The characterization of uterine calcium transport and metabolism during eggshell calcification of hens laying high or low breaking strength eggshell

Abstract

This study investigated the differences of calcium transport-related proteins and metabolites in the uterus of hens with different breaking strength eggshell during the eggshell calcification. A total of 200 Hy-Line Brown laying hens, aged 75 weeks, were selected and categorized into two groups based on the eggshell breaking strength: a high-strength group (HS, > 42 N) and a low-strength group (LS, < 32 N). Laying hens were sampled at 1 h, 7 h (the initiation stage of eggshell calcification), and 17 h (the growth stage of eggshell calcification) post-oviposition (PO). The LS group showed a decreased thickness, weight and weight ratio of eggshells, accompanied with ultrastructural deterioration and total Ca reduction. The expression levels of ATP2A3, ATP2B2, SLC8A1, and SLC8A3 were significantly increased in the HS at 17 h PO when compared to 1 h and 7 h PO, while no significant changes were observed in the LS. At 7 h PO, the LS group had lower uterine mucosa calcium levels, higher TRPV6 protein expression, and lower CALB1 protein expression. In the HS group, uterine metabolites showed a significant increase in glutathione, citrulline, and proline at 7 h PO, whereas, at 17 h PO, the tricarboxylic acid cycle pathway was significantly enriched. These findings suggest that uterine calcium transport activity is relatively subdued during the initiation stage of eggshell calcification, focusing on redox repair activities to maintain homeostasis for mammillary knobs formation. Subsequently, uterine calcium transport activity becomes highly active during the growth stage of eggshell calcification, primarily supporting rapid calcium transport through enhanced energy metabolism. In aged laying hens, the lower eggshell breaking strength may be attributed to decreased calcium levels during the initiation stage and imbalanced redox during the growth stage, which could affect calcium transport and lead to a weak ultrastructure during the calcification period.

Introduction

The eggshell has significant biological functions, and the decrease in eggshell quality brings great economic loss for the poultry industry and egg processing industry (Cheng and Ning, 2023). Eggshell breakage is a major source of economic loss for egg producers, as the eggshell breakage rate ranges from 2 % to 12 % (Hamilton and Bryden, 2021). The decreased mechanical properties of the eggshell lead to more broken eggs. Eggshell breaking strength represents the ability of eggshell to resist external forces, which is the most commonly used index to evaluate the mechanical properties of eggshells (Voisey and Hunt, 1967). The eggshell breaking strength decreases with age of laying hens, and it exhibited considerable variability during the entire laying hen cycle (Sirri et al., 2018; Benavides-Reyes et al., 2021). In our preliminary study, the proportion of eggs with low eggshell strength increases with the extension of the egg production period (Ma et al., 2021). Therefore, the low breaking strength eggshells deserves particular attention in order to reduce cracked and broken eggs in the late phase.

The eggshell has a highly ordered mineralized structure, consisting mainly of 95 % calcium carbonate and 3.5 % organic matrix proteins (Nys et al., 1999; Marie et al., 2014). The eggshell formation process consists of three stages: initiation of calcification (5-10 h post-ovulation, form the mammillary layer), rapid deposition (10-22 h post-ovulation, form the effective layer), and termination of calcification (22-24 h post-ovulation, form the cuticle layer) (Gautron et al., 1997; Nys et al., 1999). Eggshells are formed in the uterus and large amounts of Ca²⁺ are transported through the bloodstream to the uterus for calcification. Uterine calcium transport proteins mainly include transient receptor potential (TRPV6), calbindin 28k (CALB1), endoplasmic reticulum calcium ATPase (ATP2A3), inositol 1, 4, 5-trisphosphate receptors (ITPR2/3), plasma membrane calcium-ATPases (ATP2B1/2) and Na⁺/Ca²⁺ exchangers (SLC8A1/3) (Bar, 2009; Jonchère et al., 2012). Previous studies have shown that uterine CALB1 gene expression in the high strength group is about 3-fold higher than that in the low strength group (Sun et al., 2016), and significant differences in gene expression between the high and low strength groups can be seen by analyzing the uterine transcriptomes (Zhang et al., 2019), and these studies suggest that calcium transport-related proteins play a crucial role in eggshell calcification.

Metabolomics provides a unique perspective to unravel the mechanisms regulating eggshell quality by analyzing changes in small molecule metabolites. The analysis of the uterine fluid metabolome has indicated that compounds such as phosphatidylcholine, diacylglycerol, verapamil, risedronate, coproporphyrinogen III, and biliverdin may play a key role in eggshell calcification (Wang et al., 2021). However, there are still substantial knowledge gaps on the metabolic activity of uterus associated with eggshell calcification. Therefore, the study has observed the change of calcium transport-related proteins and metabolites in uterus of hens with different breaking strength eggshells at different stages of eggshell calcification, and explored the possible reasons for the deterioration of eggshell quality.

