Generation of an induced pluripotent stem cell line (NCHi023-A) from a 41-year-old male with nemaline myopathy carrying autosomal dominant ACTA1 c.809–10C>A mutation

Abstract

Nemaline myopathy is a rare genetic condition characterized by weakened muscles due to thread-like rods, called nemaline bodies, in muscle fibers. This condition varies in time of onset and severity. Although there is no cure, therapies and treatments are available to reduce symptoms. This iPSC line, NCHi023-A, was reprogrammed using Sendai virus from skin fibroblasts from a male patient with nemaline myopathy carrying a pathogenic heterozygous ACTA1 mutation. Characterization of this line was successful, with validation of cell identity, normal morphology and karyotype, positive expression of germ layer and pluripotency markers, and negative expression for mycoplasma and transgenes.

1. Resource Table

Unique stem cell line identifier	NCHi023-A https://hpscreg.eu/cell-line/NCHi023-A
Alternative name(s) of stem cell line	NCH217
Institution	Center for Cardiovascular Research and Center for Gene Therapy, Abigail Wexner Research Institute, Nationwide Children’s Hospital, Columbus, OH 43215, USA
Contact information of distributor	Dr. Ming-Tao Zhao mingtao.zhao@nationwidechildrens.org; Dr. Afrooz Rashnonejad afrooz. rashnonejad@nationwidechildrens.org
Type of cell line	iPSC
Origin	Human
Additional origin info required for human ESC or iPSC	Age: 41 Sex: Male Ethnicity if known: White, Non-Hispanic
Cell Source	Skin fibroblasts
Clonality	Clonal
Method of reprogramming	Sendai Virus
Genetic Modification	Yes
Type of Genetic Modification	Congenital
Evidence of the reprogramming transgene loss (including genomic copy if applicable)	Negative for presence of transgenes KOS and SEV as determined by result of RT-PCR (refer to Supplementary Fig. 1C)
Associated disease	Nemaline myopathy
Gene/locus	Heterozygous for ACTA1 c.809–10C>A (Intron 5)
Date archived/stock date	October 20, 2023
Cell line repository/bank	NCHi023-A (NCH217) is registered in the iPSC repository of pediatric cardiovascular disease in the Center for Cardiovascular Research at the Abigail Wexner Research Institute at Nationwide Children’s Hospital, Columbus, OH, USA. https://hpscreg.eu/cell-line/NCHi023-A
Ethical approval	Generation and characterization of this iPSC line was approved by the Institutional Review Board (IRB) under IRB approval number IRB14-00719.

2. Resource Utility

NCHi023-A is an induced pluripotent stem cell (iPSC) line generated from a patient with nemaline myopathy carrying a pathogenic ACTA1 variant. This iPSC line exhibits the ability to differentiate into the three germ layers, indicating potential as an in vitro resource for studying genetic mechanisms and investigating novel therapeutics.

3. Resource Details

Nemaline myopathy (NM) is rare genetic disease that is estimated to affect 1 in 50,000 live births (North et al., 1997). Patients with NM have a wide range of symptoms and severity, though most present with some degree of hypotonia and weakened muscles (Wallgren-Pettersson et al., 2004). At least 12 different genes with likely pathogenic variants have been identified in patients with NM, both inherited and de novo (Sewry et al., 2019). A subtype of NM caused by a mutation in the alpha actin gene (ACTA1) is named nemaline myopathy type 3, or NEM3 (Nowak et al., 2015).

iPSC line NCHi023-A was created from a 41-year-old Caucasian male with nemaline myopathy and an ACTA1 mutation (NEM3) with autosomal dominant inheritance. This specific intronic variant has previously been linked to a patient with NEM3 in ClinVar, with a likely pathogenic clinical significance, further reinforcing the utility of this resource (Richards et al., 2015). To produce cell line NCHi023-A, a skin biopsy was performed, then fibroblasts were isolated and cultured before being reprogrammed into iPSCs via transduction of Sendai virus. Transduced cells displayed normal morphology and colony formation consistent with iPSCs (Fig. 1A). A normal male karyotype was confirmed and no chromosomal abnormalities above 1 Mb were detected by Karyostat+ assay (Fig. 1B and Table 1). The loss of iPSC reprogramming transgenes SEV and KOS were confirmed by RT-PCR (Supplementary Fig. 1C). Using 1,100,000 single nucleotide polymorphisms (SNPs), NCHi023-A was confirmed to originate from patient fibroblasts with greater than 99 % correlation (Available with the authors). Sanger sequencing using the reverse primer confirmed that NCHi023-A retains the heterozygous intron 5 mutation present in the patient fibroblast line (Fig. 1C and D). Immunofluorescence staining indicated expression of pluripotency markers in the nucleus (SOX2, NANOG, OCT3/4) and on the cell surface (TRA-1-60) (Fig. 1E, Table 1, and Supplementary Fig. 1B). This line was also successfully differentiated into the three germ layers including ectoderm, mesoderm, and endoderm (Fig. 1F), indicating its applicability as a resource to study in vitro neuromuscular disorders. NCHi023-A was tested negative for mycoplasma contamination (Supplementary Fig. 1A).

Fig. 1.

Table 1.

Characterization and validation.

