Molecular evidence for the occurrence of cucurbit yellow stunting disorder virus (CYSDV) infecting round melon and wild melon in India

Abstract

Cucurbit yellow stunting disorder virus (CYSDV), has recently been detected in different crops in India, including cucumber, bitter gourd, and watermelon. To investigate the distribution of emerging criniviruses, symptomatic round melon and wild melon plants were analyzed through transmission electron microscopy and RT-PCR. Long filamentous virions (~ 850 nm in length) resembling criniviruses and ~ 550 bp amplicons of RdRp gene specific to the genus Crinivirus were observed. The phylogeny using coat protein gene amino acid sequences of different criniviruses revealed grouping of round melon and wild melon isolates of this study with CYSDV isolates originating from Mexico. These isolates exhibited up to 100% amino acid sequence homology with other previously reported CYSDV isolates worldwide. Further, the associated virus was transmitted successfully to the healthy cucumber test plants in the whitefly-based bio-assay. Results of this study confirm the association of CYSDV in round melon and wild melon plants for the first time in India, highlighting the virus’s rapid geographic and host range expansion. The findings emphasize the urgent need for strategies to manage and mitigate the spread of this devastating virus.

Of 14 criniviruses reported worldwide in different crops and locations, cucurbit yellow stunting disorder virus (CYSDV; Genus: Crinivirus) was first reported from the United Arab Emirates in 1982 infecting muskmelon and watermelon [1]. In India, CYSDV was recently reported in cucumber (Cucumis sativus), bitter gourd (Momordica charantia), and watermelon (Citrullus lanatus) crops [2]. Subsequently, another crinivirus, cucurbit chlorotic yellows virus (CCYV), was reported in pumpkin (Cucurbita moschata) and lettuce (Lactuca sativa) hosts [3, 4]. To ascertain the distribution of the emerging criniviruses in other cucurbit hosts, symptomatic leaf samples (four each) from round melon (Praecitrullus fistulosus) and wild melon (Cucumis callosus) exhibiting bleaching, blistering, chlorosis, stunting, and yellowing symptoms suggestive of crinivirus infection were collected from Bikaner, Rajasthan (Fig. 1A, B).

Fig. 1.

Wild melon (A) and Round melon (B) plants collected from Rajasthan showing the disease symptoms; and the transmission electron micrograph showing the long flexuous rod shaped virion (C) associated with them suggestive of crinivirus infection. The scale bar represents 200 nm. Healthy cucumber plant (D) and the diseased ones showing the symptoms of mild chlorosis and stunting (E) at 15 days and severe chlorosis and stunting (F) at 30 days post whitefly-based transmission of cucurbit yellow stunting disorder virus (CYSDV) isolate of this study

The association of long filamentous virions measuring over 850 nm indicative of crinivirus were observed in leaf-dip preparations under transmission electron microscope (TEM), when two representative samples from each host were tested (Fig. 1C). Based on the TEM results, all the samples were subjected to a two-step RT-PCR assay using generic primers (Crini Pol F’- GCYCCSAGRGTKAATGA and Crini Pol R’- ACCTTGRGAYTTRTCAAA) targeting partial RdRp gene (~ 550 bp) of criniviruses [5]. For the RT-PCR assays, total RNAs were extracted employing the PureLink™ RNA Mini Kit (Invitrogen) and performed cDNA synthesis and RT-PCR assays employing IMPROM-II™ Reverse Transcription system and GoTaq Flexi DNA polymerase, respectively (Promega, Madison, WI, USA). The PCR profile included initial denaturation at 94 °C for 4 min, followed by 35 cycles each of further denaturation at 94 °C for 50 s, annealing at 46 °C for 50 s, primer extension at 72 °C for 50 s, and one cycle of final extension at 72 °C for 10 min. The resultant amplicons of ~ 550 bp from two each samples of round melon and wild melon suggested the association of a crinivirus and were sequenced through outsourcing. The resultant nucleotide sequences of purified PCR products shared 85% homology with RdRP gene sequences of CYSDV Iraq isolate (OR589766). Further, the amplified products derived from another two-step RT-PCR assay performed using CYSDV coat protein gene (~756 bp) specific primers (CYSDV-CP F′- ATGGCGAGTTCGAGTGAGAATAA and CYSDV-CP R′- TCAATTACCACAGCCACCTG) were gel purified, cloned, and sequenced. The resultant nucleotide and deduced amino acid sequences of CP gene were subjected to NCBI BLAST, phylogenetic analysis using Mega11, and sequence identity matrix analysis using BioEdit (version 7.1.3.0) in relation to the respective gene sequences of related criniviruses available in the NCBI GenBank database to further ascertain the associated virus as CYSDV.

