Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Apr 24.
Published in final edited form as: Mol Cancer Res. 2014 May 19;12(9):1225–1232. doi: 10.1158/1541-7786.MCR-14-0162

BaxΔ2 Promotes Apoptosis through Caspase-8 Activation in Microsatellite-Unstable Colon Cancer

Honghong Zhang 1, Yuting Lin 1, Adriana Mañas 1, Yu Zhao 1, Mitchell F Denning 3, Li Ma 2, Jialing Xiang 1
PMCID: PMC12019869  NIHMSID: NIHMS2070203  PMID: 24842234

Abstract

Loss of apoptotic Bax due to microsatellite mutation contributes to tumor development and chemoresistance. Recently, a Bax microsatellite mutation was uncovered in combination with a specific alternative splicing event that could generate a unique Bax isoform (BaxΔ2) in otherwise Bax-negative cells. Like the prototype Baxα, BaxΔ2 is a potent proapoptotic molecule. However, the proapoptotic mechanism and therapeutic implication of BaxΔ2 remain elusive. Here, the isolation and analysis of isogenic subcell lines are described that represent different Bax microsatellite statuses from colorectal cancer. Colon cancer cells harboring Bax microsatellite G7/G7 alleles are capable of producing low levels of endogenous BaxΔ2 transcripts and proteins. Interestingly, BaxΔ2-positive cells are selectively sensitive to a subgroup of chemotherapeutics compared with BaxΔ2-negative cells. Unlike other Bax isoforms, BaxΔ2 recruits caspase-8 into the proximity for activation, and the latter, in turn, activates caspase-3 and apoptosis independent of the mitochondrial pathway. These data suggest that the expression of BaxΔ2 may provide alternative apoptotic and chemotherapeutic advantages for Bax-negative tumors.

Introduction

A microsatellite is a short stretch of repeating DNA sequence that is prone to deletion or insertion due to the slippage of DNA polymerase (1–3). Dysfunction of the DNA mismatch repair (MMR) system often results in microsatellite instability (MSI; refs. 4, 5). The classic example of MSI is Lynch syndrome (6), in which patients have a high risk of developing many types of cancer, especially hereditary nonpolyposis colorectal cancer (HNPCC; refs. 7, 8). Over 90% of patients with Lynch syndrome have a high level of microsatellite instability (MSI-H; refs. 9–11). If a microsatellite sequence is in the DNA coding region, frameshift mutations can disrupt the translational reading frame and cause truncation or premature termination. Many genes with microsatellite frameshift mutations are cancer related, such as Bax, TGF-II, IGFRII, and TCF-4, which are closely associated with MSI-H colon cancer (12–16). Loss of these key components significantly contributes to tumor development and chemoresistance (17–19).

Bax is a proapoptotic Bcl-2 family member (20–22). Typically, Bax promotes apoptosis through the activation of the mitochondrial death pathway (23, 24). Under a nonstimulated condition, Bax localizes in the cytosol as monomers. Upon stimulation by a death signal, Bax translocates to the mitochondrial membrane where it disrupts the mitochondrial membrane, causes the release of cytochrome C, and sequentially activates caspase-9 and caspase-3 for cell death (24, 25). Bax has several isoforms, mostly generated by alternative splicing between exon 1 and exon 3 or between exon 5 and exon 6 from the prototype Baxα pre-mRNA (21, 26–30). These isoforms either universally exist in normal and cancer cells or are only detectable in certain tissues (29). The proapoptotic activity of Bax isoforms can be well preserved as long as the Bax functional BH domains remain intact (31, 32). Some of the Bax isoforms, such as Baxβ, change the stability of proteins, whereas others change their potencies of cell death (30, 33). Nevertheless, most Bax isoforms promote apoptosis using the same mechanism as the prototype Baxα, that is, through the activation of the mitochondrial death pathway (23, 30, 33, 34).

Bax is one of the genes that are frequently mutated in MSI tumors (16, 35). The inactivation of Bax by a frameshift mutation is found in 50% of HNPCC (16). The deletion of a single guanine nucleotide (G) in the Bax exon 3 microsatellite tract (from G8 to G7) results in a reading frameshift and “Bax-negative” phenotype due to a premature termination codon. The loss of Bax often promotes tumor growth and increases resistance to chemotherapeutics (17–19). Recently, we found that the mutation-mediated loss of Bax could be restored by unique alternative splicing that produces a novel Bax isoform, BaxΔ2, which exists only in cells harboring the Bax microsatellite G7 mutation (36, 37). BaxΔ2 transcripts can be detected in both MSI cancer cell lines and primary tumors (36). BaxΔ2 is a more potent apoptotic inducer than Baxα (36). In this study, we show that BaxΔ2 proteins determine the chemosensitivity of colon cancer cells. Unlike Baxα, the proapoptotic activity of BaxΔ2 is mediated by the activation of the caspase-8 pathway rather than the mitochondrial death pathway. Our results uncover a distinct mechanism by which BaxΔ2 induces apoptosis and suggest that BaxΔ2 is a potential target for cancer therapy.