Materials and methods

Experimental design

All animal protocols were approved by the Animal Care and Use Committee of the Feed Research Institute of the Chinese Academy of Agricultural Sciences (approval number: AEC—CAAS-20220702). A total of 2060 75-week-old Hy-Line Brown laying hens were caged individually, and the eggshell breaking strength of each hen was measured using the Egg Force Reader (EFR-01, Israel Orka Food Technology Ltd., Ramat Hasharon, Israel) every day for one week. The average eggshell breaking strength of the flock was 37.23 N, in which the hens with average breaking strength above 42 N and below 32 N accounted for 20 %, respectively. Then 200 laying hens were selected according to the eggshell breaking strength and divided into high and low eggshell breaking strength groups. The eggshell breaking strength in the low-strength group (LS) was < 32 N, and the eggshell breaking strength in the high-strength group (HS) was > 42 N. Each group was divided into 10 replicates of 10 hens and caged individually. All hens were fed a corn-soybean meal diet (CP = 16.50 %, Ca = 3.45 %, and P = 0.49 %) according to the nutritional requirements and standards, propagated by National Research Council (1994) and Chinese Feeding Standard of Chicken (2004). All hens were housed in a single cage (cage size 45 cm × 45 cm × 45 cm) under the same controlled environments and received natural and artificial light for 16 h daily. After 4 weeks of acclimation, the oviposition time of each hen was recorded for 7 days continuously with an automatic monitoring control system (IFR, CAAS, Beijing, China) to predict the calcification periods (Zhang et al., 2017).

Sample collection

All eggs were collected for three consecutive days to measure eggshell quality. 10 birds (1 bird per replicate) from each group were sampled at 1 h post-oviposition (PO), 7 h PO (the initiation stage of eggshell calcification), and 17 h PO (the growth stage of eggshell calcification), respectively. The blood samples were collected from the wing vein, and plasma samples were separated by centrifugation at 3,000 × g at 4°C for 10 min and stored at −80°C. The hens were sacrificed after blood samples were collected, and tissue samples were taken immediately. The right femur of each hen was removed, and the medullary bone was removed from the middle after removal of residual tissue. Uterine mucosa and medullary bone were collected, placed in liquid nitrogen, and stored at −80°C until further analysis. Fig. 1 illustrates the study design and sample collection.

Fig. 1.

Study design and sample collection.

Egg and eggshell physical properties

Egg weight was weighed first after the eggs were collected. Then, the egg length and egg width were measured using an egg-shape indexer (NFN385, Fujihira Industry Co., Ltd., Tokyo, Japan), and the egg-shape index was defined by dividing the egg length by the egg width. Eggshell thickness was determined at 3 points (blunt, sharp, and equator ends) using Egg Shell Thickness Gauge (TI-PVX, Israel Orka Food Technology Ltd., Ramat Hasharon, Israel), and the average value of the 3 points was calculated. Eggshell breaking strength was measured using the Egg Force Reader (EFR-01, Israel Orka Food Technology Ltd., Ramat Hasharon, Israel). Eggshell weight was measured after cleaning the contents and drying at room temperature. The eggshell ratio was quantified by eggshell weight/egg weight × 100 %. Eggshell fracture toughness was determined according to the formulas of Ma et al. (2021). The eggshell fracture toughness was calculated as follows:

$$\text{Eggshell}\text{fracture}\text{toughness}=0.777\times {\left[2.388+\left(29.934\times 12/\mathrm{W}\right)\right]}^{1/2}\left(\mathrm{F}/{\mathrm{T}}^{3/2}\right)$$

Where W is the egg width (mm), F is the breaking strength (N), and T is the eggshell thickness (mm).

Eggshell components

Six eggshells per replicate were soaked in distilled water to remove the shell membrane. After drying, the eggshells were mixed and crushed into one sample for the detection of eggshell organic matter, Ca and P content according to a previous study method (Ma et al., 2021). Briefly, approximately 1 g of eggshell powder was weighed and dried at 110°C for 5 h, the dried sample was weighed as W₁. After that, it was put into a muffle furnace and burned for 12 h. At this time, the dried sample was weighted as W₂. The percentage of inorganic content was measured as W₂/W₁ × 100 %. The percentage of organic content was calculated as 100 %-inorganic content. Additionally, approximately 1 g of eggshell powder was digested in 4 mL nitric acid solution at 110°C for 2 h. Then, the samples were added to 3 mL H₂O₂ and digested at 160°C until the solution became transparent. The contents of Ca and P were analyzed using a flame atomic absorption spectrophotometry (Z2000, Hitachi Co., Ltd., Tokyo, Japan).

