Abstract
Background
Renal tubular injury and activation of peripheral fibroblasts are hallmarks of chronic kidney disease (CKD), suggesting a close connection between the two cell types. Exosomes transport miRNAs and other substances to recipient cells. The involvement of exosome-mediated intercellular communication has been suggested in various diseases, including renal fibrosis. However, the underlying mechanisms remain to be determined.
Methods
Rab 27a-knockout mice were constructed to confirm the role of exosomes in mice with adenine-induced renal fibrosis. Exosome secretion from the kidneys of mice with adenine-induced renal fibrosis and UA-stimulated NRK-52E cells were investigated. Exosomes released from NRK-52E cells were harvested and incubated with NRK-49 F fibroblasts or injected intravenously into the mice via the tail vein. High-throughput miRNA sequencing was used to evaluate the miRNA profiles of UA-Exo. The roles of candidate miRNAs and their target genes and related pathways were predicted and evaluated in vitro and in vivo using specific miRNA mimics, miRNA inhibitors, siRNAs, and adeno-associated viruses (AAV).
Results
Inhibition of exosome secretion by Rab27a knockout or siRNA Rab27a treatment inhibited fibroblast activation and ameliorated renal fibrosis. Significantly increased renal fibrosis was seen in mice treated with adenine, and exosome release was increased after UA treatment of NRK-52E cells. Exosomes released from NRK-52E cells after UA stimulation activated fibroblasts and exacerbated renal fibrosis. The expression of miR-330-3p in exosomes was significantly increased in the UA-Exo group compared with the control group, suggesting the potential use of miR-330-3p as a marker of renal fibrosis. CREBBP was found to be a specific target of miR-330-3p. The stimulation or inhibition of exosomal miR-330-3p release from renal tubular epithelial cells thus promoted or blocked fibroblast activation in vitro, while miR-330-3p-deficient exosomes attenuated renal fibrosis by modulating CREBBP in vivo.
Conclusion
The findings suggest that exosomes play an important role in promoting renal fibrosis by mediating the communication between renal tubular epithelial cells and fibroblasts. This role is associated with inhibition of CREBBP activity by exosomal miR-330-3p in fibroblasts. Thus, the miR-330-3p/CREBBP axis is a promising target for the treatment and management of renal fibrosis.
Supplementary Information
The online version contains supplementary material available at 10.1186/s13287-025-04338-x.
Keywords: Renal fibrosis, Exosome, Renal tubular epithelial cell, Fibroblast, MicroRNA
Introduction
The cases of chronic kidney disease (CKD) are rapidly increasing and placing a heavy burden on medical care [1, 2]. CKD is characterized by the gradual loss of renal function and the progression of renal fibrosis and is a high risk factor for end-stage renal disease [3]. However, the outcomes of CKD remain unsatisfactory currently, in part, because the underlying mechanisms are poorly understood [4]. As key components of the kidneys, renal tubular epithelial cells (RTECs) and fibroblasts play a major role in the development of renal fibrosis, and recent findings suggest communication between them [5]. Information delivery can be mediated by functional proteins and gene loader–exosomes. RTECs, as metabolically active cells that frequently undergo cytophagy and cytotaxis, are major targets and centers of kidney injury [6].
Exosomes are membrane-bound extracellular vesicles (EVs) with diameters ranging from 30 to 150 nm; they are produced within multivesicular bodies during endosomal sorting [7]. Through secretion and endocytosis, exosomes mediate crosstalk between neighboring cells and even trigger communication with distant organs [8]. Moreover, they carry several biomolecules such as proteins, lipids, metabolites, glycans, and RNA and can be excreted into the blood, urine, and even breast milk [8]. Not only serve as markers of fibrosis but also participate in the pathophysiological process of fibrosis in numerous organs and play an important role in the development of renal fibrosis [9–11]. Exosome secretion, a process mediated by multivesicular body transport, is precisely regulated by Rab guanosine triphosphatases, particularly through the actions of Rab27a and Rab27b [12]. They are important communication carriers between cells, and the intervention of microRNAs (miRNAs) on target organs or cells is an important mechanism of their participation in the process of fibrosis [13]. During the development of renal fibrosis, the exosomes of tubular origin play a central role in fibroblast activation and renal fibrosis. Indeed, recent studies have shown that tubular-derived exosomes induce fibroblast activation and lead to renal fibrosis through exosomeencapsulated contents [11, 14, 15]. However, which components carried by tubular epithelial cell–derived exosomes contribute to the initiation of renal fibrosis in tubular epithelial cells and mesenchymal fibroblast communication has not been fully elucidated.
miRNA-330 was first reported in basic research on prostate cancer; it was found to mediate the increase of apoptosis of prostate cancer cells by preventing Akt phosphorylation through E2F1 [16]. Currently, miRNA-330 has been mainly studied in the field of oncology, and its main pathophysiological effects are focused on cell transdifferentiation, migration, and apoptosis [17, 18]. Additionally, recent studies on lung epithelial cell injury, bronchial epithelial cell injury, inflammation, fibroblast proliferation, and invasion have revealed the regulatory role of microRNA-330 [19, 20]. Cyclic adenosine monophosphate–responsive element-binding protein (CREBBP) is a nuclear protein encoded by the CREBBP gene [21]. CREBBP plays an important role in many biological and physiological processes including transcription, differentiation, and apoptosis, and tissue fibrosis [22]. However, whether miR-330-3p and CREBBP play a role in the development of renal fibrosis is unknown.
In this study, we demonstrated the importance of renal tubular cell–derived exosome miR-330-3p in the pathogenesis of renal fibrosis. miR-330-3p was increased in damaged RTECs and secreted into the urine via exosomal packages, and urinary exosomal miR-330-3p could be used as a biomarker of renal fibrosis and decreased renal function. We also found that RTEC-derived exosome miR-330-3p mediated intercellular messaging from damaged renal tubular cells to mesenchymal fibroblasts via CREBBP receptors. Our findings suggest that exosome-mediated activation of the miR-330-3p/CREBBP axis plays a critical role in renal fibrosis. The results of this study may further increase our understanding of the mechanisms of development of renal fibrosis and provide potential therapeutic targets to delay the progression of CKD.
Materials and methods
Cell culture and treatment
Rat RTECs (NRK-52E) and rat fibroblasts (NRK-49 F) were cultured with 10% fetal bovine serum and high-sugar Dulbecco’s Modified Eagle’s Medium (DMEM) in a humidified environment at 37 °C with 5% CO2. A uric acid (UA) (Shanghai Claman Reagent Co., Ltd.)-induced model of fibrosis was established using NRK-52E cells by treating cells with 400 µM of UA for 48 h, followed by incubation in exosome-specific serum-free medium. Some experiments were performed with siRNA Rab27a transfection to pretreat NRK-52E cells, or cells were transfected with miR-330-3p mimics or an miR-330-3p inhibitor along with the corresponding negative control (NC). NRK-52E cells were transfected with 60–70% Lipofectamine 2000 for ensiling according to the manufacturer’s protocol. NRK-49 F cells were treated with exosomes (90 µg/mL) isolated from the NRK-52E cell supernatant.