Materials and Methods

Materials

Antibody against Bax (N20, against the Bax N-terminus) was purchased from Santa Cruz Biotechnology. The BaxΔ2 monoclonal antibody was generated as described (36). Antibodies against cleaved human-specific caspase-8 and mouse-specific caspase-8, and human-specific Bid were from Cell Signaling Technology. The antibody against full-length caspase-8 (LS-C99287) was from Lifespan BioSciences. The pan-caspase inhibitor (Z-VAD-FMK), caspase-1 inhibitor I (Ac-YVAD-CHO), caspase-8 inhibitor II (Z-IETD-FMK), caspase-3 inhibitor II (Z-DEVD-FMK) and caspase-9 inhibitor (Z-LEHD-FMK) were from Calbiochem. Adriamycin, indomethacin, cyclophosphamide (Cytoxan), cysplatin (CDDP), fluorouracil (5-FU), irinotecan (CPT-11), vinblastine, and paclitaxel (taxol) were from Sigma-Aldrich. Etoposide and MG-132 were from Calbiochem. Hydroxyurea, daunorubincin, and epirubicin were from Santa Cruz Biotechnology. Bid-specific inhibitor (BI-6C9) was from Sigma-Aldrich. The mitochondrial membrane potential assay kit was from Abcam.

Cell lines and isogenic sublines

Colon cancer cell line, HCT116, was obtained from American Type Culture Collection. The cell line was tested and authenticated by Genetica before the experiments. Both HCT116 and Bax−/− mouse embryonic fibroblasts (MEF) cells were cultured in DMEM supplemented with 10% FBS. To isolate single cell population from HCT116 cells, cells were treated with 500 μmol/L indomethacin for 72 hours to enrich Bax G7 population (17). Single-cell suspension was plated onto 96-well plates without indomethacin. Single clones were recovered, expanded, and validated by both genomic sequencing and RT-PCR analysis.

Bax microsatellite sequencing and RT-PCR

Genomic DNAs were isolated from different HCT116 sublines with DirectPCR lysis reagent (Viagen Biotech) according to the manufacturer’s instruction. Microsatellite region of Bax gene was amplified by PCR with specific primers surrounding Bax exon 3 microsatellite region, 5′ GAGTGACACCCCGTTCTGAT 3′ (forward) and 5′ ACTCGCTCAGCTTCTTGGTG 3′ (reverse). The PCR products were purified by using MinELute PCR Purification Kit (QIAGEN) and subjected to sequence analysis for determination of the Bax microsatellite status. For RT-PCR, total RNA was isolated using the PureLink RNA Mini Kit (Life Technology) according to the manufacturer’s instruction. The cDNAs were reversely transcribed from mRNA using ThermoScript RT-PCR System (Invitrogen). The transcripts were amplified with Bax primers, 5′-GCT CTA GAG AGC GGC GGT GAT GGA CGG GT-3′ (forward), and 5′-GGA ATT CCA GCT GGG GGC CTC AGC CCA T-3′ (reverse), or BaxΔ2-specific primers, 5′-CCA GAG GCG GGG GGT TTC ATC C-3′ (forward), 5′-GGT TGT CGC CCT TTT CTA CTT TGC CA-3′ (reverse).

Transient transfection and RNAi

Cells were grown in 6-well plates to 70% to 80% confluences before transfection. Caspase-9 dominant negative construct (LZRS-caspase-9, D/N; ref. 38) and Bid siRNA (5′GGGCAAAAGC UUACAAAUAUU3′), as well as controls, were transfected using Lipofectamine 2000 according to the manufacturer’s instruction (Life Technology).

Coimmunoprecipitation and immunostaining

Cell pellets were lysed in NP-40 buffer (145 mmol/L NaCl, 5 mmol/L MgCl, 1 mmol/L EGTA, 0.25% NP-40, 20 mmol/L HEPES, pH 7.4) with a cocktail of protease inhibitors at 4°C for 30 minutes. Cell lysates were incubated with the appropriate antibody-conjugated beads overnight at 4°C. The beads were washed with NP-40 buffer for three times and the immunocomplexes were separated by SDS-PAGE and subjected to immunoblotting analysis. For immunostaining, cells were grown on cover slips coated with 1% gelatin. Cells were fixed and permeabilized with ice-cold methanol and incubated with primary antibodies diluted in PBS plus 0.3%Triton-X and 3% BSA. Following PBS washing, cells were incubated with Alexa fluorescence-conjugated secondary antibodies. Cell nuclei were stained with DAPI (4′, 6-diamidino-2-phenylindole). The fluorescence images were collected by Leica SP5 Laser Scanning Confocal microscope using a ×40 objective.

Mitochondrial membrane potential assay

Cells (5 × 106 per well) in 6-well plates were treated with different stimuli for a period of time as indicated in the figure legends. For the positive control, cells were treated with FCCP (Carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone, 100 μmol/L) for 30 minutes before staining. Mitochondrial membrane potentials (MMP) were analyzed by using a mitochondrial-specific cationic dye (JC-1) according to the manufacturer’s instruction and the images were collected by Nikon TE-2000 fluorescence microscope. The quantitation of MMP was performed using ImageJ program with at least five random fields for each sample.

Colony formation and cell invasion assays

A standard colony formation assay was performed as described (39). Briefly, total 1.5 × 104 cells were seeded in each well in a 6-well plate. After culturing for 3 to 4 weeks, the colonies were visualized by staining with crystal violet and triplicate samples were counted under the dissecting microscope. The Transwell invasion assay was performed by using Transwell inserts with 8.0 μm pore size in 6-well plates. Total 5 × 105 cells were seeded into the upper chamber and cultured for 24 hours. Cells were fixed in the following day with 5% glutaraldehyde and stained by toluidine blue. The inner surface of the upper chamber was carefully wiped using a cotton swab. Invasive cells were counted in three randomly selected fields for each well under a microscope.