Eggshell ultrastructure

The ultrastructure of the eggshell cross-section and inner surface was observed using scanning electronic microscopy (SU8020, Hitachi Co., Ltd., Tokyo, Japan) under a visual field of 180 × and 150 ×magnification, respectively. The eggshell pieces (about 1 cm²) were selected from the equatorial section of the eggshell sample and soaked in distilled water to remove the inner shell membrane, then dried and fixed on the sample table, sprayed with gold powder, and examined by scanning electronic microscopy. The effective thickness (combined palisade, vertical crystal layer, and cuticle) and mammillary thickness were measured according to the method by Fu et al. (2024a). The width of the mammillary knobs was calculated by the length of mammillary knobs/the number of mammillary knobs.

Calcium concentrations in plasma, uterine mucosa and medullary bone

Plasma calcium level was measured using a blood gas biochemistry analyzer (PL2000, Perlong Medical Co., Ltd., Beijing, China). The calcium concentrations of uterine mucosa and medullary bone were measured using commercial kits purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The protein concentrations of uterine mucosa and medullary bone were measured using commercial kits purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The assay procedures were carried out following the manufacturer's instructions.

Western blot analysis

Western blot analysis was performed to detect the relative expression of three proteins associated with calcium ion transport. Total proteins were extracted, and protein concentrations were determined using a BCA protein assay kit (Beyotime, Shanghai, China). Protein samples (20 μg/lane) were electrophoresed and transferred to PVDF membranes. The membranes were blocked with 3 % non-fat dry milk for 30 min at room temperature and incubated with the primary antibodies for TRPV6 (Abclonal, A16128), CALB1 (Abcam, ab229915), ITPR2 (Affinity, DF13336) and GAPDH (Immunoway, YM3029) at 4°C overnight. After 5 times washing, the membranes were incubated with secondary antibody for 40 min at room temperature. After washing membrane again, the protein bands were visualized with ECL Western blotting substrate (Millipore, Billerica, USA) and analyzed using Image J 6.0 software.

Quantitative real-time PCR

The qRT-PCR analysis was performed to detect the relative expression of six genes associated with calcium ion transport. Total RNA in the uterine mucosa was extracted with EasyPure RNA Kit (TransGen Biotech Co., Ltd, Beijing, China), and the cDNA was synthesized with EasyScript First-Strand cDNA Synthesis SuperMix kit (TransGen Biotech Co., Ltd., Beijing, China) following the manufacturer's instructions. The mRNA expression of candidate genes was examined using the CFX96 Real-time PCR detection system (Bio-Rad, CA, USA). The relative mRNA expression levels were calculated using β-actin by the 2^−ΔΔCt method. Primer sequences are listed in Table 1.

Table 1.

Information for primer sequences.

Gene name1	Primer sequence (5′→3′)2	Accession
β-actin	F:GAGAAATTGTGCGTGACATCA	L081165
	R:CCTGAACCTCTCATTGCCA
ATP2A3	F:CAACCCCAAGGAGCCTCTTATC	NM_204891
	R:GGTCCCTCAGCGTCATACAAGAAC
ITPR3	F:AGTACAACGTGGCCCTCATC	XM_418035
	R:GTCGTGTCTGCTCTCCATGA
ATP2B1	F:CTGCACTGAAGAAAGCAGATGTTG	XM_416133
	R:GCTGTCATATACGTTTCGTCCCC
ATP2B2	F:TTACTGTACTTGTGGTTGCTGTCCC	XM_001231767
	R:GGTTGTTAGCGTCCCTGTTTTG
SLC8A1	F:GGATTGTGGAGGTTTGGGAAGG	NM_001079473
	R:CTGTTTGCCAGCTCGGTATTTC
SLC8A3	F:GGAGAGACCACAACAACAACCATTC	XM_001231413
	R:AGCTACGAATCCATGCCCACAC

¹Abbreviations: ATP2A3, endoplasmic reticulum calcium ATPase 3; ITPR3, IP3 receptor 3; ATP2B1, plasma membrane calcium transporting ATPase 1; ATP2B2, plasma membrane calcium transporting ATPase 2; SLC8A1, sodium-calcium exchanger 1; SLC8A3, sodium-calcium exchanger 3.

