Skip to main content
Toxicology Research logoLink to Toxicology Research
. 2025 Apr 26;14(2):tfaf058. doi: 10.1093/toxres/tfaf058

FTO-mediated m6A demethylation of KLF4 promotes the proliferation and collagen deposition of keloid fibroblasts

Yanqi Li 1, Wanchao Wang 2, Yuge Wang 3, Hongmei Ai 4,
PMCID: PMC12031721  PMID: 40291597

Abstract

This study aims to elucidate the molecular mechanism mechanism by which FTO affects fibroblast proliferation and collagen deposition in keloids. Human keloid fibroblasts (KFs) and normal fibroblasts were cultured in vitro. FTO expression was silenced in KFs, and cell viability and proliferation were evaluated via CCK-8 and clone formation assays. FTO, KLF4, and MC1R expressions were quantified via qRT-PCR, while the protein levels of FTO, KLF4, MC1R, Collagen I, and Collagen III were determined by Western blot. The m6A RNA methylation status of total RNA was evaluated using the EpiQuik m6A RNA Methylation Quantification Kit. Post-actinomycin D treatment, the stability of KLF4 mRNA and its m6A modification level were measured. ChIP and dual-luciferase reporter assays confirmed the binding between KLF4 and MC1R promoter. KFs presented with significantly enhanced proliferation and collagen deposition, correlating with elevated FTO expression. Silence of FTO repressed the proliferation and collagen deposition of KFs, and elevated the m6A levels of total RNA and KLF4 mRNA in KFs, resulting in enhanced KLF4 mRNA stability and expression. KLF4 bound to the MC1R promoter and promoted MC1R expression. In conclusion, FTO represses KLF4 expression by removing m6A modification and further diminishes MC1R expression, thereby facilitating KF proliferation and collagen deposition.

Keywords: FTO, KLF4, MC1R, keloids, m6A

Introduction

Keloids are benign fibroproliferative tumors that develop due to aberrant wound healing triggered by a variety of factors, such as trauma, burns, vaccinations, and folliculitis.1 Keloids are identified by the excessive deposition of extracellular matrix (ECM) components, primarily collagen within the dermis and subcutaneous tissues, extending beyond the boundaries of the original wound site.2 Fibroblast is the major cell population responsible for collagen deposition, and its uncontrolled proliferation is considered the primary factor contributing to the vigorous development of keloids.3 Owing to the clinical features of persistent growth without self-limitation, high recurrence tendency after resection, and invasion into healthy skin, keloids impose significant physical and psychological burdens to patients.4 Hence, it is imperative to further investigate the pathological mechanism underlying keloids to develop effective therapeutic targets.

N6-methyladenosine (m6A) methylation is recognized as the most prevalent post-transcriptional modification in eukaryotic mRNAs, which is installed by m6A methyltransferases (such as METTL3/14, WTAP, and RBM15), removed by demethylases (such as FTO and ALKBH5), and recognized by m6A-binding proteins (such as YTHDF1/2/3, IGF2BP1/2/3, and HNRNP).5 It is reported that 21,020 unique m6A peaks with 6,573 unique m6A-associated genetic transcripts appear in the keloid samples.6 Emerging evidence has revealed the critical role of m6A methylation in the dysregulation of keloid fibroblast functions. Disruptions in the regulatory mechanisms of m6A modification have been shown to impair critical cellular processes in keloid fibroblasts, including proliferation, migration, and differentiation.7 For example, m6A methyltransferase KIAA1429 overexpression suppresses fibroblast migration and reduces collagen deposition.8 Fat mass- and obesity-associated protein (FTO), a well-characterized m6A demethylase, plays a key role in reversing m6A modifications on RNA, thereby influencing cellular behaviors.9 Xie et al. integrated keloid-related sequencing results from public databases and observed that FTO was highly expressed in the high-risk keloid group.10 Moreover, FTO has also been demonstrated to facilitate keloid development by weakening COL1A1 m6A modification and enhancing its mRNA stability.11 Nevertheless, the significance of FTO in fibroblast proliferation and collagen deposition in keloids remains unclear.