Results

The expression of BaxΔ2 proteins can be detected in colon cancer cells harboring the Bax microsatellite G7 mutation allele

BaxΔ2 is a functional Bax isoform produced by a unique combination of a microsatellite mononucleotide deletion (G8 to G7) in Bax exon 3 and alternative splicing of Bax exon 2 (36). HCT116 colon cancer cells contain mixed populations with different Bax microsatellite statuses as follows: the majority of these cells (94%) have mixed Bax alleles (G8/G7); 4% of these cells have pure Bax G7/G7; and 2% of these cells have pure Bax G8/G8 (17). It has been shown that further deletion of the Bax G8 allele in the Bax G8/G7 cells results in a Bax null phenotype and leads to partial chemoresistance (17). We speculated that the population of HCT116 cells harboring the Bax G7 mutation is capable of producing BaxΔ2, thus remaining sensitive to chemotherapeutic treatment. To test this scenario, we isolated single-cell populations using a standard 96-well plating method (Fig. 1A; ref. 17). More than 54 isogenic subclones were isolated and genotyped. The following 20 subclones were further analyzed by both genomic sequence and splicing analyses: 14 clones contained Bax G8/G7; six clones contained G7/G7; and none of the clones contained G8/G8 (Table 1). Interestingly, all six Bax G7/G7 clones contained both detectable transcript products from constitutive splicing and alternative splicing, as determined by RT-PCR (Table 1). In contrast, all Bax G8/G7 clones contained only constitutive splicing transcripts, and none of these clones contained a detectable product from alternative splicing (Table 1). These results suggest that not all alleles containing Bax microsatellite mutations are capable of alternative splicing.

Figure 1.

Figure 1.

Generation and characterization of the isogenic subline cells with the different Bax microsatellite status. A, schematic diagram of generating the HCT116 sublines. Cells were treated with 500 μmol/L indomethacin for 72 hours. A single cell suspension was plated into 96-well plates without indomethacin. Bax microsatellite statuses (G8/G8, G8/G7, or G7/G7) of each sublines were determined by genomic sequencing as described in the Materials and Methods. B, RT-PCR analysis of Bax alternative splicing and BaxΔ2 production. The cDNAs were generated from HCT116 clones #10 (G7/G7 genotype) and clone #28 (G8/G7 genotype) with a set of primers that cover Bax exon 1 through exon 3 or primers specific for BaxΔ2 as described in the Materials and Methods. The PCR products of Baxα and BaxΔ2 plasmid DNA were used as controls. C, immunoblotting of Baxα and BaxΔ2 proteins with an anti-Bax antibody (N20) or an anti-BaxΔ2 antibody (2D4), respectively, in clones #10 and #28 after treatment with MG-132 (10 μmol/L) for 8 hours. Inputs of transfected BaxΔ2 and Baxα were used as positive controls. D, cell growth curve assay of clone #10 and clone #28. Total 1 × 104 cells were seeded onto 24-well plates and the cell numbers were counted every 24 hours up to 96 hours. E, Transwell invasion assay. F, colony formation assay. All experiments were performed independently at least three times.

Table 1.

Analysis of the Bax MSI and splicing statuses in HCT116 isogenic subcell lines

Clone # Bax MSI status Splicing
3 G8/G7 Constitutive
10 G7/G7 Constitutive, alternative
11 G8/G7 Constitutive
20 G7/G7 Constitutive, alternative
22 G7/G7 Constitutive, alternative
24 G8/G7 Constitutive
28 G8/G7 Constitutive
32 G8/G7 Constitutive
37 G8/G7 Constitutive
38 G8/G7 Constitutive
39 G8/G7 Constitutive
40 G8/G7 Constitutive
41 G8/G7 Constitutive
42 G8/G7 Constitutive
44 G7/G7 Constitutive, alternative
48 G8/G7 Constitutive
49 G8/G7 Constitutive
50 G7/G7 Constitutive, alternative
52 G7/G7 Constitutive, alternative
54 G8/G7 Constitutive

To study the ability of the isogenic cells to generate BaxΔ2 transcripts, we further analyzed HCT116 sublines, namely clone #10 (Bax G7/G7) and clone #28 (Bax G8/G7). RT-PCR analysis with primers in Bax exons 1 and 3 revealed that clone #10 (Bax G7/G7) contained both constitutive splicing (upper band) and alternative splicing (lower band), although the constitutive splicing product was predominant (Fig. 1B). In contrast, clone #28 (Bax G8/G7) only contained constitutive splicing products, albeit the Bax G7-mutated allele. Furthermore, only less than 20% of the total pre-mRNA from the Bax G7/G7 population went through the exon 2 alternative splicing (Fig. 1B). To further confirm that the alternative splicing product (lower band) was a BaxΔ2 transcript, the lower band was excised and subjected to sequence analysis. In addition, the BaxΔ2-specific 5′ primer covering the junction of exons 1 and 3 was used in the PCR analysis. As expected, the BaxΔ2 transcript was only detected in clone #10 and the BaxΔ2-positive control, but it was not detected in clone #28 and the Baxα-negative control (Fig. 1B). Thus, BaxΔ2 transcripts can be easily detected in cells containing the Bax G7/G7 allele.

We then determined the expression of endogenous BaxΔ2 proteins in the HCT116 clones #10 and #28 subline cells using a specific anti-BaxΔ2 antibody (36). Immunoblotting analysis revealed that the endogenous BaxΔ2 protein levels were extremely low in clone #10 and undetectable in clone #28 (Fig. 1C). However, BaxΔ2 proteins were easily detected in clone #10 when the cells were treated with MG-132, a proteasomal inhibitor (Fig. 1C). Under the same conditions, clone #28 had no detectable BaxΔ2 proteins. This result was consistent with previous observations (Fig. 1B) that Bax G8/G7 cannot generate detectable BaxΔ2 transcript and protein. Of note, both clone #10 and clone #28 had no detectable parental Baxα proteins, as analyzed by immunoblotting using several anti-Baxα antibodies (Fig. 1C and data not shown). Taken together, these results indicate that cancer cells harboring Bax G7/G7 mutations are capable of generating BaxΔ2 proteins, although the BaxΔ2 proteins seem to be unstable and prone to proteasomal degradation.

