natural resources are highly important for human nutrition. Due to their biological effects, such as antioxidant Properties, they have attracted significant interest (Koksal and Gulcin 2008).

5. Conclusion

The results of this study suggest that DOX treatment causes the production of ROS, which in turn stimulates ROS‐mediated direct apoptosis. Moreover, ROS‐induced endoplasmic reticulum stress results in the suppression of mitochondrial BCL2 and increased production of Bax, which in turn stimulates the formation of caspase‐3, which causes apoptosis. Once more, elevating ROS causes endoplasmic reticulum stress, which in turn causes NF‐kB to develop in the nucleus. This, in turn, raises cytokine levels, promoting apoptosis. Nevertheless, we discovered that the administration of PROP extract inhibited these DOX‐stimulated signaling pathways. These results suggested that PROP extract may be an adjuvant therapy to lessen the adverse effects of DOX‐dependent oxidative stress, ER stress, inflammation, and apoptotic effects on brain tissue.

Author Contributions

Research and technique. And writing innovative validation software: V.G., M.B., I.Ç., İ.D., and A.K. Writing: V.G., M.B., I.Ç., İ.D., and A.K. Preparing the initial draft. Conceptualization: Every author has reviewed and approved the published version of the study.

Conflicts of Interest

The authors declare no conflicts of interest.

Acknowledgments

We are grateful to all the people for their contributions to the manuscript.

Funding: The authors received no specific funding for this work.

Contributor Information

Volkan Gelen, Email: gelen_volkan@hotmail.com, Email: volkan.gelen@kafkas.edu.tr.

İnan Dursun, Email: idursun@bingol.edu.tr.

Data Availability Statement

The article or its supplemental materials include data.