Krüppel-like factor 4 (KLF4) is a zinc finger-containing transcription factor that modulates an array of cellular functions, such as cell proliferation, differentiation, and growth.12 KLF4 expression is decreased in hypertrophic scar-derived fibroblasts, and KLF4 mitigates hypertrophic scar fibrosis via direct activation of BMP4 transcription.13 Up-regulation of KLF4 contributes to improving the anti-fibrotic effect of PRAS40 in scar skin tissues.14 However, the potential role of FTO in modulating keloid fibroblast proliferation and collagen deposition via regulating KLF4 m6A level has not been investigated. The present study aims to investigate the mechanism of FTO-mediated m6A demethylation of KLF4 in the proliferation and collagen deposition of keloid fibroblasts to provide new insights into potential therapeutic strategies and prognostic markers for keloids.

Materials and methods

Cell culture

Human keloid fibroblasts (KFs) (CP-H235; Procell Life Science & Technology Co., Ltd, Wuhan, Hubei, China) and human normal fibroblasts (NFs) (FH0189; FUHENG Biotechnology Co., Ltd, Shanghai, China) were cultured in Dulbecco’s modified Eagle medium (DMEM) containing 10% fetal bovine serum (10,099,158, Gibco, Carlsbad, CA, USA) and 1% penicillin/streptomycin (15,140,148, Gibco) at 37 °C with 5% CO2.

Cell transfection

Small interfering RNA (siRNA) sequences targeting FTO (si-FTO-1, si-FTO-2), KLF4 (si-KLF4–1, si-KLF4–2), melanocortin-1 receptor (MC1R) (si-MC1R-1, si-MC1R-2), along with their corresponding controls (si-NC), as well as KLF4 overexpression vector (oe-KLF4) and its empty control vector (oe-NC) were provided by GenePharma (Shanghai, China). These RNA sequences or vectors were transfected into cells via Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). The cells were collected 48 h post-transfection and the transfection efficiency was determined. siRNA sequences are shown in Table 1.

Table 1.

siRNA sequence.

  SS Sequence AS Sequence
si-FTO-1 GGUUGUUGUGAAGGUUCAAUA UUGAACCUUCACAACAACCUU
si-FTO-2 GCUUGGUGUUAAAGAUUAAAC UUAAUCUUUAACACCAAGCAA
si-NC (FTO) GUAUGUUGUAGGUGGAUCAUA UGAUCCACCUACAACAUACUU
si-KLF4–1 GCACUACAAUCAUGGUCAAGU UUGACCAUGAUUGUAGUGCUU
si-KLF4–2 GGUGAGUCUUGGUUCUAAAGG UUUAGAACCAAGACUCACCAA
si-NC (KLF4) GAUCCAGCCUAUACAUGAAGU UUCAUGUAUAGGCUGGAUCUU
si-MC1R-1 GCAUCUUCAAGAACUUCAACC UUGAAGUUCUUGAAGAUGCAG
si-MC1R-2 GCUACAUCUCCAUCUUCUACG UAGAAGAUGGAGAUGUAGCGG
si-NC (MC1R) UCACAUAGCAAGCUUACUACC UAGUAAGCUUGCUAUGUGAUU

Quantitative real-time polymerase chain reaction (qRT-PCR)

The total RNA was extracted using RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and reverse transcribed into cDNA using Reverse Transcription Kit (RR047A, Takara, Toyko, Japan). Next, qRT-PCR was performed using SYBR® Premix Ex TaqTM II (Perfect Real Time) Kit (DRR081, Takara, Toyko, Japan) and real-time fluorescence quantitative PCR instrument (ABI 7500, ABI, Foster City, CA, USA). The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd (Shanghai, China). Primer sequences are shown in Table 2. The Ct value of each well was recorded and the relative gene expression was calculated via the 2-ΔΔCt method,15 with GAPDH serving as the internal reference.

Table 2.

qPCR primers.

  Forward Primer (5′-3′) Reverse Primer (5′-3′)
FTO GCATGGCTGCTTATTTCGGG AGGAAGGTCTCACAAGCAGC
KLF4 TTAATGAGGCAGCCACCTGG TTAATGAGGCAGCCACCTGG
m6A-site1 CACCGGACCTACTTACTCGC AACCCCAAATTGGCCGAGAT
m6A-site2 TTCCCATCTCAAGGCACACC CATGTGTAAGGCGAGGTGGT
m6A-site3 AGATGGGGTCTGTGACTGGA TCCACAACTTCCAGTCACCC
MC1R GACCCTGGGCAGTTCCTTAC CACGACTGCTGGTGAGAAGT
pro-MC1R CTTTGGCTGAGAGCAGAGGG CACAGTCTGTCCTGGTCACC
GAPDH GATTCCACCCATGGCAAATTC CTGGAAGATGGTGATGGGATT