To analyze the physiologic characteristics of these two HCT116 isogenic sublines, the growth rate, invasion ability, and colony formation of both clones #10 and #28 cells were analyzed. We found that clones #10 and #28 were quite similar to each other in terms of growth rate (Fig. 1D) and invasive ability (Fig. 1E). However, the BaxΔ2-positive clone #10 had significantly less capability in colony formation compared with the BaxΔ2-negative clone #28 (Fig. 1F). These results indicate that BaxΔ2-positive cells may be less tumorigenic in tumor development.

BaxΔ2-positive subline cells are sensitive to a subgroup of chemotherapeutics

We have previously shown that cancer cells with Bax microsatellite mutations, such as prostate cancer 104-R cells (G7/G7) and colon cancer LoVo cells (G7/G9), are more sensitive to adriamycin treatment than cancer cells with wild-type Bax (36). However, the heterogeneity of different cell lines often adds complexity to data interpretation. To address this issue, we compared HCT116 isogenic subline clone #10 (BaxΔ2-positive) and clone #28 (BaxΔ2-negative) cells for their sensitivities with chemotherapeutic agents. For the initial screening, we selected a panel of different classes of commonly used chemotherapeutic drugs. Cells were treated with a series of doses of each drug, and the results of cell death are shown in Table 2. BaxΔ2-positive clone #10 was more sensitive to adriamycin than BaxΔ2-negative clone #28, which was consistent with the previous report that BaxΔ2-positive cancer cells are more sensitive to adriamycin than BaxΔ2-negative cancer cells (36). In addition, BaxΔ2-positive clone #10 was also highly sensitive to 5-FU, a pyrimidine analogue compared with the BaxΔ2-negative clone #28 (Table 2). Interestingly, the sensitivity seems selective, even within the same class of chemotherapeutic drugs because there was no significant difference when both clones were treated with daunorubicin, which is also an anthracycline antibiotic with a similar structure as adriamycin (Table 2). These data indicate that BaxΔ2-positive cells may have a therapeutic advantage or preference to a subgroup of chemotherapeutic drugs.

Table 2.

Initial screening for chemosensitivities in the HCT116 isogenic subcell lines

Class Name Chemosensitivity
BaxΔ2+ BaxΔ2−
Alkylating Cytoxan ns ns
Cysplatin (CDDP) ns ns
Antimetabolites 5-FU +++ +
Hydroxyurea +++ ++
Antibiotics Doxorubicin +++ +
Daunorubicin ns ns
Epirubicin +++ ++
Topoisomerase inhibitor Etoposide ns ns
Irinotecan (CPT-11) ++ +
Akaloids Taxol ns ns
Vinblastine ns ns

NOTE: Cell viability was determined at 48 hours posttreatment. +, less than 20%; ++, 30% to 50%; +++, >60%.

Abbreviation: ns, no significant difference between the BaxΔ2+ and BaxΔ2− groups.

BaxΔ2 promotes apoptosis through activation of the caspase-8 pathway

Bax typically targets the mitochondria upon activation and results in the activation of the caspase-9 and caspase-3 cascade for cell death (40). To determine the underlying mechanism by which BaxΔ2 promoted cell death, HCT116 clones #10 and #28 were treated with adriamycin or 5-FU in the presence of different caspase inhibitors. We found that the chemodrug-induced apoptosis was significantly augmented in clone #10 and could be effectively inhibited by either a caspase-8 or caspase-3 inhibitor, but not caspase-1 or caspase-9 inhibitor (Fig. 2A). The caspase-3 activity was confirmed by the caspase-3 fluorometric assay (Fig. 2B). The activation of caspase-3 was not surprising because it is an executioner caspase downstream of many caspase-mediated cell death events, including the Bax mitochondrial death pathway (24, 25). However, the activation of caspase-8 was unexpected, as the Bax family usually utilizes the mitochondrial death pathway (24, 25). Consistent with this notion, immunoblotting analysis using an anti-active caspase-8 antibody revealed that caspase-8 was activated, as indicated by the appearance of the cleaved caspase-8 fragments (43 kDa and 18 kDa), in clone #10 when treated with adriamycin or 5-FU but not in clone #28 (Fig. 2C). Thus, BaxΔ2 promoted apoptosis through the activation of caspase-8 and its downstream executioner caspase-3.

Figure 2.

Figure 2.

BaxΔ2 promotes apoptosis through activation of caspase-8. A, cell death assay of HCT116 clone #10 and clone #28 cells treated with or without 5-FU (500 μmol/L) or adriamycin (Adr, 4 μg/mL) for 24 hours in the presence of inhibitors (50 μmol/L each) for caspase-3 (DEVD), caspase-8 (IETD), caspase-1 (YVAD), and caspase-9 (LEHD) as indicated. **, P < 0.01. inh., inhibitor. B, caspase-3 assay of HCT116 clone #10 and #28 cells treated as described in A. The activity of caspase-3 was measured using fluorogenic caspase-3 substrate DEVD-AFC (50 μmol/L) with a microplate spectrofluorometer. C, immunoblotting analysis for the detection of cleaved casapase-8 in the chemodrug-treated clone #10 and #28 cells with an anti-cleaved caspase-8 antibody.