CP gene sequence-based phylogeny showed the clustering of Indian isolates of round melon (PQ014401 and PQ014402) and wild melon (MT580505 and PQ014400) with Mexican CYSDV isolates (PP622792, PP622793) (Fig. 2). They shared 89–99% nucleotide and 92–94% amino acid sequence identities. Further, when the CP gene sequences of different CYSDV isolates of this study in relation to those originating from diverse hosts and locations were analyzed through phylogeny, they did not show any tendency to group with respect to their origin (data not shown).

Fig. 2.

Clustering of crinivirus isolates of this study with the cucurbit yellow stunting disorder virus (CYSDV) isolates of Mexico in the phylogenetic tree derived from coat protein amino acid sequences of 14 known crinivirus species [Abutilon yellows virus (AbYV; Crinivirus abutilonis), Bean yellow disorder virus (BnYDV; Crinivirus flavibetae), Beet pseudoyellows virus (BPYV; Crinivirus pseudobetae), Blackberry yellow vein-associated virus (BYVaV; Crinivirus rubi), Cucurbit chlorotic yellows virus (CCYV; Not listed in the current ICTV master species list—ICTV_Master_Species_List_2023_MSL39.v3.xlsx), Diodia vein chlorosis virus (DVCV; Crinivirus diodiae), Lettuce chlorosis virus (LCV; Crinivirus lactucachlorosi), Lettuce infectious yellows virus (LIYV; Crinivirus lactucaflavi), Potato yellow vein virus (PYVV; Crinivirus flavisolani), Strawberry pallidosis-associated virus (SPaV; Crinivirus palidofragariae), Sweet potato chlorotic stunt virus (SPCSV; Crinivirus ipomeae), Tetterwort vein chlorosis virus (TwVCV; Crinivirus chelidonii), Tomato chlorosis virus (ToCV; Crinivirus tomatichlorosis), Tomato infectious chlorosis virus (TICV; Crinivirus contagichlorosis)]

The infection of CYSDV in the tested plants was further validated by whitefly transmission-based bioassay [3] followed by RT-PCR confirmation. The bioassay was conducted employing the whitefly species Bemisia tabaci as the vector with the acquisition access period (AAP) and inoculation access periods (IAP) of 24 h. Eight whitefly individuals per plant were used for inoculating ten cucumber seedlings of first true leaf stage grown in pots containing soilrite as the potting medium under insect-proof cages. Six out of 10 inoculated plants exhibited chlorosis and stunting symptoms at 12–15 days post-inoculation (Fig. 1D–F) and were found positive for CYSDV in the RT-PCR assay performed using CP gene-specific primers (data not shown).

In India, CYSDV has been known to incite natural infection with severe foliar chlorosis, stunting, and yellowing symptoms in the members of Cucurbitaceae, such as cucumber, bitter gourd and watermelon plants [2]. Besides, the results of present study confirmed the association of CYSDV with round melon and wild melon plants for the first time in the world. These results suggest that CYSDV is not only spreading rapidly in different geographic locations but also among different cucurbit hosts as well. This demands a timely plan of work towards checking the spread of this devastating virus as well as to develop strategies to manage the disease.

Funding

Indian Council of Agricultural Research, ICAR-Emeritus Scientist Scheme F.N.9(10)/2018-ES-HRD, Rakesh Kumar Jain

Declarations

Conflicts of interest

The authors declare that they have no conflict of interest.