Note: FTO: Fat mass and obesity-associated protein; KLF4: Kruppel-like factor 4; MC1R: Melanocortin-1 receptor; GAPDH: glyceraldehyde-3-phosphate dehydrogenase

Western blot

The cells were lysed with enhanced radioimmunoprecipitation assay (RIPA) buffer containing protease inhibitors (Boster Biological Technology Co., Ltd, Wuhan, Hubei, China). Then the protein concentration was determined using bicinchoninic acid assay kit (Boster Biological Technology Co., Ltd). The proteins were separated by 10% SDS-PAGE and transferred to PVDF membranes. The blot was incubated with 5% bovine serum albumin for 2 h at room temperature to block nonspecific binding. After blocking, the blot was kept with diluted primary antibodies overnight at 4 °C. After rinsing, the membranes were incubated with horseradish peroxidase-labeled secondary antibody IgG (1:2000, ab205718, Abcam Inc., Cambridge, MA, USA) for 1 h and visualized via enhanced chemiluminescence working solution (EMD Millipore, Billerica, MA, USA). The used primary antibodies included FTO (1:10000, ab126605, Abcam), KLF4 (1:1000, ab215036, Abcam), MC1R (1:5000, ab125031, Abcam), Collagen I (1:5000, ab138492, Abcam), Collagen III (1:5000, ab7778, Abcam), and Lamin B (1:500, ab32535, Abcam). Gray scale quantification of Western blot bands for each group was performed using Image Pro Plus 6.0 (Media Cybernetics, San Diego, CA, USA), with Lamin B as the internal reference. Each experiment was repeated three times. The original Gels and Blots images can be found in Supplementary Materials 1.

Cell counting kit-8 (CCK-8) assay

The cells (5 × 103) were seeded into 96-well plates. After 48 h, 10 μL CCK-8 reagent (CK04, Dojindo Laboratories, Japan) was added for 3 h of incubation. The absorbance at 450 nm was measured using a microplate reader (Bio-Rad, Hercules, CA, USA).

Clone formation assay

The cells (1 × 103) were seeded into 6-well plates and incubated at 37 °C for 2 weeks. The colonies were fixed in methanol and stained with 0.1% crystal violet. Images were captured and quantified for each colony. All the original results can be found in Supplementary Materials 2.

Detection of the total m6A level

The m6A level of total RNA was measured using m6A RNA Methylation Quantification Kit (ab185912, Abcam). Briefly, 200 ng RNA and 80 μL binding solution were added into 96-well plates and incubated at 37 °C for 90 min for RNA binding. Approximately 50 μL of capture antibody was added to each well and incubated at room temperature for 60 min. Next, the detection antibody and enhancer solution were added for 30 min of incubation at room temperature. Finally, developer solution was added, followed by a 5-min of incubation at 25 °C in the dark. The reaction was terminated by the addition of a stop solution. The absorbance at 450 nm was measured using a microplate reader. The percentage of m6A in total RNA was calculated as per the following formula: Inline graphic, where NC and PC refer to the negative and positive controls provided in the kit respectively; S represents the amount of RNA input while P denotes the amount of RNA of the positive control, both measured in nanograms (ng).

Detection of KLF4 mRNA stability by actinomycin D

The cells were treated with 2 mg/mL actinomycin D (SBR00013, Merck, Germany). For RNA extraction, cells were collected at 0, 2, 4, 6, and 8 h. The stability of KLF4 mRNA was detected by qRT-PCR.

Methylated RNA immunoprecipitation (MeRIP)

MeRIP was performed using the MeRIP m6A Transcriptome Profiling Kit (C11051–1, RIBOBIO, Guangzhou, China) to detect the KLF4 m6A level. The total RNA was extracted from cells and fragmented according to the manufacturer’s protocol. The protein A/G magnetic beads, m6A antibody, and MeRIP reaction solution were added, and the resulting eluted product was used for qRT-PCR. All primers are listed in Table 2.

Chromatin immunoprecipitation (ChIP)

EZ-ChIP Kit (17-371FR, Millipore) was used for ChIP to detect the interaction between KLF4 and MC1R promoter. NF and KF cell suspensions were crosslinked with 1% formaldehyde for 10 min and quenched with 0.125 M glycine solution. The samples were then sonicated and incubated with KLF4 antibody (1:50, AF3640, R&D Systems, Minnesota, USA) or IgG antibody (1:50, 2729S, Cell Signaling Technology, Danvers, MA, USA) for immunoprecipitation, with IgG as the negative control. The eluted product was used for qRT-PCR. Primers are shown in Table 1.