²F: forward; R: reverse.

LC-MS metabolomic analysis

Metabolite concentrations in uterine mucosa samples at 7 and 17 h PO between the HS and LS groups were quantified with UHPLC System (Thermo Fisher Scientific, MA, USA) in positive and negative ionization modes. The uterine mucosa samples were thawed at 4°C and mixed with 400 µL methanol. The mixture was vortex, ground, and centrifuged at 12,000 × g for 10 min at 4°C. The supernatant was transferred into a new 2 mL centrifuge tube and dried. After the dried sample was redissolved using a 150 µL 80 % methanol:water solution with 2‑chloro-l-phenylalanine, the supernatant was transferred into the detection bottle for LC-MS detection. Chromatography was carried out with an ACQUITY UPLC HSS T3 (150 × 2.1 mm, 1.8 µm, Waters, Milford, MA, USA) at 40°C.The flow rate and injection volume were set at 0.25 mL/min and 2 µL, respectively. Data was collected in both the positive and negative ion modes. The parameters were as follows: sheath gas pressure, 30 arb; aux gas flow, 10 arb; spray voltage, 3.5 kV in positive ion mode and −2.5 kV in ion negative mode; capillary temperature, 325°C. Full MS resolution was 60,000, and MS/MS resolution was 15,000. The full range mass scan was from 100∼1000 m/z.

The raw data were processed using R XCMS software for peak detection, correction and alignment. The batch effect was eliminated by correcting the data based on QC samples. Metabolites with a relative standard deviation > 30 % in QC samples were filtered. Then, the obtained data were applied for principal component analysis (PCA) and partial least squares-discriminant analysis (PLS-DA). Metabolites with variable importance projection (VIP) > 1.0 and P < 0.05 were considered differential metabolites. The Metlin and Human Metabolome Database databases were used to check and confirm the putative differential metabolites. Finally, the metabolites were subjected to KEGG pathway enrichment analysis.

Statistical analysis

Data analysis was performed using SPSS, version 24.0. The normality of data distribution was assessed using the Shapiro-Wilk test, and homoscedasticity was evaluated using Levene's test in SPSS 24.0. A two-tailed Student's t-test was used to compare the two groups. A one-way analysis of variance (ANOVA) followed by Duncan's multiple-range test was conducted for the comparisons among multiple groups. Data were displayed as mean and pooled SEM, with P < 0.05 as the significant difference.

Results

Eggshell quality

As shown in Table 2, the physical properties, including the eggshell thickness, eggshell weight, eggshell ratio, and breaking strength, decreased in LS compared to the HS (P < 0.001). No significant differences between HS and LS were found in egg weight, length, width, shape index, and fracture toughness (P > 0.05). Although no differences were observed in the calcium and phosphorus content between the two groups (P > 0.05), total calcium per eggshell and total phosphorus per eggshell were significantly decreased in the LS (P < 0.001; P = 0.04).

Table 2.

Eggshell physical properties and chemical composition in LS and HS in the late production phase¹.

Items	HS	LS	P-value
Eggshell physical properties
Egg weight (g)	62.08±3.31	62.27±4.16	0.831
Length (cm)	5.90±0.20	5.90±0.23	0.970
Width (cm)	4.37±0.10	4.39±0.11	0.510
Shape index	1.35±0.04	1.34±0.04	0.456
Eggshell thickness (*0.01 mm)	49.23±2.86a	43.30±3.44b	< 0.001
Eggshell weight (g)	6.52±0.41a	5.75±0.42b	< 0.001
Eggshell ratio (%)	10.50±0.005a	9.34±0.004b	< 0.001
Eggshell breaking strength (N)	44.07±3.00a	27.99±3.37b	< 0.001
Fracture toughness (N/mm3/2)	304.48±51.68	283.30±50.00	0.120
Eggshell chemical composition
Organic matter (%)	2.86±0.53	2.88±0.63	0.921
Organic matter per eggshell (mg)	185.21±35.00	163.25±38.47	0.223
Ca (%)	34.37±0.90	33.31±1.20	0.070
Total Ca per eggshell (mg)	2278.40±139.64a	1901.14±71.98b	< 0.001
P (%)	0.08±0.01	0.08±0.01	0.654
Total P per eggshell (mg)	5.37±0.71a	4.69±0.56b	0.040

¹Results are reported as the mean ± SD, n = 10. HS means the high-strength group and LS means the low-strength group.

^a,bMeans within a row with no common superscripts differ significantly (P < 0.05).