Animal models
Male C57BL/6J mice (weight 20–25 g) and Rab27a knockout mice (weight 20–25 g) were purchased from GemPharmatech Co., Ltd. (Nanjing, China). C57BL/6J mice were randomly divided into a sham or a model group (n = 6). To establish an adenine-induced model of renal fibrosis, modeled C57BL/6J mice and Rab27a knockout mice were fed 0.2% adenine mixed with AIN-93 M (Research Diets, Inc., New Brunswick), whereas those in the Sham group were provided a normal AIN-93 M diet for 8 weeks. After 8 weeks, 1% sodium pentobarbital, 50 mg/kg intraperitoneal injection for anesthesia in mice, the serum and kidney tissues were collected for analyses.
To effects of exosomes collected from NRK-52E cells treated with or without UA were studied. The collected exosomes were injected (100 µL) into the tail vein of mice in the model group twice a week for 8 weeks. Subsequently, in accordance with the American Veterinary Medical Association Guidelines for the Euthanasia of Animals, 5% isoflurane overdose was administered until complete respiratory arrest occurred, followed by cervical dislocation to confirm death. After euthanasia, the kidneys were harvested, and the surrounding fat and membrane were removed. Kidney samples were either fixed in 4% paraformaldehyde overnight or snap-frozen in liquid nitrogen and stored at -80 °C for further analysis. All animal protocols were approved by the Animal Ethics Committee of Anhui University of Traditional Chinese Medicine (No. AHUCM-rats-2019003). The work has been reported in line with the ARRIVE guidelines.
Human urine samples
All human urine samples were collected from patients with CKD from the Department of Nephrology, Anhui University of Chinese Medicine. Demographic and clinical data are shown in Table S1. Clean, morning urine samples (50 mL) were collected from each of the 30 patients with clinically diagnosed CKD and from 30 healthy volunteers. Urinary exosomes were isolated using ultra-high-speed centrifugation, and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was used to validate the differentially expressed miRNAs. Statistically significant differences in miRNAs were correlated with the estimated glomerular filtration rate (eGFR). All human samples (urine) were collected with written consent. All studies involving human samples were approved by the Ethics Committee on Human Subjects of the First Affiliated Hospital of Anhui University of Chinese Medicine (KY2019005). The clinical data of the patients are shown in Table S1.
Serum creatinine and blood Urea nitrogen (BUN) measurement in mice
Serum creatinine and BUN levels in mice were determined using an automatic chemistry analyzer (C011-2-1, Nanjing Jiancheng Biological Engineering Research Institute, China), and the data are presented as mg/dL.
Exosome isolation
Exosomes were isolated by differential centrifugation at 4 °C using the following procedure: morning urine or cell supernatant was centrifuged at 1000 ×g for 10 min to collect the supernatant, centrifugation at 2000 ×g for 30 min to collect the supernatant, and then centrifugation at 17,000 ×g for 30 min to collect the supernatant. After the removal of cells and debris, the supernatants were filtered through a 0.22-µm filter to remove the microvesicles. For the isolation and purification of exosomes, the supernatant was ultracentrifuged at 28,000 ×g for 80 min at 4 °C (type 70 Ti rotor, Beckman Coulter Optima L-XP). The pellet (exosomes) was washed to remove contaminating proteins, recentrifuged at 28,000 ×g, and resuspended in sterile 1× phosphate-buffered saline (PBS) for quantification.
Labeling of exosomes
NRK-52E cell–derived exosomes were first labeled with the lipophilic fluorescent dyes PKH26 and DiR according to the manufacturer’s instructions. PKH26-labeled exosomes were incubated with NRK-49 F cells for 24 h, and DiR-labeled exosomes were injected into mice via the tail vein.
Nanoparticle tracking analysis (NTA)
NTA was performed using NanoSight NS300 (Malvern, England). Isolated exosomes were diluted using 1× PBS to measure particle size and determine the concentration. Based on the measured concentration, the resuspension volume and dilution factor were used to calculate the absolute number of particles.
Transmission electron microscopy (TEM)
For TEM, 15 µL of exosome samples were first pipetted onto a copper grid for 1 min, and then 15 µL of 2% uranyl acetate staining solution was pipetted and stained at room temperature for 1 min. Then, the exosome samples on the copper grid were blotted dry using a filter paper, and the stained samples were placed under a lamp for 10 min for observation and photographing, and the images were saved.
High-throughput MiRNA sequencing
Purified exosomes from NRK-52E cells with or without UA (400 µM) stimulation were separately subjected to the extraction of total RNA, including the small RNA fraction. After the extraction of the exosomal RNA, high-throughput sequencing was performed by Shanghai OE Biotech Co., Ltd. Total RNA detection, gene library construction, and HiSeq/ MiSeq sequencing were performed according to the manufacturers’ instructions.
Western blotting
Protein expression was analyzed by western blotting following a previously described protocol. The following primary antibodies were used: anti-CD9 (Abcam, Ab92726, 1:500), anti-TSG101 (Abcam, Ab125011, 1:3000), anti-Hsp70 (SANTA, SC-24, 1:1000), anti-α-SMA (Affinity, AF1032, 22p5934, 1:500), anti-E-cadherin (Affinity, BF0219, 19q6272, 1:500), anti-fibronectin (Affinity, AF5335, 14o8589, 1:500), anti-Collagen III (Affinity, AF5457, 65i8386, 1:500), anti-PCNA (Affinity, AF0239, 87a7182, 1:500), anti-FSP1 (Affinity, DF6516, 82h4514, 1:500), and anti-CREBBP (Affinity, AF0861, 16s3573, 1:500).
RT-qPCR
Total RNA was isolated using TRIzol RNA isolation system (Life Technologies, 15596018, 248207) according to the manufacturer’s instructions. cDNA synthesis was carried out using a PrimeScript™ RT reagent kit with gDNA Eraser (TaKaRa, RR047A, AJ51485A), and qRT-PCR was performed using an ABI prism 7000 Sequence Detection System (Applied Biosystems, StepOne Plus). Primer pair sequences for different genes are described in Table S2. The mRNA levels of various genes were calculated after normalizing with β-actin. Primer sequence numbers are shown in Table S2.
Histological analysis
Kidney tissues were fixed in 10% formalin, embedded in paraffin, and cut into 5-µm-thick sections. After deparaffinization and rehydration, the sections were stained with hematoxylin and eosin (H&E) and Masson’s Trichrome stain. The areas at the junction of the cortex and the medulla in the stained sections were selected for histopathological analysis. Masson’s staining was performed to assess collagen fiber deposition in the renal interstitium. ImageJ was used to semi-quantify the positive areas of Masson’s staining (blue). All histopathological analyses were performed by 2 independent investigators who were blinded to the subgroups.
Immunofluorescence staining
After deparaffinization, rehydration, and blocking with goat serum, kidney sections were incubated with anti-α-SMA antibody (HUABIO), E-cadherin (Affinity), collagen III (Affinity), or fibronectin (Affinity) overnight at 4 °C, followed by incubation with Cy3-labeled goat anti-rabbit IgG (H + L) (Beyotime). DAPI (Beyotime) was used to visualize the nuclei. The intensity of the positive staining area was quantified using ImagePro Plus (Media Cybernetics Inc., Rockville, MD, USA).
Dual luciferase reporter assay
To construct a reporter gene plasmid containing the target fragment, we inserted it into a luciferase-expressing vector and successfully transfected it into NRK-49 F cells. At the same time, we also co-transfected these cells with phRL-TK (internal reference).
Fluorescence in situ hybridization (FISH)
The expression levels and localization of 5 miRNAs in renal tissues were determined using FISH. Five probes for Cy3-labeled miRNAs were designed (mmu-miR-330-3p FISH Probe (5′ CY3): TCTCTGCAGGCCCTGTGCTTTGC) and purchased from GenePharma (Shanghai, China). Each probe was hybridized overnight according to the manufacturer’s instructions.