Dual-luciferase reporter gene assay

The synthesized MC1R promoter sequence containing KLF4 binding site (pro-MC1R-WT) and its mutant type according to the binding site (pro-MC1R-MUT) were constructed into pCMV-reporter plasmid (16,156, Thermo Fisher, Waltham, MA, USA), and co-transfected with oe-KLF4 or oe-NC into NFs, respectively. The cells were recovered and lysed 48 h after transfection. The luciferase activity was detected using a luciferase assay kit (K801–200, Biovision, Mountain View, CA, USA).

Bioinformatics

The m6A modification site of KLF4 mRNA was predicted through the SRAMP database16 (http://www.cuilab.cn/sramp/). The binding site between KLF4 and MC1R promoter was predicted through the JASPAR database17 (https://jaspar.genereg.net/).

Statistical analysis

Data were statistically analyzed via SPSS 21.0 (IBM Corp., Armonk, NY, USA) and the map was plotted using GraphPad Prism 8.0 (GraphPad Software Inc., San Diego, CA, USA). The data were examined for normal distribution and homogeneity of variance. The t test was adopted for comparisons between two groups, and one-way or two-way analysis of variance (ANOVA) was employed for the comparisons among multiple groups, following Tukey’s multiple comparison test. Statistical significance was defined as P < 0.05.

Results

The proliferation and collagen deposition of KFs are significantly enhanced and FTO expression is increased

Both NFs and KFs were evaluated for proliferation and collagen deposition. In comparison to NFs, KFs showed higher cell viability and proliferation potentials (P < 0.05, Fig. 1A and B), and the protein levels of collagen I and collagen III were notably increased (P < 0.05, Fig. 1C). The expression of FTO in KFs was significantly elevated (P < 0.05, Fig. 1C and D).

Fig. 1.

Fig. 1

The proliferation and collagen deposition of KFs are significantly enhanced and FTO expression is increased. A) Detection of cell viability by CCK-8 assay. B) Detection of cell proliferation by clone formation assay. C) Detection of FTO, collagen I, and collagen III expressions in cells by western blot. D) Detection of FTO expression in cells by qRT-PCR. The cell experiments were repeated three time independently. Data are presented as mean ± SD. Data in panels A/B/D were analyzed by t test, and data in panel C were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons test. *P < 0.05.

Silence of FTO represses the proliferation and collagen deposition of KFs

FTO expression in KFs was silenced to investigate its impact on KF proliferation and collagen deposition. Two siRNAs targeting FTO (si-FTO-1 and si-FTO-2) were transfected into KFs and the transfection efficiency was detected (P < 0.05, Fig. 2A). si-FTO-1, which demonstrated better transfection efficiency, was selected for subsequent experiments. After silence of FTO in KFs (P < 0.05, Fig. 2A and B), the viability and proliferation of KFs were weakened significantly (P < 0.05, Fig. 2C and D), and the protein levels of collagen I and collagen III were decreased (P < 0.05, Fig. 2B). These results indicated that silence of FTO effectively repressed the proliferation and collagen deposition of KFs.

Fig. 2.

Fig. 2

Silence of FTO represses the proliferation and collagen deposition of KFs. Two siRNAs targeting FTO (si-FTO-1 and si-FTO-2) were transfected into KFs, with si-NC as the control. A) Detection of transfection efficiency by qRT-PCR. B) Detection of FTO, collagen I, and collagen III expressions in cells by western blot. C) Detection of cell viability by CCK-8 assay. D) Detection of cell proliferation by clone formation assay. The cell experiments were repeated three time independently. Data are presented as mean ± SD. Data in panel A were analyzed by one-way ANOVA, while data in panel B were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons test, and data in panels C/D were analyzed by t test. *P < 0.05.