References

  1. Abd El‐Gany, A. M. , Rasha M. N., Bakry N., and Shimaa B.. 2016. “Amelioration of Cisplatin Induced Testicular Injury by Different Garlic Preparations in Experimental Rat.” World Journal of Pharmaceutical Research 5, no. 9: 160–181. [Google Scholar]
  2. Abdel‐Rahman, R. F. , Alqasoumi S. I., Ogaly H. A., Abd‐Elsalam R. M., El‐Banna H. A., and Soliman G. A.. 2020. “Propolis Ameliorates Cerebral Injury in Focal Cerebral Ischemia/Reperfusion (I/R) Rat Model via Upregulation of TGF‐β1.” Saudi Pharmaceutical Journal 28, no. 1: 116–126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alavi, M. , and Varma R. S.. 2020. “Overview of Novel Strategies for the Delivery of Anthracyclines to Cancer Cells by Liposomal and Polymeric Nanoformulations.” International Journal of Biological Macromolecules 164: 2197–2203. [DOI] [PubMed] [Google Scholar]
  4. Apak, R. , Calokerinos A., Gorinstein S., et al. 2022. “Methods to Evaluate the Scavenging Activity of Antioxidants Toward Reactive Oxygen and Nitrogen Species.” Pure and Applied Chemistry 94: 87–144. [Google Scholar]
  5. Arivalagan, P. , Immanuel Edison T. N. J., Velmurugan B. K., Jacob J. A., and Karuppusamy I.. 2018. “Toxicity of Doxorubicin (DOX) to Different Experimental Organ Systems.” Journal Unknown 200: 26–30. 10.1016/j.lfs.2018.03.023. [DOI] [PubMed] [Google Scholar]
  6. Beutler, E. , Duron O., and Kelly B. M.. 1963. “Improved Method for Determination of Blood Glutathione.” Journal of Laboratory and Clinical Medicine 61: 882–888. [PubMed] [Google Scholar]
  7. Cagel, M. , Grotz E., Bernabeu E., Moretton M. A., and Chiappetta D. A.. 2017. “Doxorubicin: Nanotechnological Overviews From Bench to Bedside.” Drug Discovery Today 22, no. 2: 270–281. [DOI] [PubMed] [Google Scholar]
  8. Ceylan, C. , Cetin N., Menevse E., et al. 2024. “Echinophora Tournefortii Jaub. & Spach: Evaluation of the Effect on Indomethacin‐Induced Gastric Ulcer in Rats and Phytochemical Analyses by LC‐HRMS.” Fitoterapia 177: 106072. [DOI] [PubMed] [Google Scholar]
  9. Chen, X. , Shi C., He M., Xiong S., and Xia X.. 2023. “Endoplasmic Reticulum Stress: Molecular Mechanism and Therapeutic Targets.” Signal Transduction and Targeted Therapy 8: 352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen, Y. , Wang J., Wang Y., et al. 2022. “A Propolis‐Derived Small Molecule Ameliorates Metabolic Syndrome in Obese Mice by Targeting the CREB/CRTC2 Transcriptional Complex.” Nature Communications 13: 246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chen, Y. , Zhang W., Guo X., Ren J., and Gao A.. 2019. “The Crosstalk Between Autophagy and Apoptosis Was Mediated by the Phosphorylation of Bcl‐2 and Beclin1 in Benzene‐Induced Hematotoxicity.” Cell Death and Disease 10: 772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. da Silva, C. , Prasniewski A., Calegari M. A., de Lima V. A., and Oldoni T. L. C.. 2018. “Determination of Total Phenolic Compounds and Antioxidant Activity of Ethanolic Extracts of Propolis Using ATR–FT‐IR Spectroscopy and Chemometrics.” Food Analytical Methods 11: 2013–2021. [Google Scholar]
  13. Denard, B. , Seemann J., Chen Q., et al. 2011. “The Membrane‐Bound Transcription Factor CREB3L1 Is Activated in Response to Virus Infection to Inhibit the Proliferation of Virus‐Infected Cells.” Cell Host & Microbe 10, no. 1: 65–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Draper, H. H. , and Hadley M.. 1990. “Malondialdehyde Determination as Index of Lipid Peroxidation.” Methods in Enzymology 186: 421–431. 10.1016/0076-6879(90)86135-i. [DOI] [PubMed] [Google Scholar]
  15. Dursun, İ. , Sağlamtaş R., Fettahoğlu K., et al. 2025. “Antioxidant and Antimicrobial Activities of Different Extracts of Tragopogon Dubius and Tragopogon Porrifolium L. Subsp. Longirostris: Determination of Their Phytochemical Contents by UHPLC‐Orbitrap‐HRMS Analysis.” Food Bioscience 63: 105604. 10.1016/j.fbio.2024.105604. [DOI] [Google Scholar]
  16. El‐Agamy, S. E. , Abdel‐Aziz A. K., Esmat A., and Azab S. S.. 2019. “Chemotherapy and Cognition: Comprehensive Review on Doxorubicin‐Induced Chemobrain.” Cancer Chemotherapy and Pharmacology 84, no. 1: 1–14. [DOI] [PubMed] [Google Scholar]
  17. Elbaz, A. , Wei Y. Y., Meng Q., Zheng Q., and Yang Z. M.. 2010. “Mercury‐Induced Oxidative Stress and Impact on Antioxidant Enzymes in Chlamydomonas reinhardtii .” Ecotoxicology 19: 1285–1293. [DOI] [PubMed] [Google Scholar]