RNA antisense purification
To generate probe-coated beads, streptavidin-coupled magnetic beads (Life Technologies, USA) were incubated with the biotincoupled miR-330-3p probes above and oligo probes for 3 h at room temperature. Approximately 1 × 107 NRK-49 F cells were collected and sonicated, and cell lysates were incubated with probe-coated beads at 4 ℃ overnight for further experiments.
Adeno-associated virus (AAV) serotype 9 packaging and AAV9 treatment
HEK293T cells were cultured in a 10 cm cell-culture dish and cultured with DMEM (10% fetal bovine serum and 1% penicillin/streptomycin). Next, the cells were transfected with 10 mg of miR-330-3p knockdown plasmid (or control plasmid), 10 mg pAAV9 (General Biosystems, Inc., #BB045), and 10 mg pAd Delta F6 (Fenghui Biotechnology Co., #ZT344) using 100 mL polyethylenimine (1 mg/mL, Kingmorn, #KE1098). The supernatant and cells were collected after 48 h. AAV9 virus from the supernatant was obtained by precipitation with PEG8000. Virus from cells was obtained using the repetitive freeze-thaw method. After incubation with 1 M MgCl2 and benzonase nuclease (EMD Millipore Core, USA), the AAV9 virus was purified using density gradient centrifugation with iodixanol (Sigma, USA). The purified AAV9 virus was concentrated in a concentration tube (Amicon Ultra-15, Millipore, Ireland). To detect the viral titer, the genomic viral DNA was extracted using a TIANamp Genomic DNA kit (TIANGEN, China). qRT-PCR was performed to construct a standard curve and determine the viral titer. A single tail vein injection of AAV9 virus was administered at the dose of 1012 GC per mouse. Based on the mature miR-330-3p (GCAAAGCACAGGGCCTATACAC) sequence, the following sequences were designed to knock down miR-330-3p and pENN.AAV.cTNT. Plasmid (General Biosystems, Inc., #BB045-AAV9) was used.
Serotype 9 AAV vectors (AAV9) carrying shRNA against miR-330-3p were obtained from Hanheng Biotechnology (Shanghai, China). Randomly selected mice were subjected to tail vein injection of either AAV9 carrying shRNA against miR-330-3p or the control vector at 50 µL (2 × 1012 vg/mL) per mouse. After 3 weeks, an adenine-induced mouse model was established.
Statistical analyses
Data are presented as mean ± standard error of the mean. Statistical analysis was performed using SPSS 25.0 (SPSS Inc., Chicago, IL). Comparisons were made using Student’s t-test for the comparison of 2 groups, or using one-way analysis of variance followed by the least significant difference or Games–Howell procedure for the comparison of more than 2 groups. p < 0.05 was considered statistically significant. Bivariate correlation analysis was performed using Pearson and Spearman rank correlation analysis.
Results
Rab27a knockout inhibits exosome secretion to attenuate renal fibrosis
The Rab27a knockout mouse model (Rab27a-/- ) was successfully established and confirmed (Fig. 1A and Supplementary Fig. 1). Rab27a knockout decreased exosomal secretion in adenine-treated mice (Fig. 1B and C). Serum creatinine and BUN levels were significantly elevated after adenine-induced renal fibrosis in mice, but Rab27a knockout reduced these levels (Fig. 1D and E). Western blotting and immunofluorescence confirmed that Rab27a knockout inhibited renal fibrosis in adeninetreated mice by suppressing α-SMA, Col-III, and FN deposition. It increased E-cad expression and ameliorated renal fibrosis in adenine-treated mice (Fig. 1F-I). Similarly, mice in the model group exhibited the shedding of RTECs, vacuolar degeneration, and partial tubular lumen dilatation compared with those in the sham group, whereas Rab27a knockout significantly attenuated these pathological changes. Masson’s staining confirmed that Rab27a knockout reduced collagen deposition in adenine-treated mice (Fig. 1J and K). Therefore, it could be concluded that the inhibition of exosome secretion by Rab27a knockout attenuated renal fibrosis.
Fig. 1.
Rab27a knockout inhibits exosome secretion to attenuate renal fibrosis. A Rab27a knockout. B, C Representative western blots (B) and quantitative data (C) of CD63, Hsp70, and TSG101 in Rab27a knockout kidneys after modeling (n = 6). *p < 0.05 versus Sham, #p < 0.05 versus Model. D, E Changes in Scr and BUN levels in mice in each group. F, G Representative western blots (F) and quantitative data (G) of Col-III, α-SMA, FN, and E-cad in Rab27a knockout kidneys after modeling (n = 6). *p < 0.05 versus Sham, #p < 0.05 versus Model. H, I Representative immunofluorescence micrographs (H) and quantitative data (I) showing Col-III, α-SMA, FN, and E-cad expression (n = 6). Scale bars = 50 μm. *p < 0.05 versus Sham, #p < 0.05 versus Model. J, K H&E and Masson’s staining. Representative micrographs (J) and quantitative data (K) are presented (n = 6). Scale bars = 50 μm. *p < 0.05 versus Sham, #p < 0.05 versus Model
UA promotes exosome secretion from RTECs and activates fibroblasts
Immediately following this, we investigated the potential role of RTEC-derived exosomes in the activation of fibroblasts. The pathophysiology of UA-induced renal disease is complex and involves several factors such as endothelial dysfunction, activation of the renin-angiotensin system, oxidative stress, and tubular epithelial cell transformation. Recent studies have shown that persistent hyperuricosuria induces renal tubular mesangial fibrosis with a concomitant increase in the expression of epithelialmesenchymal transition (EMT) markers. After UA plus or minus transfection with siRNA Rab27a, NRK-52E cells were incubated for 24 h in exosome-free medium, and exosomes were collected from the conditioned medium to stimulate normal NRK-49 F cells (Fig. 2A). NTA, western blotting, and TEM showed that most of the isolated EVs were exosomes (Fig. 2B-E). Next, NRK-52E cell-derived exosome tracers were labeled with the lipophilic fluorescent dye PKH26. The fluorescence intensity was markedly enhanced, further confirming that exosome secretion was increased after UA treatment and that PKH26-labeled exosomes were taken up by NRK-49 F cells after co-culturing (Fig. 2F). Western blotting of CD63, TSG101, and Hsp70 confirmed that transfection of siRNA Rab27a significantly inhibited exosome secretion (Fig. 2G and H). In addition, exosomes isolated from UA-treated NRK-52E cells could activate NRK-49 F cells, as evidenced by the increased expression of α-SMA, Col-III, and FN, and decreased expression of E-cad, which was significantly reversed by siRNA Rab27a treatment (Fig. 2I-L).
Fig. 2.