FTO inhibits KLF4 expression by removing m6A modification, and KLF4 promotes MC1R expression

FTO is a critical m6A demethylase, and the m6A level of total RNA in KFs is reduced as a result of enhanced FTO expression. After silence of FTO, the m6A level of total RNA was elevated in KFs (P < 0.05, Fig. 3A). KLF4 is poorly expressed in scar tissues and inhibits fibroblast proliferation.13,18 Therefore, this study suggests that FTO represses KLF4 expression by demethylating m6A modifications on KLF4 mRNA in KFs. Three high-confidence m6A modification sites were identified in the KLF4 mRNA sequence via prediction using the SRAMP database (Fig. 3B). Through MeRIP experimental detection, it was found that the m6A modification levels at all three m6A modification sites of KLF4 mRNA in KFs were decreased, while silence of FTO increased the m6A levels at all three m6A modification sites of KLF4 mRNA (P < 0.05, Fig. 3C). Moreover, the stability of KLF4 mRNA in KFs was attenuated but significantly improved after silence of FTO (P < 0.05, Fig. 3D). Also, KLF4 expression was reduced in KFs and elevated after FTO silencing (P < 0.05, Fig. 3E and F). These results indicate that FTO inhibits KLF4 expression by removing m6A modification.

Fig. 3.

Fig. 3

FTO inhibits KLF4 expression by removing m6A modification, and KLF4 promotes MC1R expression. A) Dtection of the total RNA m6A level by m6A RNA methylation quantification kit. B) Prediction of the possible m6A modification sites of KLF4 mRNA through the SRAMP database. C) Detection of the KLF4 m6A level by MeRIP. D) Detection of the KLF4 mRNA stability after actinomycin D treatment. E) Detection of KLF4 and MC1R expressions by qRT-PCR. F) Detection of KLF4 and MC1R expressions by western blot. G) Detection of the binding between KLF4 and MC1R by ChIP. H) Verification of the binding between KLF4 and MC1R by dual-luciferase reporter gene assay. The cell experiments were repeated three time independently. Data are presented as mean ± SD. Data in panel a were analyzed by one-way ANOVA, while data in panels C-H were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons test. *P < 0.05.

In KFs, MC1R expression is decreased, which promotes cell proliferation and collagen deposition.19,20  KLF4 is predicted to bind to the MC1R promoter by the JASPAR database (Fig. 3H). Therefore, it was predicted that KLF4 stimulated MC1R expression by binding to its promoter. ChIP and dual-luciferase reporter gene assays verified that KLF4 bound to the MC1R promoter (P < 0.05, Fig. 3G and H). Further, the study found that MC1R expression was decreased in KFs and increased significantly after silence of FTO (P < 0.05, Fig. 3E and F). The above results indicate that KLF4 promotes MC1R expression.

Silence of KLF4 partially reverses the inhibitory effect of FTO silencing on KF proliferation and collagen deposition

To explore the effect of KLF4 on the proliferation and collagen deposition of KFs, siRNAs targeting KLF4 (si-KLF4–1 and si-KLF4–2) were transfected into KFs (P < 0.05, Fig. 4A), and si-KLF4–1 with better efficiency was selected for the combined treatment with si-FTO-1. MC1R expression was also significantly reduced after silence of KLF4 (P < 0.05, Fig. 4B and C). The combined treatment enhanced cell viability (P < 0.05, Fig. 4D), improved proliferation ability (P < 0.05, Fig. 4E), and increased protein levels of collagen I and collagen III (P < 0.05, Fig. 4C). These results indicate that silence of KLF4 partially reverses the inhibitory effect of FTO silencing on proliferation and collagen deposition of KFs.

Fig. 4.

Fig. 4

Silence of KLF4 partially reverses the inhibitory effect of FTO silencing on KF proliferation and collagen deposition. Two siRNAs targeting KLF4 (si-KLF4–1 and si-KLF4–2) were transfected into KFs, with si-NC as the control. si-KLF4–1 with better efficiency was selected for the combined treatment with si-FTO-1. A) Detection of transfection efficiency by qRT-PCR. B) Detection of KLF4 and MC1R expressions by qRT-PCR. C) Detection of KLF4, MC1R, collagen I, and collagen III expressions in cells by western blot. D) Detection of cell viability by CCK-8 assay. E) Detection of cell proliferation by clone formation assay. The cell experiments were repeated three time independently. Data are presented as mean ± SD. Data in panels a/D/E were analyzed by one-way ANOVA, while data in panels B/C were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons test. *P < 0.05.

Silence of MC1R partially reverses the inhibitory effect of FTO silencing on KF proliferation and collagen deposition

To confirm the above findings, siRNAs targeting MC1R (si-MC1R-1 and si-MC1R-2) were transfected into KFs (P < 0.05, Fig. 5A), and si-MC1R-1 with better efficiency was selected for the combined treatment with si-FTO-1. Silencing MC1R (P < 0.05, Fig. 5B and C) resulted in enhanced cell viability (P < 0.05, Fig. 5D), improved proliferation ability (P < 0.05, Fig. 5E), and increased collagen I and collagen III protein levels (P < 0.05, Fig. 5C). These results indicate that silence of MC1R partially reverses the inhibitory effect of FTO silencing on proliferation and collagen deposition of KFs.