  18. Flessa, C. M. , Kyrou I., Nasiri‐Ansari N., Kaltsas G., Kassi E., and Randeva H. S.. 2022. “Endoplasmic Reticulum Stress in Nonalcoholic (Metabolic Associated) Fatty Liver Disease (NAFLD/MAFLD).” Journal of Cellular Biochemistry 123: 1585–1606. [DOI] [PubMed] [Google Scholar]
  19. Forma, E. , and Bryś M.. 2021. “Anticancer Activity of Propolis and Its Compounds.” Nutrients 13, no. 8: 2594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gelen, V. , Sengul E., Yildirim S., and Cinar İ.. 2023. “The Role of GRP78/ATF6/IRE1 and Caspase‐3/Bax/Bcl2 Signaling Pathways in the Protective Effects of Gallic Acid Against Cadmium‐Induced Liver Damage in Rats.” Iranian Journal of Basic Medical Sciences 26, no. 11: 1326–1333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Gelen, V. , Şengül E., Yıldırım S., Senturk E., Tekin S., and Kükürt A.. 2021. “The Protective Effects of Hesperidin and Curcumin on 5‐Fluorouracil‐Induced Nephrotoxicity in Mice.” Environmental Science and Pollution Research International 28, no. 34: 47046–47055. [DOI] [PubMed] [Google Scholar]
  22. Gu, M. , Mei X. L., and Zhao Y. N.. 2021. “Sepsis and Cerebral Dysfunction: BBB Damage, Neuroinflammation, Oxidative Stress, Apoptosis, and Autophagy as Key Mediators and the Potential Therapeutic Approaches.” Neurotoxicology Research 39, no. 2: 489–503. 10.1007/s12640-020-00270-5. [DOI] [PubMed] [Google Scholar]
  23. Gündoğdu, H. , Uluman E., Eliş Yıldız S., Aksu Kılıçle P., Gezer A., and Karadağ Sarı E.. 2023. “Therapeutic Effect of Pomegranate Peel Extract on Heme Oxygen‐Free 1 (HO‐1) and Angiotensin‐Converting Enzyme‐2 (ACE‐2) in the Kidney Tissue of Mice Treated With Mitomycin: Effect of Pomegranate Peel on HO‐1 and ACE‐2 in the Kidney Tissue of Mice Treated With Mitomycin.” Rats 1, no. 2: 27–34. [Google Scholar]
  24. Gür, C. , Özkanlar S., Gedikli S., et al. 2022. “The Effects of Quercetin Administration on Heart Tissue and Serum Parameters in the Rats With Experimental Obesity.” Eurasian Molecular Biochemistry Sciences 1, no. 1: 16–21. [Google Scholar]
  25. Guzelmeric, E. , Yuksel P. I., Yaman B. K., et al. 2021. “Comparison of Antioxidant and Anti‐Inflammatory Activity Profiles of Various Chemically Characterized Turkish Propolis Sub‐Types: Which Propolis Type Is a Promising Source for Pharmaceutical Product Development?” Journal of Pharmaceutical and Biomedical Analysis 203: 114196. [DOI] [PubMed] [Google Scholar]
  26. Hirai, T. , Okumura K., Nishimoto Y., et al. 2006. “Upregulation of Renal eNOS by High‐Sodium Diet Facilitates Hypertension in Doxorubicin‐Treated Rats Through Enhanced Oxidative Stress.” Toxicology 225: 81–89. [DOI] [PubMed] [Google Scholar]
  27. Ibrahim Fouad, G. , and Ahmed K. A.. 2021. “Neuroprotective Potential of Berberine Against Doxorubicin‐Induced Toxicity in Rat's Brain.” Neurochemical Research 46, no. 12: 3247–3263. [DOI] [PubMed] [Google Scholar]
  28. Kara, A. , Gedikli S., Sengul E., Gelen V., and Ozkanlar S.. 2016. “Oxidative Stress and Autophagy.” In Free Radicals and Diseases, 1st ed., 69–86. InTechOpen. [Google Scholar]
  29. Kara, A. , Gelen V., and Kara H.. 2023. “The Relationship of Some Neurodegenerative Diseases With Endoplasmic Reticulum Stress and Histopathological Changes in These Diseases: An Overview.” In Molecular Histopathology and Cytopathology, 1st ed., 5–13. InTechOpen. [Google Scholar]
  30. Karaman, A. , Fadillioglu E., Turkmen E., Tas E., and Yilmaz Z.. 2006. “Protective Effects of Leflunomide Against Ischemia‐Reperfusion Injury of the Rat Liver.” Pediatric Surgery International 22, no. 5: 428–434. [DOI] [PubMed] [Google Scholar]
  31. Karamese, M. , Guvendi B., Karamese S. A., et al. 2016. “The Protective Effects of Epigallocatechin Gallate on Lipopolysaccharide‐Induced Hepatotoxicity: An in Vitro Study on Hep3B Cells.” Iranian Journal of Basic Medical Sciences 19, no. 5: 483–489. [PMC free article] [PubMed] [Google Scholar]
  32. Kitamura, H. 2019. “Effects of Propolis Extract and Propolis‐Derived Compounds on Obesity and Diabetes: Knowledge From Cellular and Animal Models.” Molecules 24, no. 23: 4394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kiyomiya, K. , Matsuo S., and Kurebe M.. 2001. “Differences in Intracellular Sites of Action of Adriamycin in Neoplastic and Normal Differentiated Cells.” Cancer Chemotherapy and Pharmacology 47, no. 1: 51–57. [DOI] [PubMed] [Google Scholar]
  34. Koksal, E. , and Gulcin I.. 2008. “Antioxidant Activity of Cauliflower (Brassica Oleracea L.).” Turkish Journal of Agriculture and Forestry 32: 65–78. [Google Scholar]