Activation of the Bid mitochondrial pathway is not essential for the onset of BaxΔ2-induced apoptosis

Caspase-8 is one of the initiator caspases in the extrinsic death receptor pathway (41). Once activated, caspase-8 directly activates the executioner caspase-3, or cleaves the BH-3-only protein Bid into tBid, which in turn targets mitochondria and triggers the release of cytochrome c for apoptosis (42, 43). We next determined whether the Bid-dependent mitochondrial death pathway was required for BaxΔ2 to promote apoptosis. We found that Bid was partially degraded in the BaxΔ2-positive clone #10 cells treated with 5-FU or adriamycin but not in the BaxΔ2-negative clone #28 cells (Fig. 3A). However, inhibition of Bid activity by its specific siRNA or inhibitor did not significantly affect the chemodrug-induced apoptosis (Fig. 3B). Similar results were obtained using a caspase-9 inhibitor or ectopic expression of the caspase-9 dominant negative mutant (ref. 44; Fig. 3C). Furthermore, caspase-8 was activated as early as 8 hours and reached to its maximum activity by 16 hours, but the mitochondria membrane potential remained reasonable intact 24 hours posttreatment, as evidenced by simultaneously monitoring the caspase activity and MMP (Fig. 3D and E). Taken together, these data indicate that the Bid-dependent mitochondrial death pathway may not be essential for the onset of chemodrug-induced apoptosis in the BaxΔ2-positive cells. Direct activation of caspase-3 by caspase-8 is likely required for the onset of the apoptosis.

Figure 3.

Figure 3.

The Bid-dependent mitochondrial death pathway is not essential for the onset of chemodrug-induced apoptosis in BaxΔ2-positive cells. A, immunoblotting analysis of cleaved Bid in HCT116 clone #10 and #28 cells treated with or without 5-FU (500 μmol/L) or adriamycin (4 μg/mL) as indicated. The intensities of truncated Bid bands were quantitated relevant to the actin control and are presented as arbitrary numbers. B, cell death assay of HCT116 clone #10 cells treated with 5-FU (500 μmol/L) in the presence of a Bid-specific inhibitor (BI-6C9; 10 μmol/L) or Bid siRNA. C, cell death assay of clone #10 cells treated with 5-FU (500 μmol/L) in the presence of a caspase-9 inhibitor (LEHD; 50 μmol/L) or transfected with a caspase-9 dominant negative (D/N) mutant construct. D, quantitative analysis of cleaved caspase-8 and MMP in a time course indicated for clone #10 cells treated with 5-FU (500 μmol/L). The MMP was measured by JC-1 staining (20 μmol/L) and quantitated by ImageJ software for the decrease in the ratio of red (Em 590) versus green (Em 529) fluorescence intensity. Cleaved caspase-8 was quantitated from the immunoblot analyses by ImageJ software from three independent experiments. E, representative images of JC-1 staining from (D). Carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP; 100 μmol/L) was used as a positive control. JC-1 monomer green fluorescence as observed by excitation with 488 nm and emission with 529 nm (top). JC-1 aggregate red fluorescence as observed by excitation at 546 nm and emission at 590 nm (bottom).

BaxΔ2 activates caspase-8 by recruiting it into proximity

Caspase-8 is usually activated by death receptor-mediated self-processing, that is, the proximity-induced dimerization, followed by aggregation and self-cleavage/activation (45). We speculated whether BaxΔ2 oligomers or aggregates might serve as a platform to recruit caspase-8 into the proximity for activation. To test this hypothesis, we first examined whether BaxΔ2 and caspase-8 were localized together. Bax null MEFs were transfected with BaxΔ2 and the activation of caspase-8 was confirmed by immunoblotting analysis with an anti-cleaved caspase-8 antibody (Fig. 4A). Immunostaining showed that in the absence of BaxΔ2, the staining of caspase-8 was weak and appeared as diffused fine granules (Fig. 4B, top). Upon the expression of BaxΔ2, caspase-8 became aggregated and colocalized with BaxΔ2 (Fig. 4B, bottom). To determine whether BaxΔ2 and caspase-8 physically interacted with each other, we transfected BaxΔ2 into BaxΔ2-negative HCT116 clone #28 cells. Coimmunoprecipitation in combination with immunoblotting analysis revealed that the amount of the caspase-8 cleaved fragment (p43) was significantly higher in the immunocomplex with the anti-BaxΔ2 antibody than that with the IgG control (Fig. 4C). These data suggest that BaxΔ2 oligomers may serve as a platform for caspase-8 aggregation and activation.

Figure 4.

Figure 4.

BaxΔ2 activates caspase-8 through physical interaction. A, Bax−/− MEFs were transfected with BaxΔ2 for 16 hours, and the cleavage of caspase-8 was confirmed by immunoblotting with anti-cleaved caspase-8 antibody. B, cells from A were immunostained with an anti-BaxΔ2 (green) and anti-cleaved caspase-8 antibodies (red), and they were imaged using a confocal microscope. Nuclei were stained with DAPI (blue). C, cells from clone #28 were transfected with BaxΔ2 for 16 hours and subjected to immunoprecipitation (IP) with a BaxΔ2 antibody or control IgG. The immunocomplexes were analyzed by immunoblotting (IB) with anti-caspase-8 and anti-BaxΔ2 antibodies. Actin was used as an input control.