Fig. 5.

Fig. 5

Silence of MC1R partially reverses the inhibitory effect of FTO silencing on KF proliferation and collagen deposition. Two siRNAs targeting MC1R (si-MC1R and si-MC1R) were transfected into KFs, with si-NC as the control. si-MC1R-1 with better efficiency was selected for the combined treatment with si-FTO-1. A) Detection of transfection efficiency by qRT-PCR. B) Detection of MC1R expression by qRT-PCR. C) Detection of MC1R, collagen I, and collagen III expressions in cells by western blot. D) Detection of cell viability by CCK-8 assay. E) Detection of cell proliferation by clone formation assay. The cell experiments were repeated three time independently. Data are presented as mean ± SD. Data in panels a/B/D/E were analyzed by one-way ANOVA, while data in panel C were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons test. *P < 0.05.

Discussion

Keloids are fibroproliferative disorders characterized by excessive collagen accumulation and fibroblast proliferation, leading to persistent clinical symptoms, local tissue invasion, and frequent postoperative relapse.2 m6A demethylase FTO has been identified as a key factor in keloid formation.11 This study elucidates that FTO-mediated m6A demethylation of KLF4 promotes the proliferation and collagen deposition of KFs.

KFs are implicated as key mediators in the remodeling of scar tissues, showing enhanced proliferation and resistance to apoptosis, which leads to the excessive production of collagen and other ECM.3,21 Compared with NFs, KFs demonstrated increased cell viability and proliferative capacity, along with the upregulation of Collagen I and Collagen III. m6A demethylase FTO facilitates dermal fibroblast migration and collagen deposition to accelerate the development of keloids.11 Consistently, we revealed a high expression pattern of FTO in KFs. Silence of FTO notably repressed the viability and proliferation of KFs and led to decreased levels of Collagen I and Collagen III. These findings suggest that silence of FTO effectively inhibits KF proliferation and collagen deposition.

Thereafter, we set out to investigate the specific mechanism by which FTO promotes KF proliferation and collagen deposition. KLF4 as a vital transcription factor has been demonstrated to participate in the process of fibrosis.22–24 KLF4 expression is reduced in skin hypertrophic scar tissues and hypertrophic scar-derived fibroblasts,14,18 and upregulation of KLF4 reduces fibrosis-related molecules such as Col1, Col3, and α-SMA.13 Accordingly, this study suggested that m6A demethylase FTO promoted KF proliferation and collagen deposition by removing m6A modification of KLF4. KFs showed a decrease in KLF4 m6A level and mRNA stability, while silencing FTO elevated the m6A level and mRNA stability of KLF4. Moreover, silence of FTO reversed the downregulation of KLF4 expression in KFs. KLF4 activation can depress the proliferation and migration of human hypertrophic scar fibroblasts and significantly diminish fibrosis markers α-SMA and collagen I in fibroblasts.25 The study also conducted a combined experiment with si-FTO-1 to investigate the effect of KLF4 on KF proliferation and collagen deposition. Our results revealed that the inhibitory effect of FTO silencing on KF proliferation and collagen deposition was partially reversed by the silence of KLF4.

MC1R is a G protein-coupled receptor well-known for controlling skin pigmentation. In addition to its role in pigmentation, MC1R signaling pathway executes antagonistic effects on skin inflammatory and fibrogenic responses.26 The binding site of KLF4 with MC1R was predicted via the JASPAR database. ChIP and dual-luciferase reporter gene assays verified the binding relationship between KLF4 and MC1R promoter. MC1R mRNA expression in keloid fibroblast cell lines and tissue samples is dramatically reduced, and depletion of MC1R may revoke the repression of collagen deposition and myofibroblast transformation mediated by α-melanocyte-stimulating hormone.19 LINC00937 promotes the expression of MC1R, which in turn reduces the extracellular matrix deposition and keloid fibroblast proliferation.20 We also found that MC1R was weakly expressed in KFs and the inhibitory effect of FTO silencing on KF proliferation and collagen deposition was partially ameliorated by MC1R knockdown.