Eggshell ultrastructure

Scanning electron microscopy images in Fig. 2A show the eggshell ultrastructure in HS and LS. In Fig. 2B, the results of eggshell ultrastructure show that the calcified thickness, effective thickness, and thickness ratio of the effective layer in the HS were significantly higher than those in the LS (P < 0.001; P < 0.001; P = 0.014). There were no significant differences in the mammillary thickness, thickness ratio of the mammillary layer, and mammillary knob width between the two groups (P > 0.05).

Fig. 2.

Eggshell ultrastructure in LS and HS in the late production phase. HS means the high-strength group and LS means the low-strength group. CT, calcified thickness; ET, effective thickness; MT, mammillary layer thickness; MW, width of mammillary knobs; ML, thickness ratio of mammillary layer; EL, thickness ratio of effective layer. Results are reported as the mean ± SEM, n = 10. An asterisk (*) indicates a significant difference (P < 0.05) between groups.

Calcium concentrations in plasma, uterine mucosa and medullary bone

As can be seen from the Fig. 3, both in HS and LS, plasma calcium level was significantly lower at 17 h PO when compared to 1 h and 7 h PO (Fig. 3A, P = 0.002; P = 0.002), and there was no significant difference between 1 h and 7 h PO (Fig. 3A, P > 0.05). Both in HS and LS, uterine mucosa calcium level was significantly lower at 7 h PO when compared to 1 h and 17 h PO (Fig. 3B, P < 0.001; P < 0.001), and there was no significant difference between 1 h and 17 h PO (Fig. 3B, P > 0.05). At 7 h PO, uterine mucosa calcium level in the LS was significantly lower than that in the HS (Fig. 3B, P = 0.027).

Fig. 3.

The concentrations of plasma (A), uterine mucosae (B) and medullary bone (C) calcium at 1 h, 7 h and 17 h PO in LS and HS. HS means the high-strength group and LS means the low-strength group. Results are reported as the mean ± SEM, n = 10. The letters (A, B) and the letters (a, b) indicate significant differences among all time nodes chosen from HS and LS, respectively (P < 0.05). An asterisk (*) indicates a significant difference (P < 0.05) between HS and LS for each time node.

Protein expressions in the uterus

In the HS, the protein expression level of TRPV6 was significantly decreased at 7 h PO compared to that at 1 h PO (Fig. 4A, P = 0.042), but there was no significant difference between 7 h and 17 h PO (Fig. 4A, P > 0.05). In the LS, the protein expression level of TRPV6 was significantly increased at 7 h PO compared with that at 1 h and 17 h PO (Fig. 4A, P = 0.031). Compared with the HS, the LS had a higher protein expression level of TRPV6 at 7 h PO (Fig. 4A, P = 0.017), while no difference was observed at 1 h and 17 h PO (Fig. 4A, P > 0.05). In the LS, the protein expression level of CALB1 was significantly decreased at 7 h PO compared with that at 1 h and 17 h PO (Fig. 4B, P = 0.003) while no significant changes were observed in the HS (Fig. 4B, P > 0.05). At 7 h PO, the protein expression level of CALB1 in the LS was significantly lower than that in the HS (Fig. 4B, P = 0.008).

Fig. 4.

Expression of protein associated with calcium transport in uterus at 1 h, 7 h and 17 h PO in LS and HS. HS means the high-strength group and LS means the low-strength group. Results are reported as the mean ± SEM, n = 3. The letters (A, B) and the letters (a, b) indicate significant differences among all time nodes chosen from HS and LS, respectively (P < 0.05). An asterisk (*) indicates a significant difference (P < 0.05) between HS and LS for each time node. TRPV6, transient receptor potential cation channel subfamily V member 6; CALB1, Calbindin 28 K; ITPR2, IP3 receptor 2.

Gene expression in the uterus

Expression level of ATP2A3 in the HS was significantly increased at 17 h PO when compared to 1 h and 7 h PO (Fig. 5A, P = 0.002), while no significant changes were observed in the LS (Fig. 5A, P > 0.05). Compared with the LS, the HS had a lower expression level of ATP2A3 at 7 h PO and a higher expression level at 17 h PO (Fig. 5A, P = 0.016; P = 0.044). The expression level of ITPR3 in the HS was significantly increased at 17 h PO when compared to 1 h PO (Fig. 5B, P = 0.02). In the HS, the expression level of ATP2B1 was significantly decreased at 7 h PO compared to that at 1 h and 17 h PO (Fig. 5C, P < 0.001), while no significant changes were observed in the LS (Fig. 5C, P > 0.05). At 7 h PO, expression level of ATP2B1 in the HS was significantly lower than that in the LS (Fig. 5C, P = 0.014). Expression level of ATP2B2 in the HS was significantly increased at 17 h PO when compared to 1 h and 7 h PO (Fig. 5D, P < 0.001), while no significant changes were observed in the LS (Fig. 5D, P > 0.05). Compared with the LS, the HS had a lower expression level of ATP2B2 at 7 h PO (Fig. 5D, P = 0.004). In the HS, the expression levels of SLC8A1 and SLC8A3 were significantly upregulated at 17 h PO compared with those at 1 h and 7 h PO (Fig. 5E-F, P = 0.006; P = 0.007).