Discussion

Bax is a proapoptotic tumor suppressor and is expressed in almost all types of human cells (21, 46). Exon 3 of Bax contains a microsatellite sequence that is prone to mutation due to replication slippage if the MMR system is impaired (47, 48). A single guanine nucleotide deletion from G8 to G7 is the most common mutation in colorectal cancer with MSI, thus resulting in an apparent Bax null phenotype (47, 48). Interestingly, alternative splicing of Bax exon 2 can rescue the frameshift mutation, generating a unique and functional BaxΔ2 isoform (36). In this report, we demonstrated that cancer cells harboring Bax G7/G7 alleles were capable of producing BaxΔ2 transcripts and proteins, although the levels of BaxΔ2 transcripts and proteins were extremely low and unstable (Fig. 1B and C). BaxΔ2-positive cells were selectively sensitive to a subgroup of chemotherapeutics, such as 5-FU and adriamycin (Table 2 and Fig. 2). Surprisingly, BaxΔ2-promoted apoptosis relied on the activation of caspase-8 and downstream caspase-3 (Fig. 2). The Bid-mitochondrial pathway appeared not essential for onset of the apoptosis (Fig. 3). The mechanism underlying caspase-8 activation by BaxΔ2 was most likely through physical interactions between BaxΔ2 and caspase-8 resulting in the formation of aggregates thereby triggering the apoptotic process (Fig. 4).

There are two criteria in the generation of BaxΔ2. First, the Bax gene must have the deletion of a single guanine nucleotide (G8 to G7) in its exon 3 microsatellite tract. Second, the alternative splicing machinery needs to be able to remove most of exon 2 (36). Previously, we have shown that the alternative splicing factors for BaxΔ2 are universal because cancer or noncancerous, human or murine fibroblast cells are all able to process the BaxΔ2 alternative splicing in a minigene assay (37). Thus, any Bax G7 allele, theoretically, is able to generate BaxΔ2. However, our current results showed that BaxΔ2 transcripts and proteins were only detected in cells harboring the Bax G7/G7 alleles (Fig. 1B). Furthermore, only less than 20% of total pre-mRNA from the Bax G7/G7 population went through exon 2 alternative splicing (Fig. 1B). Neither alternative splicing nor the BaxΔ2 protein was detected in all Bax G8/G7 subclones tested (Table 1). However, the underlying mechanism is not known. One possibility is that the amount of BaxΔ2 generated by Bax G8/G7 is too low to be detected. Another possibility is that there is a potential inhibitory mechanism for alternative splicing to occur in Bax G8/G7 cancer cells. Future studies are needed to test these possibilities.

Bax usually promotes apoptosis through activation of the intrinsic mitochondria death pathway (49, 50). Unlike Baxα and other known Bax isoforms, BaxΔ2 lacks exon 2, which is critical for the mitochondria targeting (33). Although ectopically expressed BaxΔ2 is able to activate the mitochondrial death pathway, it does not mean that BaxΔ2 directly targets mitochondria (36). Our results indicate that caspase-8 via caspase-3 is essential for the onset of BaxΔ2-induced apoptosis, and that mitochondria may act as an amplifier for the death process. Future studies are needed to explore whether this unique proapoptotic feature of BaxΔ2 is related to its ability to sensitize some “Bax-negative” MSI tumor cells to a subgroup of chemotherapeutic drugs.

Implications:

“Bax-negative” colorectal tumors expressing a Bax isoform are sensitive to selective chemotherapeutics.

Grant Support

This work was supported by an NIH grant (R01 CA128114).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Footnotes

Disclosure of Potential Conflicts of Interest

L. Ma and J. Xiang have ownership interest a patent application on the anti-BaxΔ2 antibody in Mumetel LLC. No potential conflicts of interest were disclosed by the other authors.