Conclusion

To sum up, FTO represses KLF4 expression by removing m6A modification and further diminishes MC1R expression to promote KF proliferation and collagen deposition. However, this study only conducted relevant tests at the cellular level, and did not carry out pathological tests on tissues, nor in vivo animal experiments for mechanism verification. This study mainly focused on the molecular mechanism of FTO regulating fibroblast proliferation and collagen deposition, and has not yet explored whether FTO affects cell migration ability. The FTO/KLF4/MC1R axis regulating KF proliferation and collagen deposition needs more pathological tests and animal experiments to verify. In the future, we will combine in vivo, in vitro, and pathological experiments to further validate the molecular mechanism of FTO/KLF4/MC1R regulating KF proliferation and collagen deposition.

Supplementary Material

Supplementary_Materials_1_tfaf058
Supplementary_Materials_2_tfaf058

Acknowledgments

Not applicable.

Contributor Information

Yanqi Li, Department of Plastic Surgery, Emergency General Hospital/National Research Center for Emergency Medicine, No. 29, Xi Ba He Nan Li, Chaoyang District, Beijing 100020, China.

Wanchao Wang, Department of Plastic Surgery, Emergency General Hospital/National Research Center for Emergency Medicine, No. 29, Xi Ba He Nan Li, Chaoyang District, Beijing 100020, China.

Yuge Wang, Department of Plastic Surgery, Emergency General Hospital/National Research Center for Emergency Medicine, No. 29, Xi Ba He Nan Li, Chaoyang District, Beijing 100020, China.

Hongmei Ai, Department of Plastic Surgery, Emergency General Hospital/National Research Center for Emergency Medicine, No. 29, Xi Ba He Nan Li, Chaoyang District, Beijing 100020, China.

Author contributions

Yanqi Li (Conceptualization, Data curation, Validation, Investigation, Visualization, Methodology, Writing – original draft, Writing – review & editing), Wanchao Wang (Data curation, Supervision, Validation, Visualization), Yuge Wang (Data curation, Formal Analysis, Investigation), Hongmei Ai (Conceptualization, Formal Analysis, Supervision, Methodology).

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Conflict of interest statement

None declared.

Availability of data and materials

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Consent for publication

Not applicable.

Consent to participate

Not applicable.

Ethical approval

Not applicable.