Fig. 5.

Expression of gene associated with calcium transport in uterus at 1 h, 7 h and 17 h PO in LS and HS. (A) ATP2A3 mRNA; (B) ITPR3 mRNA; (C) ATP2B1 mRNA; (D) ATP2B2 mRNA; (E) SLC8A1 mRNA; (F) SLC8A3 mRNA. HS means the high-strength group and LS means the low-strength group. Results are reported as the mean ± SEM, n = 10. The letters (A, B) and the letters (a, b) indicate significant differences among all time nodes chosen from HS and LS, respectively (P < 0.05). An asterisk (*) indicates a significant difference (P < 0.05) between HS and LS for each time node.

Metabolomics analyses

To characterize the metabolite changes during eggshell calcification, we performed LC-MS/MS-based metabolomic analysis of uterine mucosa from the birds at 7 h and 17 h PO in the HS and LS. Although there was no distinct separation, groups did tend to cluster on the PCA score plots (Additional file1). Using PLS-DA, the results showed distinct separations (Fig. 6). The differential metabolite profile is as follows: 143 differential metabolites were identified between the 7 h and 17 h PO in the HS (Additional file2: Table S1); 148 differential metabolites were identified between the 7 h and 17 h PO in the LS (Additional file2: Table S2); 103 differential metabolites were identified between the HS and LS at 7 h PO (Additional file2: Table S3); 80 differential metabolites were identified between the HS and LS at 17 h PO (Additional file2: Table S4). The metabolic pathways identified mainly involved amino acid metabolism, carbohydrate metabolism, metabolism of other amino acids, nucleotide metabolism, and lipid metabolism (Fig. 7, 8). The concentrations of glutathione, proline, and citrulline were significantly lower at 17 h PO compared to 7 h PO in both the HS and LS. In contrast, the levels of linatine, urate, phenylpyruvate, and tryptophan were significantly higher at 17 h PO than at 7 h PO. Notably, the tricarboxylic acid cycle related metabolites, α-oxoglutarate, and fumarate, showed significantly higher concentrations at 17 h PO in the HS, a trend not observed in the LS (Fig. 7). At 7 h PO, deoxyguanosine, xanthosine, adenosine, and dAMP levels were significantly elevated in the LS compared to the HS. Conversely, sphingosine and phytosphingosine concentrations were significantly higher in the LS at 17 h PO (Fig. 8).

Fig. 6.

Partial least squares-discriminant analysis (PLS-DA) model of uterine mucosa metabolites. (A, B, C, D) Score plots for the positive ion mode. (E, F, G, H) Score plots for the negative ion mode.

Fig. 7.

Schematic model for metabolite changes in uterus at 7 h and 17 h PO in LS and HS. A single red arrow (↑/↓) indicates increased or decreased levels of metabolites at the 17 h PO compared with the 7 h PO in the HS. A single blue arrow (↑/↓) indicates increased or decreased levels of metabolites at the 17 h PO compared with the 7 h PO in the LS.

Fig. 8.

Schematic model for metabolite changes in uterus at 7 h and 17 h PO in LS and HS. A single red arrow (↑/↓) indicates increased or decreased levels of metabolites in the LS compared with the in the HS at 7 h PO. A single blue arrow (↑/↓) indicates increased or decreased levels of metabolites in the LS compared with the in the HS at 17 h PO.

Disscussion

Eggshell breaking strength is an important indicator for evaluating eggshell quality, which directly reflects the ability of eggshell to withstand external pressure. Consistent with the previous report (Fu et al., 2024b), eggshells with low breaking strength exhibited lower eggshell weight, eggshell ratio, and eggshell thickness. The eggshell ultrastructure showed a thinner effective layer and subsequently total calcified layer, confirming successful differentiation between high and low breaking strength eggshell groups. In addition, the low strength eggshells had lower total Ca and P content. The mammillary layer and the effective layer are the main structural layers that determine the mechanical properties of the eggshell, and the formation of eggshell ultrastructure is primarily related to calcium carbonate transit deposition during calcification (Hincke et al., 2012). Therefore, our study focused on three time points (1 h, 7 h, and 17 h PO) to investigate calcium carbonate transit deposition.