References

  • 1.Loeb LA. Microsatellite instability: marker of a mutator phenotype in cancer. Cancer Res 1994;54:5059–63. [PubMed] [Google Scholar]
  • 2.Sia EA, Jinks-Robertson S, Petes TD. Genetic control of microsatellite stability. Mutat Res 1997;383:61–70. [DOI] [PubMed] [Google Scholar]
  • 3.Perucho M Cancer of the microsatellite mutator phenotype. Biol Chem 1996;377:675–84. [PubMed] [Google Scholar]
  • 4.Peltomaki P Role of DNA mismatch repair defects in the pathogenesis of human cancer. J Clin Oncol 2003;21:1174–9. [DOI] [PubMed] [Google Scholar]
  • 5.Elliott B, Jasin M. Repair of double-strand breaks by homologous recombination in mismatch repair-defective mammalian cells. Mol Cell Biol 2001;21:2671–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Lynch HT, Lynch PM. The cancer-family syndrome: a pragmatic basis for syndrome identification. Dis Colon Rectum 1979;22:106–10. [DOI] [PubMed] [Google Scholar]
  • 7.Aarnio M, Mecklin JP, Aaltonen LA, Nystrom-Lahti M, Jarvinen HJ. Life-time risk of different cancers in hereditary non-polyposis colorectal cancer (HNPCC) syndrome. Int J Cancer 1995;64:430–3. [DOI] [PubMed] [Google Scholar]
  • 8.Aarnio M, Sankila R, Pukkala E, Salovaara R, Aaltonen LA, de la Chapelle A, et al. Cancer risk in mutation carriers of DNA-mismatch-repair genes. Int J Cancer 1999;81:214–8. [DOI] [PubMed] [Google Scholar]
  • 9.Liu B, Parsons R, Papadopoulos N, Nicolaides NC, Lynch HT, Watson P, et al. Analysis of mismatch repair genes in hereditary non-polyposis colorectal cancer patients. Nat Med 1996;2:169–74. [DOI] [PubMed] [Google Scholar]
  • 10.Abdel-Rahman WM, Ollikainen M, Kariola R, Jarvinen HJ, Mecklin JP, Nystrom-Lahti M, et al. Comprehensive characterization of HNPCC-related colorectal cancers reveals striking molecular features in families with no germline mismatch repair gene mutations. Oncogene 2005;24:1542–51. [DOI] [PubMed] [Google Scholar]
  • 11.Duval A, Hamelin R. Mutations at coding repeat sequences in mismatch repair-deficient human cancers: toward a new concept of target genes for instability. Cancer Res 2002;62:2447–54. [PubMed] [Google Scholar]
  • 12.Yamaguchi T, Iijima T, Mori T, Takahashi K, Matsumoto H, Miyamoto H, et al. Accumulation profile of frameshift mutations during development and progression of colorectal cancer from patients with hereditary nonpolyposis colorectal cancer. Dis Colon Rectum 2006;49:399–406. [DOI] [PubMed] [Google Scholar]
  • 13.Ham MF, Takakuwa T, Luo WJ, Liu A, Horii A, Aozasa K. Impairment of double-strand breaks repair and aberrant splicing of ATM and MRE11 in leukemia-lymphoma cell lines with microsatellite instability. Cancer Sci 2006;97:226–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Miquel C, Jacob S, Grandjouan S, Aime A, Viguier J, Sabourin JC, et al. Frequent alteration of DNA damage signalling and repair pathways in human colorectal cancers with microsatellite instability. Oncogene 2007;26:5919–26. [DOI] [PubMed] [Google Scholar]
  • 15.Schwartz S Jr, Yamamoto H, Navarro M, Maestro M, Reventos J, Perucho M. Frameshift mutations at mononucleotide repeats in caspase-5 and other target genes in endometrial and gastrointestinal cancer of the microsatellite mutator phenotype. Cancer Res 1999;59:2995–3002. [PubMed] [Google Scholar]
  • 16.Rampino N, Yamamoto H, Ionov Y, Li Y, Sawai H, Reed JC, et al. Somatic frameshift mutations in the BAX gene in colon cancers of the microsatellite mutator phenotype. Science 1997;275:967–9. [DOI] [PubMed] [Google Scholar]
  • 17.Zhang L, Yu J, Park BH, Kinzler KW, Vogelstein B. Role of BAX in the apoptotic response to anticancer agents. Science 2000;290:989–92. [DOI] [PubMed] [Google Scholar]
  • 18.Olejniczak SH, Hernandez-Ilizaliturri FJ, Clements JL, Czuczman MS. Acquired resistance to rituximab is associated with chemotherapy resistance resulting from decreased Bax and Bak expression. Clin Cancer Res 2008;14:1550–60. [DOI] [PubMed] [Google Scholar]
  • 19.Jeong SH, Lee HW, Han JH, Kang SY, Choi JH, Jung YM, et al. Low expression of Bax predicts poor prognosis in resected non-small cell lung cancer patients with non-squamous histology. Jpn J Clin Oncol 2008;38:661–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Korsmeyer SJ. BCL-2 gene family and the regulation of programmed cell death. Cancer Res 1999;59:1693s–1700s. [PubMed] [Google Scholar]
  • 21.Oltvai ZN, Milliman CL, Korsmeyer SJ. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 1993;74:609–19. [DOI] [PubMed] [Google Scholar]
  • 22.Chipuk JE, Moldoveanu T, Llambi F, Parsons MJ, Green DR. The BCL-2 family reunion. Mol Cell 2010;37:299–310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Er E, Oliver L, Cartron PF, Juin P, Manon S, Vallette FM. Mitochondria as the target of the pro-apoptotic protein Bax. Biochim Biophys Acta 2006;1757:1301–11. [DOI] [PubMed] [Google Scholar]
  • 24.Goping IS, Gross A, Lavoie JN, Nguyen M, Jemmerson R, Roth K, et al. Regulated targeting of BAX to mitochondria. J Cell Biol 1998;143:207–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Jurgensmeier JM, Xie Z, Deveraux Q, Ellerby L, Bredesen D, Reed JC. Bax directly induces release of cytochrome c from isolated mitochondria. Proc Natl Acad Sci U S A 1998;95:4997–5002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Zhou M, Demo SD, McClure TN, Crea R, Bitler CM. A novel splice variant of the cell death-promoting protein BAX. J Biol Chem 1998;273:11930–6. [DOI] [PubMed] [Google Scholar]