References

  • 1. Ogawa  R. Keloid and hypertrophic scars are the result of chronic inflammation in the reticular dermis. Int J Mol Sci. 2017:18:606. 10.3390/ijms18030606 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Huang  C, Ogawa  R. Pharmacological treatment for keloids. Expert Opin Pharmacother. 2013:14:2087–100. 10.1517/14656566.2013.826651 [DOI] [PubMed] [Google Scholar]
  • 3. Bensa  T, Tekkela  S, Rognoni  E. Skin fibroblast functional heterogeneity in health and disease. J Pathol. 2023:260:609–20. 10.1002/path.6159 [DOI] [PubMed] [Google Scholar]
  • 4. Naik  PP. Novel targets and therapies for keloid. Clin Exp Dermatol. 2022:47:507–15. 10.1111/ced.14920 [DOI] [PubMed] [Google Scholar]
  • 5. Jiang  X  et al.  The role of m6A modification in the biological functions and diseases. Signal Transduct Target Ther. 2021:6:74. 10.1038/s41392-020-00450-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Lin  CX  et al.  Corrigendum: the m(6)A-methylated mRNA pattern and the activation of the Wnt signaling pathway under the hyper-m(6)A-modifying condition in the keloid. Front Cell Dev Biol. 2023:11:1144733. 10.3389/fcell.2023.1144733 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Lv  W  et al.  Epigenetic modification mechanisms involved in keloid: current status and prospect. Clin Epigenetics. 2020:12:183. 10.1186/s13148-020-00981-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Ren  S  et al.  KIAA1429 promotes keloid formation through the TGF-Beta1/Smad pathway. Curr Mol Med. 2024:25. 10.2174/0115665240307157241104095116 [DOI] [PubMed] [Google Scholar]
  • 9. Lan  N  et al.  FTO - a common genetic basis for obesity and cancer. Front Genet. 2020:11:559138. 10.3389/fgene.2020.559138 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Xie  J  et al.  Construction and validation of the diagnostic model of keloid based on weighted gene co-expression network analysis (WGCNA) and differential expression analysis. J Plast Surg Hand Surg. 2023:57:163–71. 10.1080/2000656X.2021.2024557 [DOI] [PubMed] [Google Scholar]
  • 11. Ren  S  et al.  The m6A demethylase FTO promotes keloid formation by up-regulating COL1A1. Ann Transl Med. 2023:11:15. 10.21037/atm-22-6021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Ghaleb  AM, Yang  VW. Kruppel-like factor 4 (KLF4): what we currently know. Gene. 2017:611:27–37. 10.1016/j.gene.2017.02.025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Wang  J  et al.  KLF4 alleviates hypertrophic scar fibrosis by directly activating BMP4 transcription. Int J Biol Sci. 2022:18:3324–36. 10.7150/ijbs.71167 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Wang  C, Jiang  D. Exogenous PRAS40 reduces KLF4 expression and alleviates hypertrophic scar fibrosis and collagen deposition through inhibiting mTORC1. Burns. 2024:50:936–46. 10.1016/j.burns.2024.01.026 [DOI] [PubMed] [Google Scholar]
  • 15. Livak  KJ, Schmittgen  TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001:25:402–8. 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  • 16. Zhou  Y, Zeng  P, Li  YH, Zhang  Z, Cui  Q. SRAMP: prediction of mammalian N6-methyladenosine (m6A) sites based on sequence-derived features. Nucleic Acids Res. 2016:44:e91. 10.1093/nar/gkw104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Rauluseviciute  I  et al.  JASPAR 2024: 20th anniversary of the open-access database of transcription factor binding profiles. Nucleic Acids Res. 2024:52:D174–D182. 10.1093/nar/gkad1059 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Gras  C  et al.  miR-145 contributes to hypertrophic scarring of the skin by inducing Myofibroblast activity. Mol Med. 2015:21:296–304. 10.2119/molmed.2014.00172 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Luo  LF, Shi  Y, Zhou  Q, Xu  SZ, Lei  TC. Insufficient expression of the melanocortin-1 receptor by human dermal fibroblasts contributes to excess collagen synthesis in keloid scars. Exp Dermatol. 2013:22:764–6. 10.1111/exd.12250 [DOI] [PubMed] [Google Scholar]
  • 20. Wan  J  et al.  LINC00937 suppresses keloid fibroblast proliferation and extracellular matrix deposition by targeting the miR-28-5p/MC1R axis. Histol Histopathol. 2021:36:995–1005. 10.14670/HH-18-372 [DOI] [PubMed] [Google Scholar]
  • 21. Andrews  JP, Marttala  J, Macarak  E, Rosenbloom  J, Uitto  J. Keloids: the paradigm of skin fibrosis - Pathomechanisms and treatment. Matrix Biol. 2016:51:37–46. 10.1016/j.matbio.2016.01.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Chen  YJ, Huang  SM, Tai  MC, Chen  JT, Liang  CM. Glucosamine impedes transforming growth factor beta1-mediated corneal fibroblast differentiation by targeting Kruppel-like factor 4. J Biomed Sci. 2019:26:72. 10.1186/s12929-019-0566-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Lin  L  et al.  Krupple-like-factor 4 attenuates lung fibrosis via inhibiting epithelial-mesenchymal transition. Sci Rep. 2017:7:15847. 10.1038/s41598-017-14602-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Mreich  E, Chen  XM, Zaky  A, Pollock  CA, Saad  S. The role of Kruppel-like factor 4 in transforming growth factor-beta-induced inflammatory and fibrotic responses in human proximal tubule cells. Clin Exp Pharmacol Physiol. 2015:42:680–6. 10.1111/1440-1681.12405 [DOI] [PubMed] [Google Scholar]
  • 25. Wang  YW  et al.  Influences and mechanism of extracellular vesicles from dermal papilla cells of mice on human hypertrophic scar fibroblasts. Zhonghua Shao Shang Yu Chuang Mian Xiu Fu Za Zhi. 2024:40:258–65. 10.3760/cma.j.cn501225-20231107-00185 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Muffley  LA, Zhu  KQ, Engrav  LH, Gibran  NS, Hocking  AM. Spatial and temporal localization of the melanocortin 1 receptor and its ligand alpha-melanocyte-stimulating hormone during cutaneous wound repair. J Histochem Cytochem. 2011:59:278–88. 10.1369/0022155410397999 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary_Materials_1_tfaf058
Supplementary_Materials_2_tfaf058

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.


Articles from Toxicology Research are provided here courtesy of Oxford University Press

RESOURCES