  35. Kosoko, A. M. , Olurinde O. J., and Akinloye O. A.. 2017. “Doxorubicin Induced Neuro‐ and Cardiotoxicities in Experimental Rats: Protection Against Oxidative Damage by Theobroma cacao Stem Bark.” Biochemistry and Biophysics Reports 10: 303–317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lesniak, M. S. , Upadhyay U., Goodwin R., Tyler B., and Brem H.. 2005. “Local Delivery of Doxorubicin for Treating Malignant Brain Tumors in Rats.” Anticancer Research 25, no. 6B: 3825–3831. [PMC free article] [PubMed] [Google Scholar]
  37. Luck, H. 1955. “Catalase.” In Methods in Analysis, edited by Bergmeyer H. U.. Academy Press. [Google Scholar]
  38. Morean, D. F. , O'Dwyer L., and Cherney L. R.. 2015. “Therapies for Cognitive Deficits Associated With Chemotherapy for Breast Cancer: A Systematic Review of Objective Outcomes.” Archives of Physical Medicine and Rehabilitation 96, no. 10: 1880–1897. [DOI] [PubMed] [Google Scholar]
  39. Nattagh‐Eshtivani, E. , Pahlavani N., Ranjbar G., et al. 2022. “Does Propolis Have Any Effect on Rheumatoid Arthritis? A Review Study.” Food Science & Nutrition 10, no. 4: 1003–1020. 10.1002/fsn3.2684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Oleggrio, L. S. , Andrade J. K. S., Andrade G. R. S., et al. 2019. “Chemical Characterization of Four Brazilian Brown Propolis: An Insight in Tracking of Its Geographical Location of Production and Quality Control.” Food Research International 123: 481–502. [DOI] [PubMed] [Google Scholar]
  41. Oršolić, N. , and Jazvinšćak Jembrek M.. 2022. “Molecular and Cellular Mechanisms of Propolis and Its Polyphenolic Compounds Against Cancer.” International Journal of Molecular Sciences 23, no. 18: 10479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Sannasimuthu, A. , Kumaresan V., Anilkumar S., et al. 2019. “Design and Characterization of a Novel Arthrospira Platensis Glutathione Oxido‐Reductase‐Derived Antioxidant Peptide GM15 and Its Potent Anti‐Cancer Activity via Caspase‐9 Mediated Apoptosis in Oral Cancer Cells.” Free Radical Biology and Medicine 135: 198–209. [DOI] [PubMed] [Google Scholar]
  43. Scorza, C. , Goncalves V., Finsterer J., Scorza F., and Fonseca F.. 2024. “Exploring the Prospective Role of Propolis in Modifying Aging Hallmarks.” Cells 13, no. 5: 390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Sengul, E. , Gelen V., Yildirim S., Cinar İ., and Aksu E. H.. 2023. “Effects of Naringin on Oxidative Stress, Inflammation, Some Reproductive Parameters, and Apoptosis in Acrylamide‐Induced Testis Toxicity in Rat.” Environmental Toxicology 38, no. 4: 798–808. [DOI] [PubMed] [Google Scholar]
  45. Sun, Y. , Oberley L. W., and Li Y.. 1988. “A Simple Method for Clinical Assay of Superoxide Dismutase.” Clinical Chemistry 34: 497–500. [PubMed] [Google Scholar]
  46. Tulubas, F. , Gurel A., Oran M., Topcu B., Caglar V., and Uygur E.. 2015. “The Protective Effects of ω‐3 Fatty Acids on Doxorubicin‐Induced Hepatotoxicity and Nephrotoxicity in Rats.” Toxicology and Industrial Health 31, no. 7: 638–644. [DOI] [PubMed] [Google Scholar]
  47. Ujah, G. A. , Nna V. U., Suleiman J. B., et al. 2021. “Tert‐Butylhydroquinone Attenuates Doxorubicin‐Induced Dysregulation of Testicular Cytoprotective and Steroidogenic Genes, and Improves Spermatogenesis in Rats.” Scientific Reports 11, no. 1: 5522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Valverde, T. M. , Soares B. N. G. S., Nascimento A. M. D., et al. 2023. “Anti‐Inflammatory, Antimicrobial, Antioxidant and Photoprotective Investigation of Red Propolis Extract as Sunscreen Formulation in Polawax Cream.” International Journal of Molecular Sciences 24, no. 6: 5112. 10.3390/ijms24065112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Vyas, V. , Simbo D. A., Mursalin M., Mishra V., Bashary R., and Khatik G. L.. 2020. “Drug Delivery Approaches for Doxorubicin in the Management of Cancers.” Current Cancer Therapy Reviews 16, no. 4: 320–331. 10.2174/1573394716666191216114950. [DOI] [Google Scholar]
  50. Wang, T. , Liu Q., Wang M., and Zhang L.. 2020. “Metabolomics Reveals Discrimination of Chinese Propolis From Different Climatic Regions.” Food 9, no. 4: 491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zulhendri, F. , Lesmana R., Tandean S., et al. 2022. “Recent Update on the Anti‐Inflammatory Activities of Propolis.” Molecules 27, no. 23: 8473. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The article or its supplemental materials include data.


Articles from Food Science & Nutrition are provided here courtesy of Wiley

RESOURCES