UA promotes exosome secretion from renal tubular epithelial cells and activates fibroblasts. A Schematic diagram of the experimental process. Exosomes from NRK-52E cells without treatment (Ctrl-Exo) or treatment with UA (UA-Exo) were extracted and incubated with NRK-49 F cells. B TEM image of exosomes isolated from NRK-52E cells. Scale bar = 100 nm. C NTA of exosomes from NRK-52E cells. D, E Representative western blots (D) and quantitative data (E) of CD63, Hsp70, and TSG101 in Ctrl-Exo and UA-Exo. F Fluorescent staining images of NRK-52E cell–derived exosomes taken up by NRK-49 F cells. Scale bars = 50 μm. G, H Representative western blots (G) and quantitative data (H) of CD63, Hsp70, and TSG101 in NRK-49 F cells incubated with exosomes from UA- or siRNA Rab27a–treated NRK-52E cells (n = 3). *p < 0.05 versus Ctrl-Exo, #p < 0.05 versus UA-Exo. I, J Representative western blots (I) and quantitative data (J) of Col-III, α-SMA, FN, and E-cad in NRK-49 F cells incubated with exosomes from UA- or siRNA Rab27a–treated NRK-52E cells (n = 3). *p < 0.05 versus Ctrl-Exo, #p < 0.05 versus UA-Exo. K, L Representative immunofluorescence micrographs (K) and quantitative data (L) showing Col-III and FN expression (n = 3). Scale bars = 50 μm. *p < 0.05 versus Ctrl-Exo, #p < 0.05 versus UA-Exo
Exosomes of tubular cell origin aggravate renal fibrosis
To investigate the relationship between tubule-derived exosomes and renal fibrosis, animal experiments were performed using an adenine-induced model of renal fibrosis, in which Ctrl-Exo and UA-Exo were isolated from the supernatant of UA-treated or untreated NRK-52E cells. Mice with renal fibrosis were injected twice weekly with 100 µL of the NRK-52E cell supernatant–extracted Ctrl-Exo or UA-Exo for 8 weeks, respectively (Fig. 3A). DiR-labeled exosomes in NRK-52E cells were observed in renal tissues of mice with renal fibrosis in vivo (Fig. 3B). In addition, injection of UA-Exo significantly induced higher expression of CD63, TSG101, and Hsp70 than that of Ctrl-Exo (Fig. 3C and D). Next, the effects of exosome injection on the kidneys of mice with renal fibrosis were examined. Immunofluorescence staining and western blotting for Col-III, E-cad, α-SMA, and FN, as well as Masson’s staining, showed that compared with Ctrl-Exo, UA-Exo promoted fibroblast proliferation and exacerbated adenine-induced deposition of fibronectin and collagen in the renal tissues of mice with renal fibrosis (Fig. 3E-J).
Fig. 3.
Exosomes of tubular cell origin aggravate renal fibrosis. A Experimental design. Ctrl-Exo or UA-Exo from NRK-52E cells were injected (100 µL) into Adenine-induced model mice through the tail vein twice weekly for 8 weeks. B Mice were injected with DiR-labeled exosomes from NRK-52E cells via the tail vein. Fluorescent images of organs were acquired using an IVIS Spectrum Small Animal Optical Imaging System. Fluorescence luminescence of the heart, lungs, liver, spleen, and kidneys was assessed 12 h after injection. C, D Representative western blots (C) and quantitative data (D) of CD63, Hsp70, and TSG101 in the kidneys of model mice after injecting Ctrl-Exo or UA-Exo (n = 6). *p < 0.05 versus Sham, #p < 0.05 versus Ctrl-Exo. E, F Representative western blots (E) and quantitative data (F) of Col-III, α-SMA, FN, and E-cad in the kidneys of model mice injected with Ctrl-Exo or UA-Exo (n = 6). *p < 0.05 versus Sham, #p < 0.05 versus Ctrl-Exo. G, H H&E and Masson’s staining. Representative micrographs (G) and quantitative data (H) are presented (n = 6). Scale bars = 50 μm. *p < 0.05 versus Sham, #p < 0.05 versus Ctrl-Exo. I, J Representative immunofluorescence micrographs (I) and quantitative data (J) show Col-III, α-SMA, FN, and E-cad expression (n = 6). Scale bars = 50 μm. *p < 0.05 versus Sham, #p < 0.05 versus Ctrl-Exo
RTEC-derived exosome miR-330-3p promotes fibroblast activation
The above in vivo and in vitro experiments have demonstrated that RTEC-derived exosomes play a role in promoting fibroblast activation in a mouse model of adenine-induced renal fibrosis and in the UA-stimulated NRK-52E cell model. However, the specific molecular mechanisms are unknown. To explore whether RTEC-derived exosomal miRNAs play a role, we performed miRNA sequencing of RTEC-derived exosomes (Fig. 4A and B). Among all altered miRNAs, miR-330-3p was the most significantly elevated (Fig. 4C-G). Meanwhile, 50 mL of clean morning urine samples were collected from each of the 30 patients with clinically diagnosed CKD and 30 healthy volunteers. Urinary exosomes were isolated using ultra-high-speed centrifugation, and RT-qPCR was used to determine differentially expressed miRNAs with consistent results (Fig. 4H-L). miR-330-3p expression in UA-stimulated exosomes derived from rat kidney intrinsic cells, including tubular epithelial cells, renal peduncle cells, tethered membrane cells, and endothelial cells was also examined. miR-330-3p was found to be predominantly enriched in RTEC-derived exosomes (Fig. 4M). Moreover, comparison of miR-330-3p levels in cells and cell-derived exosomes indicated that it was mainly enriched in exosomes (Fig. 4N). Meanwhile, miR-330-3p was negatively correlated with eGFR in patients with CKD (Fig. 4O). The receiver operator characteristic (ROC) curve indicated an area under the curve value of 0.7956, indicating that the urinary exosomes of miR-330-3p in patients with CKD could be used as a biomarker to monitor renal fibrosis (Fig. 4P).
Fig. 4.
RTEC-derived exosome miR-330-3p promotes fibroblast activation. A Gene expression profiling using RNA-seq shows differential gene clustering of exosomes from NRK-52E cells with or without UA treatment. B Volcano plot showing differentially expressed genes of the 2 groups as indicated. C-G Relative expression of the top 5 miRNAs among RNA-Seq expression upregulated miRNAs in exosomes from NRK-52E cells with or without UA treatment. H-L Relative expression of the top 5 miRNAs among RNA-seq expression upregulated miRNAs in urinary exosomes in healthy controls and patients with CKD. M miR-330-3p levels in renal intrinsic cell-derived exosomes. N miR-330-3p levels in NRK-52E-Exo, NRK-52E cells, and NRK-52E cells Exo-out. O Simple linear regression between miR-330-3p from urinary exosomes in patients with CKD and the eGFR in patients with CKD. P ROC analysis of the combination of urinary exosomal miR-330-3p for discriminating CKD, an area under the ROC curve of 0.7956
Next, miR-330-3p and CD63 were co-stained using FISH and immunofluorescence. Co-localization of CD63 with miR-330-3p was confirmed, suggesting that miR-330-3p was encapsulated by exosomes (Fig. 5A). To confirm the role of exosomal miR-330-3p, miR-330-3p mimics or the inhibitor was transfected into NRK-52E cells overexpressing or inhibiting exosomal miR-330-3p (Fig. 5B). Immediately after cell transfection and treatment with UA, the corresponding exosomes were added to NRK-49 F cells. miR-330-3p mimics transfected into NRK-52E cell exosomes and stimulation promoted cell proliferation and aggravated renal fibrosis. Similarly, miR-330-3p inhibitor–transfected NRK-52E cell exosomes stimulated NRK-49 F cells, inhibited cell proliferation, and attenuated renal fibrosis. However, mimics NC or inhibitor NC transfection showed no significant changes (Fig. 5C-F).
Fig. 5.