  • 27.Thomas AL, Price C, Martin SG, Carmichael J, Murray JC. Identification of two novel mRNA splice variants of bax. Cell Death Differ 1999;6:97–8. [DOI] [PubMed] [Google Scholar]
  • 28.Schmitt E, Paquet C, Beauchemin M, Dever-Bertrand J, Bertrand R. Characterization of Bax-sigma, a cell death-inducing isoform of Bax. Biochem Biophys Res Commun 2000;270:868–79. [DOI] [PubMed] [Google Scholar]
  • 29.Cartron PF, Oliver L, Martin S, Moreau C, LeCabellec MT, Jezequel P, et al. The expression of a new variant of the pro-apoptotic molecule Bax, Baxpsi, is correlated with an increased survival of glioblastoma multiforme patients. Hum Mol Genet 2002;11:675–87. [DOI] [PubMed] [Google Scholar]
  • 30.Fu NY, Sukumaran SK, Kerk SY, Yu VC. Baxbeta: a constitutively active human Bax isoform that is under tight regulatory control by the proteasomal degradation mechanism. Mol Cell 2009;33:15–29. [DOI] [PubMed] [Google Scholar]
  • 31.Wang K, Gross A, Waksman G, Korsmeyer SJ. Mutagenesis of the BH3 domain of BAX identifies residues critical for dimerization and killing. Mol Cell Biol 1998;18:6083–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Letai A, Bassik MC, Walensky LD, Sorcinelli MD, Weiler S, Korsmeyer SJ. Distinct BH3 domains either sensitize or activate mitochondrial apoptosis, serving as prototype cancer therapeutics. Cancer Cell 2002;2:183–92. [DOI] [PubMed] [Google Scholar]
  • 33.Cartron PF, Priault M, Oliver L, Meflah K, Manon S, Vallette FM. The N-terminal end of Bax contains a mitochondrial-targeting signal. J Biol Chem 2003;278:11633–41. [DOI] [PubMed] [Google Scholar]
  • 34.Shi B, Triebe D, Kajiji S, Iwata KK, Bruskin A, Mahajna J. Identification and characterization of baxepsilon, a novel bax variant missing the BH2 and the transmembrane domains. Biochem Biophys Res Commun 1999;254:779–85. [DOI] [PubMed] [Google Scholar]
  • 35.Shima K, Morikawa T, Yamauchi M, Kuchiba A, Imamura Y, Liao X, et al. TGFBR2 and BAX mononucleotide tract mutations, microsatellite instability, and prognosis in 1072 colorectal cancers. PLoS ONE 2011;6:e25062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Haferkamp B, Zhang H, Lin Y, Yeap X, Bunce A, Sharpe J, et al. BaxDelta2 is a novel bax isoform unique to microsatellite unstable tumors. J Biol Chem 2012;287:34722–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Haferkamp B, Zhang H, Kissinger S, Wang X, Lin Y, Schultz M, et al. BaxDelta2 family alternative splicing salvages Bax microsatellite-frameshift mutations. Genes Cancer 2013;4:501–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Sitailo LA, Tibudan SS, Denning MF. Activation of caspase-9 is required for UV-induced apoptosis of human keratinocytes. J Biol Chem 2002;277:19346–52. [DOI] [PubMed] [Google Scholar]
  • 39.Puck TT, Marcus PI. Action of x-rays on mammalian cells. J Exp Med 1956;103:653–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Garrido C, Galluzzi L, Brunet M, Puig PE, Didelot C, Kroemer G. Mechanisms of cytochrome c release from mitochondria. Cell Death Differ 2006;13:1423–33. [DOI] [PubMed] [Google Scholar]
  • 41.Chang DW, Xing Z, Capacio VL, Peter ME, Yang X. Interdimer processing mechanism of procaspase-8 activation. EMBO J 2003;22:4132–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Gross A, Yin XM, Wang K, Wei MC, Jockel J, Milliman C, et al. Caspase cleaved BID targets mitochondria and is required for cytochrome c release, while BCL-XL prevents this release but not tumor necrosis factor-R1/Fas death. J Biol Chem 1999;274:1156–63. [DOI] [PubMed] [Google Scholar]
  • 43.Kantari C, Walczak H. Caspase-8 and bid: caught in the act between death receptors and mitochondria. Biochim Biophys Acta 2011;1813:558–63. [DOI] [PubMed] [Google Scholar]
  • 44.Denning MF, Wang Y, Tibudan S, Alkan S, Nickoloff BJ, Qin JZ. Caspase activation and disruption of mitochondrial membrane potential during UV radiation-induced apoptosis of human keratinocytes requires activation of protein kinase C. Cell Death Differ 2002;9:40–52. [DOI] [PubMed] [Google Scholar]
  • 45.Jin Z, Li Y, Pitti R, Lawrence D, Pham VC, Lill JR, et al. Cullin3-based polyubiquitination and p62-dependent aggregation of caspase-8 mediate extrinsic apoptosis signaling. Cell 2009;137:721–35. [DOI] [PubMed] [Google Scholar]
  • 46.Knudson CM, Tung KS, Tourtellotte WG, Brown GA, Korsmeyer SJ. Bax-deficient mice with lymphoid hyperplasia and male germ cell death. Science 1995;270:96–9. [DOI] [PubMed] [Google Scholar]
  • 47.Miquel C, Borrini F, Grandjouan S, Auperin A, Viguier J, Velasco V, et al. Role of bax mutations in apoptosis in colorectal cancers with microsatellite instability. Am J Clin Pathol 2005;123:562–70. [DOI] [PubMed] [Google Scholar]
  • 48.Molenaar JJ, Gerard B, Chambon-Pautas C, Cave H, Duval M, Vilmer E, et al. Microsatellite instability and frameshift mutations in BAX and transforming growth factor-beta RII genes are very uncommon in acute lymphoblastic leukemia in vivo but not in cell lines. Blood 1998;92:230–3. [PubMed] [Google Scholar]
  • 49.Korsmeyer SJ, Shutter JR, Veis DJ, Merry DE, Oltvai ZN. Bcl-2/Bax: a rheostat that regulates an anti-oxidant pathway and cell death. Semin Cancer Biol 1993;4:327–32. [PubMed] [Google Scholar]
  • 50.Reed JC. Proapoptotic multidomain Bcl-2/Bax-family proteins: mechanisms, physiological roles, and therapeutic opportunities. Cell Death Differ 2006;13:1378–86. [DOI] [PubMed] [Google Scholar]

RESOURCES