Calcium obtained from intestinal absorption and medullary bone mobilization are transported via the blood to the uterus, where they complete the calcification of the eggshell (Bar, 2009). Precise dynamic equilibrium of calcium ions between intestine, bone, plasma and uterus during eggshell calcification is a central physiological process for the maintenance of eggshell quality. In the current study, compared with 1 h and 7 h PO, plasma calcium level in the HS significantly decreased at 17 h PO, which in the LS also showed the same trend. The same blood calcium dynamic curve was reported in Ren et al. (2019) in Hy-Line Brown laying hens. At 17 h PO, a substantial amount of blood calcium is transported into the uterus to satisfy the high calcium demand for eggshell calcification. In addition, approximately one-third of the calcium deposited in the uterus originates from bone mobilization (Nys, 2017; Nys and Le Roy, 2018). Medullary bone provides a stable calcium reservoir for eggshell formation, and the mineral content of medullary bone and the size of bone trabeculae are significantly reduced during eggshell calcification (Kerschnitzki et al., 2014). The persistently declining trend of medullary bone calcium content in the HS also confirmed the bone mobilization during eggshell calcification, while the medullary bone calcium content in the LS increased at 7 h PO. The increase of medullary bone calcium content in the LS might be caused by the decrease of uterine calcium utilization, which does not require a large amount of bone calcium consumption (Fu et al., 2024b). Furthermore, in both the HS and the LS, the calcium content of uterine mucosa at 7 h PO was significantly lower than that at 1 h and 17 h PO, which could attributed to the lack of plasma calcium transport to the uterus during the initiation stage of eggshell calcification. This results in calcium required for eggshell mammillary layer production having to be sourced from uterine tissue, further proved by no significant differences in plasma calcium content at 1 h and 7 h PO. Plasma and medullary bone calcium levels were not significantly different between the HS and LS at any of the three time points, further suggesting an important role for uterine calcium transport in eggshell calcification.

To determine the differences in the transporters mediating calcium movement in the uterus between the HS and LS during the eggshell calcification cycle, protein expression of TRPV6, CALB1, ITPR2, and gene expression of ATP2A3, ITPR3, ATP2B1, ATP2B2, SLC8A1, and SLC8A3 were evaluated. Our findings revealed that uterine calcium transport activity remained stable during the initial stage of eggshell calcification, as there was no significant difference in the expression of calcium transport genes compared with 1 h and 7 h PO. However, compared with the initial stage of eggshell calcification, calcium transport ability of the HS was enhanced during the growth stage of eggshell calcification, as evidenced by the upregulation of ATP2A3, ATP2B1, ATP2B2, SLC8A1 and SLC8A3 at 17 h compared with 7 h PO, to adapt to the rapid calcium calcification during the rapid deposition period (eggshell calcification rate up to 300 mg/h). In contrast, no changes were observed at the gene level in the LS. These outcomes indicated that the upregulation of ion transport during the growth stage of eggshell calcification in HS may be conducive to providing sufficient calcium for eggshell mineralization, resulting in increased calcium deposition and effective layer thickness of eggshells. A higher mRNA expression of CALB1 during eggshell calcification in the uterus of hens has been reported (Jeong et al., 2012; Yang et al., 2013; Sinclair-Black et al., 2024). What needs to be mentioned is, in our study, there was no significant change in the CALB1 protein level of the uterus in HS, which may be due to post-transcriptional regulation of CALB1 (Nys et al., 1989). TRPV6 is involved in the calcium ions transport from the blood to uterine epithelial cells, and it has been noted that low calcium concentrations can stimulate TRPV6 expression in the uterus (Yang et al., 2013). Similarly, we observed that the LS had higher TRPV6 and lower CALB1 protein expression at 7 h PO, indicating that the content of calcium ions in uterine epithelial cells in the LS was lower. The preliminary laboratory results showed that the thinner thickness of the effective layer in the low strength group was related to the slow growth of the eggshell mammillary knobs during the initial stage of eggshell calcification (Fu et al., 2024b). In this study, the low concentration of calcium ions in uterine cells at the initial stage of eggshell calcification may contribute to the slow growth of the mammillary knobs.