CREBBP is a potential target of miR-330-3p. A FISH and immunofluorescence staining confirming the intracellular transfer of tubule-derived exosomal miR-330-3p and its co-localization with the receptor of CD63 in NRK-52E cells. miR-330-3p (green), CREBBP (red), Scale bars = 50 μm. B Experimental design. C, D Representative western blots (C) and quantitative data (D) of Col-III, FSP1, and PCNA in NRK-49 F cells after stimulation with NRK-52E–delivered exosomes. *p < 0.05 versus Sham, #p < 0.05 versus UA-Exo. △p < 0.05 versus UA-Exo + miR-330-3p mimics. E, F Representative immunofluorescence micrographs (E) and quantitative data (F) showing Col-III and FN expression in NRK-49 F cells after stimulation with NRK-52E–delivered exosomes. Scale bars = 50 μm. *p < 0.05 versus Sham, #p < 0.05 versus UA-Exo. △p < 0.05 versus UA-Exo + miR-330-3p mimics. G-I CREBBP is a potential target of miR-330-3p. (G) Predicted potential miR-330-3p binding site in 3′-UTR of CREBBP mRNA. (H) Luciferase activity in NRK-49 F cells transfected with NC or miR-330-3p mimics together with reporter vector–containing CREBBP-mut binding sequences. #p < 0.05 versus miR-NC. ns, no significant difference. (I) Binding of CREBBP to miR-330-3p in NRK-49 F cells was detected using RAP-qPCR. K, L Representative western blots (K) and quantitative data (L) of CREBBP in NRK-49 F cells after stimulation with NRK-52E–delivered exosomes. *p < 0.05 versus Sham, #p < 0.05 versus UA-Exo. △p < 0.05 versus UA-Exo + miR-330-3p mimics
CREBBP is a potential target of miR-330-3p
We further investigated the possible mechanism by which the RTEC-derived exosome miR-330-3p mediates fibroblast activation. TargetScan software predicted that the 3′-untranslated region (UTR) of the CREBBP gene is a conserved binding site for miR-330-3p (Fig. 5G). To verify the relationship between miR-330-3p and CREBBP, we constructed a wild-type CREBBP (CREBBP-WT) luciferase reporter gene construct carrying CREBBP 3′-UTR. miR-330-3p mimics with CREBBP-WT were transfected into NRK-49 F cells. Compared with the Ctrl group, miR-330-3p mimics inhibited luciferase activity in CREBBP-miR-330-3p–transfected cells (Fig. 5H). The RNA antisense purification (RAP) assay demonstrated CREBBP enrichment in the direct adsorption product of miR-330-3p, confirming the association of miR-330-3p and CREBBP binding (Fig. 5I). FISH and immunofluorescence assay were further used to demonstrate the co-localization of miR-330-3p with CREBBP in RTECs (Fig. 5J). Lastly, we confirmed CREBBP expression in NRK-49 F cells using western blotting. Unsurprisingly, CREBBP expression was significantly reduced by exosomal stimulation in miR-330-3p mimic–transfected NRK-52E cells, but these changes were mitigated by exosomal stimulation in miR-330-3p inhibitor–transfected NRK-52E cells (Fig. 5K and L).
RTEC-derived exosome miR-330-3p mediates fibroblast activation via CREBBP
To further confirm the role of miR-330-3p in CREBBP, NRK-49 F cells were treated with si-CREBBP prior to receiving the exosomes delivered by NRK-52E (Fig. 6A). CREBBP mRNA was significantly suppressed compared with that in the si-NC group (Fig. 6B). Western blotting was performed, which shows NRK-49 F cells treated with si-CREBBP prior to receiving NRK-52E–delivered exosomes. The expression of Col-III, FN, PCNA, and FSP1 increased markedly in NRK-49 F cells but concurrent transfection with miR-330-3p significantly reversed this finding (Fig. 6C-F). In the exosome intervention group, CREBBP levels increased after co-transfection of the miR-330-3p inhibitor with si-CREBBP compared with transfection with si-CREBBP only (Fig. 6G-I), and CREBBP levels were found to be negatively correlated with miR-330-3p levels (Fig. 6J). These results suggested that tubular cell–derived exosome miR-330-3p could mediate fibroblast activation by regulating CREBBP.
Fig. 6.
RTEC-derived exosome miR-330-3p mediates fibroblast activation via CREBBP. A Experimental design. B CREBBP mRNA level after si-CREBBP treatment. ns, no significant difference versus the Ctrl, *p < 0.05 versus the Ctrl. C, D Representative western blots (C) and quantitative data (D) of Col-III, FN, FSP1, and PCNA in NRK-49 F cells after stimulation with NRK-52E–delivered exosomes. *p < 0.05 versus Sham, #p < 0.05 versus UA-Exo. △p < 0.05 versus UA-Exo + si-CREBBP. E, F Representative immunofluorescence micrographs (E) and quantitative data (F) show Col-III and FN expression in NRK-49 F cells after stimulation with NRK-52E–delivered exosomes. Scale bars = 50 μm. *p < 0.05 versus Sham, #p < 0.05 versus UA-Exo. △p < 0.05 versus UA-Exo + si-CREBBP. G, H Representative western blots (G) and quantitative data (H) of CREBBP in NRK-49 F cells after stimulation with NRK-52E–delivered exosomes. *p < 0.05 versus Sham, #p < 0.05 versus UA-Exo. △p < 0.05 versus UA-Exo + si-CREBBP. I CREBBP mRNA levels in NRK-49 F cells after stimulation with NRK-52E–delivered exosomes. *p < 0.05 versus Sham, #p < 0.05 versus UA-Exo. △p < 0.05 versus UA-Exo + si-CREBBP. J miR-330-3p level in NRK-49 F cells after stimulation with NRK-52E–delivered exosomes. *p < 0.05 versus Sham, #p < 0.05 versus UA-Exo. △p < 0.05 versus UA-Exo + si-CREBBP
RTEC-derived exosome miR-330-3p exacerbates renal fibrosis by inhibiting CREBBP expression
To verify the mechanism of action of exosomal miR-330-3p in vivo, we performed a tail vein injection of AAV miR-330-3p to inhibit miR-330-3p in RTEC-derived exosomes. Interestingly, the findings from immunofluorescence staining, western blotting, and Masson’s staining showed that the tail vein injection of exosomes increased fibrosis in the renal tissues of mice with adenine-induced renal fibrosis, whereas the inhibition of miR-330-3p expression in RTEC-derived exosomes suppressed renal fibrosis (Fig. 7A-F). Furthermore, CREBBP was downregulated after renal fibrosis in mice, and CREBBP levels were lower in the UA-Exo group than in the Ctrl-Exo group. However, the inhibition of miR-330-3p in exosomes upregulated CREBBP levels (Fig. 7G-I). Therefore, our experiments revealed that exosomal miR-330-3p of renal tubular cell origin aggravated renal fibrosis by inhibiting CREBBP expression (Fig. 8).
Fig. 7.
RTEC-derived exosome miR-330-3p exacerbates renal fibrosis by inhibiting CREBBP expression. A, B Representative western blots (A) and quantitative data (B) show Col-III, αSMA, FN, E-cad, FSP1, and PCNA expression in mouse kidneys after tail vein injection (n = 6). *p < 0.05 versus Sham, #p < 0.05 versus Ctrl-Exo, ns, no significant difference versus UA-Exo, △p < 0.05 versus UA-Exo. C, D Representative immunofluorescence micrographs (C) and quantitative data (D) show Col-III and FN expression in mouse kidneys after tail vein injection (n = 6). Scale bars = 50 μm. *p < 0.05 versus Sham, #p < 0.05 versus Ctrl-Exo, ns, no significant difference versus UA-Exo, △p < 0.05 versus UA-Exo. E, F H&E and Masson’s staining. Representative micrographs (E) and quantitative data (F) are presented (n = 6). Scale bars = 50 μm. *p < 0.05 versus Sham, #p < 0.05 versus Ctrl-Exo, ns, no significant difference versus UA-Exo, △p < 0.05 versus UA-Exo. G, H Representative western blots (G) and quantitative data (H) show CREBBP expression in mouse kidneys after tail vein injection (n = 6). *p < 0.05 versus Sham, #p < 0.05 versus Ctrl-Exo, ns, no significant difference versus UA-Exo, △p < 0.05 versus UA-Exo. I CREBBP mRNA levels in mouse kidneys after tail vein injection (n = 6). *p < 0.05 versus Sham, #p < 0.05 versus Ctrl-Exo, ns, no significant difference versus UA-Exo, △p < 0.05 versus UA-Exo
Fig. 8.
Renal tubular epithelial cell–derived exosomal miR-330-3p plays a key role in fibroblast activation and renal fibrosis by regulating CREBBP. CREBBP, Cyclic adenosine monophosphate–responsive element-binding protein; TEC, tubular epithelial cell
Discussion
CKD is emerging as a public health problem and has affected more than 10% of the global population [23]. Although induced by several etiologies, renal fibrosis is the ultimate pathologic change in all types of CKD [24]. The main reason for the lack of effective therapeutic measures is the complex mechanism of renal fibrosis that has not yet been fully elucidated.
Renal tubules and interstitium are important components of the kidney. RTECs perform functions such as reabsorption, secretion, excretion, active metabolism, and providing high energy, and are considered to be the main target cells and initial responders after renal injury. The maladaptive repair of renal tubular epithelium is considered a critical step in renal fibrosis [25]. Fibroblasts, which are located in the renal mesenchyme and connect adjacent tubules, provide important structural support and promote tissue remodeling by regulating extracellular matrix components [26]. Therefore, they are the ultimate performers in the development of renal fibrosis [6]. In addition, as neighboring cells, RTECs and fibroblasts usually interfere with each other and transmit information to aid renal repair under physiological conditions or to exacerbate disease progression under maladaptive conditions [11, 27]. Notably, the communication between renal tubular cells and mesenchymal fibroblasts plays a central role in the activation of renal fibrosis. In addition to soluble factors, many signaling proteins, RNAs, and lipids are encapsulated into EVs, such as exosomes, for more efficient transport and to a greater extent to prevent their rapid degradation [14, 15]. Interestingly, recent studies have shown that communication between renal tubular cells and mesenchymal fibroblasts, especially through exosomes, plays a key role in mediating tubular cell EMT and fibroblast activation in renal fibrosis [6, 15].
Exosomes are released by several cell types; they are surrounded by a double membrane from the original cell via cytokinesis. By delivering numerous molecules, exosomes play an important role in intercellular communication to regulate the behavior of recipient cells through receptorligand interactions, direct membrane fusion, or endocytosis [8, 28]. In recent years, the role of exosomes in renal diseases has received increasing attention; however, internal signaling mechanisms still need to be investigated in detail [29–31]. In the present study, we found that RTEC-derived exosomes were associated with renal fibrosis. Our findings demonstrate the importance of these exosomes in the pathogenesis of renal fibrosis. Similarly, renal fibrosis could be inhibited in vivo by blocking exosome secretion, suggesting that exosomes act as unique and powerful signal exchangers between renal tubular cells and fibroblasts and promote the development and progression of renal fibrosis.
A novel finding of this study is that miR-330-3p was enriched in the renal tissues of mice with renal fibrosis, in RTEC-derived exosomes, and in urinary exosomes isolated from patients with CKD. These results suggested that miR-330-3p plays an important role in the progression of renal fibrosis through exosomal secretion. Although some reports have shown that miR-330-3p promotes cardiac and hepatic fibrosis, its effects on renal fibrosis have not been reported [32, 33]. How miR-330-3p is transported to receptor cells remains to be elucidated. We found that miR-330-3p is predominantly expressed in RTECs, whereas its receptor, CREBBP, is mainly located in mesenchymal fibroblasts. CREBBP plays an important role in many biological and physiological processes, including transcription, differentiation, and apoptosis, and can bind several ligands, including miR-330-3p [33]. As an important intranuclear transcriptional protein, it can encode acetyltransferases. In a study on small cell lung cancer, invasion and metastasis were accelerated after CREBBP knockdown in a mouse model [34]. It was found that the metastatic nuclear factor erythroid-derived-like 2 and NF-κB competed for the transcriptional coactivator CREBBP in cystic fibrosis, and that increasing the binding of CREBBP to Nrf2 attenuated the extent of cellular inflammation [35]. Studies on liver fibrosis reveal that circCREBBP is significantly downregulated in primary hepatic stellate cells and the liver tissues of rats with carbon tetrachloride–induced hepatic fibrosis. The decreased adsorption of circCREBBP to hsa-miR-1291 sponges may be a major factor in the progression of liver fibrosis [36]. In ischemia-reperfusion lung-injury studies, zinc finger protein 36 attenuated the progression of pulmonary fibrosis by regulating the CREBBP/p53/p21/Bax signaling pathway. In studies focusing on aortic stenosis, a progressive fibrotic disease, CREBBP was found to prevent valve mesenchymal stromal cells from activating into myofibroblasts, and CREBBP levels were higher in the valves of healthy patients compared with the controls [37]. In conclusion, CREBBP is involved in the fibrotic process of different tissues and has a clear target for fibrotic intervention, but its role in the development of renal fibrosis has not been reported. Here, we conclusively found that CREBBP is associated with renal fibrosis and plays a key role in renal fibrosis.
In this study, we found that exosomes are powerful carriers of biomolecules that transport RTEC-derived miR-330-3p into mesenchymal fibroblasts to bind to CREBBP, and several lines of evidence supported this finding. First, CREBBP knockdown by siRNA in NRK-49 F cells eliminated fibroblast activation induced by RTEC-derived exosome miR-330-3p. In addition, exosomes isolated from UA-stimulated NRK-52E cells exacerbated adenine-induced renal fibrosis in mice with renal fibrosis, but this phenomenon was attenuated in mice with renal fibrosis in which miR-330-3p expression was inhibited and CREBBP levels were increased.
Another novel and interesting finding of this study was the use of miR-330-3p as a marker of renal fibrosis. As invasive renal biopsy remains the gold standard for assessing renal damage; thus, there is a need to develop noninvasive biomarkers as an alternative strategy to assess, predict, and monitor the progression of renal fibrosis in patients with CKD. Notably, given the crucial role of miR-330-3p in the progression of renal fibrosis, the urinary exosomal miR-330-3p of patients with CKD could be used as a biomarker for monitoring the development and progression of renal fibrosis.
Conclusions
Our findings suggest that exosomes play an important role in promoting renal fibrosis by mediating the communication between RTECs and fibroblasts. This role is associated with the inhibition of CREBBP activity in fibroblasts by miR-330-3p that is present in exosomes. Thus, the miR-330-3p/CREBBP axis is a promising target in the therapy and management of renal fibrosis.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
We appreciate the efforts of all patients and healthy controls who participated in this study. The authors declare that they have not used Artificial Intelligence in this study.