A large amount of calcium transport in the uterus is necessary to maintain eggshell calcification. Based on the above results, we identified differences in uterine ion transport at different periods of eggshell calcification between HS and LS. The transcriptomic and proteomic of uterine tissue during eggshell calcification have been described in numerous studies (Brionne et al., 2014; Zhang et al., 2019; Wu et al., 2022). However, the intrauterine environment in which eggshell calcification occurs during different calcification periods has not been reported. The current study used the metabolome analysis to reveal the metabolic changes of eggshell calcification cycles and the metabolic differences between the HS and LS (Fig. 7). At 17 h PO, the growth stage of eggshell calcification, glutamate as a key node is switched off, and metabolism is concentrated in the tricarboxylic acid cycle (TCA cycle) in the HS, which provided energy for the rapid transport of calcium ions, a result that echoed with the increase in calcium transporter gene expression and calcium transporter capacity at 17 h PO. In contrast, the uterine metabolism of the TCA cycle did not show differential changes in the LS, which also echoed the plateauing of calcium transport activity at 7 h and 17 h PO. However, at 7 h PO, the initial stage of eggshell calcification, the key nodes of glutamate opened, and the levels of uterine metabolites glutathione, citrulline, cysteine, and proline increased. Glutathione is a key antioxidant in cells. Typically, cells export a large amount of intracellular glutamate via transporters in exchange for extracellular cystine, which is then converted to cysteine, supporting glutathione biosynthesis and reactive oxygen species (ROS) detoxification (Koppula et al., 2018). Decreased intracellular glutathione levels lead to an increase in reactive oxygen species, which directly or indirectly affects calcium transport proteins located on the plasma membrane, endoplasmic reticulum, and mitochondria (Madreiter-Sokolowski et al., 2020). Citrulline and nitric oxide are produced by the catabolism of arginine under the action of nitric oxide synthase. Citrulline has been shown to have antioxidant properties, either directly by reducing the formation of hydroxyl radicals or indirectly by promoting NO production (Allerton et al., 2018; Uyanga et al., 2020). Dietary addition of citrulline modulated nitric oxide synthesis, antioxidant defense system, and increased egg shape index in laying hens (Uyanga et al., 2020). In addition, proline is both the basis of protein synthesis and contributes to the redox balance regulation of cells (Yam et al., 2019; Lv et al., 2024). Given the importance of glutathione, citrulline, and proline in the antioxidant system, the elevations of these metabolites during the initial stage of eggshell calcification indicate that the uterine tissue is in the process of regulating reoxidation-reduction balance, providing a homeostatic environment for the formation of eggshell mammillary knobs. Moreover, we analyzed the differences in uterine metabolism between the HS and the LS at 7 h PO. We found that the levels of deoxyguanosine, xanthine, and adenosine in the LS were up-regulated, suggesting that the uterine tissue was undergoing cell proliferation and repair activities. Sphingosine and phytosphingosine act as negative regulators of cell proliferation to promote apoptosis (Cuvillier, 2002; Nagahara et al., 2005). We observed that the levels of sphingosine, phytosphingosine, and oxidized glutathione were up-regulated in the LS compared with the HS at 17 h PO, suggesting that the LS might be in a state of oxidative stress, with vigorous apoptotic activity. Phytosphingosine can induce apoptosis by disrupting mitochondria (Nagahara et al., 2005), implying potential mitochondrial dysfunction occurs at this stage, resulting in decreased AMP levels and increased ADP levels, ultimately reducing efficiency of cellular energy production, and impacted calcium transport capacity. Thus, the uterus during the initiation stage of eggshell calcification maintains redox homeostasis to establish an ideal environment for early eggshell development. During the growth stage of eggshell calcification, the uterus is largely responsible for energy supply and metabolism promotion, allowing for the fast transit and deposition of calcium ions, whereas the weak ability of the LS to regulate redox homeostasis compared with that of the HS resulted in the insufficient supply of energy to affect the transport and deposition of calcium.

Conclusion

In conclusion, uterine calcium transport activity is relatively subdued during the initiation stage of eggshell calcification, focusing on redox repair activities to maintain homeostasis for mammillary knobs formation. Further, uterine calcium transport activity becomes highly active during the growth stage of eggshell calcification, primarily supporting rapid calcium transport through enhanced energy metabolism. Lower eggshell breaking strength in aged laying hens may be due to decreasing calcium levels during the initiation stage and imbalanced redox during the growth stage, which could influence calcium transport and result in a weak ultrastructure during the calcification period.

Declaration of competing interest

No conflict of interest exits in the submission of this manuscript, and manuscript is approved by all authors for publication. The work described was original research and has not been published previously.