Abbreviations
- CKD
Chronic kidney disease
- RTECs
Renal tubular epithelial cells
- EVs
Extracellular vesicles
- CREBBP
Cyclic adenosine monophosphate–responsive element-binding protein
- NRK-52E
Rat renal tubular epithelial cells
- NRK-49F
Rat fibroblasts
- AAV
Adeno-associated viruses
Author contributions
Dai R, Cheng M, Wang YP and Zhang L, designing research studies; Dai R, Peng CY and Cao ZP conducting experiments; Dai R, Jin H and Wang D acquiring data; Dai R, Cheng M, Cao ZP and Zhang L, analyzing data; Dai R, Peng CY, Jin H and Wang D, writing the manuscript.
Funding
This work was supported by grants from the National Natural Science Foundation of China (no. 82274307 and no. 82004165), Natural Science Research Project of Universities in Anhui Province (KJ2021A0545, KJ2021A0546), Collaborative Public Relations Project Plan of Chinese and Western Medicine for Major and Difficult Diseases in Anhui Province (Approval number: 2021-70), Key Projects of Scientific Research in Higher Educational Institutions in Anhui Province (2023AH050749), Natural Science Foundation of Anhui Province (2208085MH269, 202407290785, 2308085MH292), Anhui Provincial Health Research Program (AHWJ2024Aa30409, AHWJ2024BAc20084), Research Project of Center for Xin’an Medicine and Modernization of Traditional Chinese Medicine of IHM, Anhui University of Chinese Medicine, 2023 (no. 2023CXMMTCM018).
Declarations
Ethics approval and consent to participate
All animal protocols were approved by the Animal Ethics Committee of Anhui University of Traditional Chinese Medicine (“P-selectin/PSGL-1 based MAPK signaling pathway for vascular endothelial cell injury to explore the mechanism of promoting renal fibrosis”, No. AHUCM-rats-2019003, approved March 15, 2019). All studies involving human samples were approved by the Ethics Committee on Human Subjects of the First Affiliated Hospital of Anhui University of Chinese Medicine (“Exploring the intervention effect of Qingshen granules in patients with portal nephropathy based on immunoinflammation-mediated mechanisms”, KY2019005, approved May 5, 2019).
Consent for publication
Not applicable.
Competing interests
The authors have declared that no competing interest exists.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rong Dai, Meng Cheng these authors contributed equally to this work.
Contributor Information
Yi-Ping Wang, Email: wypwyp54@aliyun.com.
Lei Zhang, Email: zhang0551lei@163.com.
References
- 1.Rashidi MM, Saeedi Moghaddam S, Azadnajafabad S, Heidari-Foroozan M, Haddadi M, Sharifnejad Tehrani Y, Keykhaei M, Ghasemi E, Mohammadi E, Ahmadi N, Malekpour MR, Mohammadi Fateh S, Rezaei N, Mehrazma M, Larijani B, Farzadfar F. Burden and quality of care index of chronic kidney disease: global burden of disease analysis for 1990–2019, nephrology, dialysis, transplantation: official publication of the European Dialysis and transplant association -. Eur Ren Association. 2024;39(2):317–27. [DOI] [PubMed] [Google Scholar]
- 2.He L, Wei Q, Liu J, Yi M, Liu Y, Liu H, Sun L, Peng Y, Liu F, Venkatachalam MA, Dong Z. AKI on CKD: heightened injury, suppressed repair, and the underlying mechanisms. Kidney Int. 2017;92(5):1071–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Kalantar-Zadeh K, Jafar TH, Nitsch D, Neuen BL, Perkovic V. Chronic kidney disease. Lancet (London England). 2021;398(10302):786–802. [DOI] [PubMed] [Google Scholar]
- 4.Song L, Zhang W, Tang SY, Luo SM, Xiong PY, Liu JY, Hu HC, Chen YQ, Jia B, Yan QH, Tang SQ, Huang W. Natural products in traditional Chinese medicine: molecular mechanisms and therapeutic targets of renal fibrosis and state-of-the-art drug delivery systems. Volume 170. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie; 2024. p. 116039. [DOI] [PubMed]
- 5.Shen AR, Lv LL. Tubule epithelial cells and fibroblasts communication: vicious cycle of renal fibrosis. EBioMedicine. 2022;86:104360. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Liu X, Miao J, Wang C, Zhou S, Chen S, Ren Q, Hong X, Wang Y, Hou FF, Zhou L, Liu Y. Tubule-derived exosomes play a central role in fibroblast activation and kidney fibrosis. Kidney Int. 2020;97(6):1181–95. [DOI] [PubMed] [Google Scholar]
- 7.Yang D, Zhang W, Zhang H, Zhang F, Chen L, Ma L, Larcher LM, Chen S, Liu N, Zhao Q, Tran PHL, Chen C, Veedu RN, Wang T. Progress, opportunity, and perspective on exosome isolation - efforts for efficient exosome-based theranostics. Theranostics. 2020;10(8):3684–707. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Kalluri R, LeBleu VS. The biology, function, and biomedical applications of exosomes, Science (New York, N.Y.) 367(6478) (2020). [DOI] [PMC free article] [PubMed]
- 9.Dinh PC, Paudel D, Brochu H, Popowski KD, Gracieux MC, Cores J, Huang K, Hensley MT, Harrell E, Vandergriff AC, George AK, Barrio RT, Hu S, Allen TA, Blackburn K, Caranasos TG, Peng X, Schnabel LV, Adler KB, Lobo LJ, Goshe MB, Cheng K. Inhalation of lung spheroid cell secretome and exosomes promotes lung repair in pulmonary fibrosis. Nat Commun. 2020;11(1):1064. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Lin Y, Yan M, Bai Z, Xie Y, Ren L, Wei J, Zhu D, Wang H, Liu Y, Luo J, Li X. Huc-MSC-derived exosomes modified with the targeting peptide of aHSCs for liver fibrosis therapy. J Nanobiotechnol. 2022;20(1):432. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Zhao S, Li W, Yu W, Rao T, Li H, Ruan Y, Yuan R, Li C, Ning J, Li S, Chen W, Cheng F, Zhou X. Exosomal miR-21 from tubular cells contributes to renal fibrosis by activating fibroblasts via targeting PTEN in obstructed kidneys. Theranostics. 2021;11(18):8660–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Ostrowski M, Carmo NB, Krumeich S, Fanget I, Raposo G, Savina A, Moita CF, Schauer K, Hume AN, Freitas RP, Goud B, Benaroch P, Hacohen N, Fukuda M, Desnos C, Seabra MC, Darchen F, Amigorena S, Moita LF, Thery C. Rab27a and Rab27b control different steps of the exosome secretion pathway, Nature cell biology 12(1) (2010) 19–30; sup pp 1–13. [DOI] [PubMed]
- 13.(!!!. INVALID CITATION!!! [13]).
- 14.Zhou X, Zhao S, Li W, Ruan Y, Yuan R, Ning J, Jiang K, Xie J, Yao X, Li H, Li C, Rao T, Yu W, Cheng F. Tubular cell-derived Exosomal miR-150-5p contributes to renal fibrosis following unilateral ischemia-reperfusion injury by activating fibroblast in vitro and in vivo. Int J Biol Sci. 2021;17(14):4021–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Chen S, Zhang M, Li J, Huang J, Zhou S, Hou X, Ye H, Liu X, Xiang S, Shen W, Miao J, Hou FF, Liu Y. Zhou, β-catenin-controlled tubular cell-derived exosomes play a key role in fibroblast activation via the OPN-CD44 axis. J Extracell Vesicles. 2022;11(3):e12203. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Lee KH, Chen YL, Yeh SD, Hsiao M, Lin JT, Goan YG, Lu PJ. MicroRNA-330 acts as tumor suppressor and induces apoptosis of prostate cancer cells through E2F1-mediated suppression of Akt phosphorylation. Oncogene. 2009;28(38):3360–70. [DOI] [PubMed] [Google Scholar]
- 17.Chen J, Chen T, Zhu Y, Li Y, Zhang Y, Wang Y, Li X, Xie X, Wang J, Huang M, Sun X, Ke Y. CircPTN sponges miR-145-5p/miR-330-5p to promote proliferation and stemness in glioma. J Experimental Clin cancer Research: CR. 2019;38(1):398. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Cai L, Ye L, Hu X, He W, Zhuang D, Guo Q, Shu K, Jie Y. MicroRNA miR-330-3p suppresses the progression of ovarian cancer by targeting RIPK4. Bioengineered. 2021;12(1):440–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Ren Y, Li L, Wang M, Yang Z, Sun Z, Zhang W, Cao L, Nie S. Knockdown of circrna paralemmin 2 ameliorates Lipopolysaccharide-induced murine lung epithelial cell injury by sponging miR-330-5p to reduce ROCK2 expression. Immunol Investig. 2022;51(6):1707–24. [DOI] [PubMed] [Google Scholar]
- 20.Zhao L, Jiao J, Yan G, Wei W, Fang G, Yu T. Circ_0018168 inhibits the proliferation and osteogenic differentiation of fibroblasts in ankylosing spondylitis via regulating miR-330-3p/DKK1 axis. Regenerative Therapy. 2022;21:175–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Chrivia JC, Kwok RP, Lamb N, Hagiwara M, Montminy MR, Goodman RH. Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature. 1993;365(6449):855–9. [DOI] [PubMed] [Google Scholar]
- 22.Huang YH, Cai K, Xu PP, Wang L, Huang CX, Fang Y, Cheng S, Sun XJ, Liu F, Huang JY, Ji MM, Zhao WL. CREBBP/EP300 mutations promoted tumor progression in diffuse large B-cell lymphoma through altering tumor-associated macrophage polarization via FBXW7-NOTCH-CCL2/CSF1 axis, Signal transduction and targeted therapy 6(1) (2021) 10. [DOI] [PMC free article] [PubMed]
- 23.Huang J, Kong Y, Xie C, Zhou L. Stem/progenitor cell in kidney: characteristics, homing, coordination, and maintenance. Stem Cell Res Ther. 2021;12(1):197. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Jing H, Tang S, Lin S, Liao M, Chen H, Fan Y, Zhou J. Adiponectin in renal fibrosis. Aging. 2020;12(5):4660–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Qi R, Yang C. Renal tubular epithelial cells: the neglected mediator of tubulointerstitial fibrosis after injury. Cell Death Dis. 2018;9(11):1126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Kuppe C, Ibrahim MM, Kranz J, Zhang X, Ziegler S, Perales-Patón J, Jansen J, Reimer KC, Smith JR, Dobie R, Wilson-Kanamori JR, Halder M, Xu Y, Kabgani N, Kaesler N, Klaus M, Gernhold L, Puelles VG, Huber TB, Boor P, Menzel S, Hoogenboezem RM, Bindels EMJ, Steffens J, Floege J, Schneider RK, Saez-Rodriguez J, Henderson NC, Kramann R. Decoding myofibroblast origins in human kidney fibrosis. Nature. 2021;589(7841):281–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Livingston MJ, Shu S, Fan Y, Li Z, Jiao Q, Yin XM, Venkatachalam MA, Dong Z. Tubular cells produce FGF2 via autophagy after acute kidney injury leading to fibroblast activation and renal fibrosis. Autophagy. 2023;19(1):256–77. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Yue B, Yang H, Wang J, Ru W, Wu J, Huang Y, Lan X, Lei C, Chen H. Exosome biogenesis, secretion and function of Exosomal MiRNAs in skeletal muscle myogenesis. Cell Prolif. 2020;53(7):e12857. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Yu Y, Chen M, Guo Q, Shen L, Liu X, Pan J, Zhang Y, Xu T, Zhang D, Wei G. Human umbilical cord mesenchymal stem cell exosome-derived miR-874-3p targeting RIPK1/PGAM5 attenuates kidney tubular epithelial cell damage. Cell Mol Biol Lett. 2023;28(1):12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Xu S, Cheuk YC, Jia Y, Chen T, Chen J, Luo Y, Cao Y, Guo J, Dong L, Zhang Y, Shi Y, Rong R. Bone marrow mesenchymal stem cell-derived Exosomal miR-21a-5p alleviates renal fibrosis by attenuating Glycolysis by targeting PFKM. Cell Death Dis. 2022;13(10):876. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Cao JY, Wang B, Tang TT, Wen Y, Li ZL, Feng ST, Wu M, Liu D, Yin D, Ma KL, Tang RN, Wu QL, Lan HY, Lv LL, Liu BC. Exosomal miR-125b-5p deriving from mesenchymal stem cells promotes tubular repair by suppression of p53 in ischemic acute kidney injury. Theranostics. 2021;11(11):5248–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Zheng R, Liu H, Gu J, Ni B, Sun H, Guo Y, Su C, He K, Du J, Shao Y. Upregulated microRNA–330–3p promotes calcification in the bicuspid aortic valve via targeting CREBBP. Mol Med Rep. 2020;22(3):2351–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Sun XL, Zhang YL, Xi SM, Ma LJ, Li SP. MiR-330-3p suppresses phosphoglycerate mutase family member 5 -inducted mitophagy to alleviate hepatic ischemia-reperfusion injury. J Cell Biochem. 2019;120(3):4255–67. [DOI] [PubMed] [Google Scholar]
- 34.Jia D, Augert A, Kim DW, Eastwood E, Wu N, Ibrahim AH, Kim KB, Dunn CT, Pillai SPS, Gazdar AF, Bolouri H, Park KS, MacPherson D. Crebbp loss drives small cell lung Cancer and increases sensitivity to HDAC Inhibition. Cancer Discov. 2018;8(11):1422–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Ziady AG, Sokolow A, Shank S, Corey D, Myers R, Plafker S, Kelley TJ. Interaction with CREB binding protein modulates the activities of Nrf2 and NF-κB in cystic fibrosis airway epithelial cells, American journal of physiology. Lung Cell Mol Physiol. 2012;302(11):L1221–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Yang YR, Hu S, Bu FT, Li H, Huang C, Meng XM, Zhang L, Lv XW, Li J. Circular RNA CREBBP suppresses hepatic fibrosis via targeting the hsa-miR-1291/LEFTY2 Axis. Front Pharmacol. 2021;12:741151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Walker CJ, Batan D, Bishop CT, Ramirez D, Aguado BA, Schroeder ME, Crocini C, Schwisow J, Moulton K, Macdougall L, Weiss RM, Allen MA, Dowell R, Leinwand LA, Anseth KS. Extracellular matrix stiffness controls cardiac valve myofibroblast activation through epigenetic remodeling. Bioeng Translational Med. 2022;7(3):e10394. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.