Classification	Test	Result	Data
Morphology	Photography Bright field	Normal	Fig. 1 panel A
Phenotype	Qualitative analysis	Positive expression of pluripotency markers: SOX2, TRA-1-60, OCT3/4, NANOG	Fig. 1 panel E
	Quantitative analysis	SOX2: 97.2 ± 1.6 % NANOG: 95.5 ± 0.6 % OCT3/4: 94.5 ± 2.3 %	Supplementary Fig. 1 panel B
Genotype	Whole genome array (Karyostat + Assay)	Normal Karyotype: 46, XY Resolution: 1–2 Mb	Fig. 1 panel B
mtDNA analysis (IF APPLICABLE)	N/A	N/A	N/A
Identity	Microsatellite PCR (mPCR) OR	Not performed	N/A
	STR analysis	1.1 million SNPs were analyzed and a 99.69 % correlation between iPSCs and fibroblasts was confirmed, which is considered an identical genetic background.	Available with the authors
Mutation analysis (IF APPLICABLE)	Sequencing	Heterozygous	Fig. 1 panels C and D
	Southern Blot OR WGS	N/A	N/A
Microbiology and virology	Mycoplasma	Negative result of mycoplasma testing by luminescence	Supplementary Fig. 1 panel A
Differentiation potential	Directed differentiation	Positive germ layer staining: Mesoderm: TBXT/Brachyury, TBX6 Endoderm: FOXA2, SOX17 Ectoderm: PAX6, OTX2	Fig. 1 panel F
Donor screening (OPTIONAL)	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A	N/A
Genotype additional info (OPTIONAL)	Blood group genotyping	N/A	N/A
	HLA tissue typing	N/A	N/A

4. Materials and methods

4.1. Reprogramming

Fibroblasts were plated in media containing DMEM/F12 GlutaMAX (Gibco) with 10 % FBS (Gibco) and incubated at 37 °C, 5 % CO₂, and 20 % O₂. On day 0, fibroblasts were transduced with Sendai virus (Cyto-Tune^™-iPS 2.0 Sendai Reprogramming Kit, Invitrogen) according to the manufacturer’s instructions. Media was changed daily until day 7, when cells were dissociated with Accutase (Sigma) and passaged to a 1:300 Matrigel (Corning)-coated plate with E8 media. iPSC clones were isolated after three weeks, with colonies individually cut and placed into a single well of a 24-well plate with E8 media and ROCK inhibitor Y-27632 (Selleck Chemicals).

4.2. Culturing

iPSCs were refreshed daily with E8 media until 90 % confluent. Cells were lifted with 0.5 mM EDTA and passaged at a 1:6 ratio with E8 media and 5 μM ROCK inhibitor. Cells are maintained in E8 media at 37 °C, 5 % CO₂, and 20 % O₂.

4.3. Immunofluorescent staining

Cells (P12) were fixed for 15 min with 4 % paraformaldehyde (Electron Microscopy Sciences), permeabilized for 20 min with 0.1 % Triton-X (Sigma) in PBS and blocked with 0.2 % BSA (Sigma) in DPBS for 3 h. Cells were incubated with primary antibodies (Table 2) diluted in 0.2 % BSA overnight at 4 °C. Diluted secondary antibodies (Table 2) were applied and incubated for 1 h. Counterstaining with DAPI was performed for 5 min before imaging. All experiments were conducted at room temperature unless stated.

Table 2.

Reagents details.

	Antibodies used for immunocytochemistry/flow-cytometry
	Antibody	Dilution	Company Cat #	RRID
Pluripotency Marker	Mouse anti-Human TRA-1-60	1:2000	ThermoFisher Scientific, Cat# MA1-023X	AB_2536705
Pluripotency Marker	Rabbit anti-Human SOX2	1:2000	ThermoFisher Scientific Cat# PA1-094X	AB_2539863
Pluripotency Marker	Rabbit anti-Human NANOG	1:500	Cell Signaling Technology, Cat# 4903P	AB_10559205
Pluripotency Marker	Alexa Fluor 488 Mouse anti-Human OCT3/4	1:500	BD Biosciences, Cat# 561628	AB_10895977
Mesoderm Marker	Goat anti-Human TBXT/Brachyury	1:1000	R&D Systems, Cat# AF2085	AB_2200235
Mesoderm Marker	Rabbit anti-Human TBX6	1:1000	ThermoFisher Scientific, Cat# PA535102	AB_2552412
Endoderm Marker	Goat anti-Human SOX17	1:500	R&D Systems, Cat# AF1924	AB_355060
Endoderm Marker	Mouse anti-Human FOXA2	1:500	Abnova, Cat# H00003170-M10	AB_534871
Ectoderm Marker	Goat anti-Human OTX2	1:500	R&D Systems, Cat# AF1979	AB_2157172
Ectoderm Marker	Rabbit anti-Human PAX6	1:500	ThermoFisher Scientific, Cat# 42-660-0	AB_2533534
Secondary Antibody	Goat anti-Rabbit IgG (H + L), Alexa Fluor 488	1:2000	ThermoFisher Scientific, Cat# A11008	AB_143165
Secondary Antibody	Goat anti-Mouse IgG (H + L), Alexa Fluor 594	1:2000	ThermoFisher Scientific, Cat# A11032	AB_2534091
Secondary Antibody	Donkey anti-Mouse IgG (H + L), Alexa Fluor 594	1:2000	ThermoFisher Scientific, Cat# A21203	AB_2535789
Secondary Antibody	Donkey anti-Rabbit IgG (H + L), Alexa Fluor 594	1:2000	ThermoFisher Scientific Cat# A21207	AB_141637
Secondary Antibody	Donkey anti-Goat IgG (H + L), Alexa Fluor 488	1:2000	ThermoFisher Scientific, Cat# A11055	AB_2534102
	Primers
	Target	Size of band	Forward/Reverse primer (5′−3′)
Housekeeping gene (RT-PCR)	GAPDH	452 bp	F: ACCACAGTCCATGCCATCAC R: TCCACCACCCTGTTGCTGTA
Transgene (RT-PCR)	KOS	528 bp	F: ATGCACCGCTACGACGTGAGCGC R: ACCTTGACAATCCTGATGTGG
Transgene (RT-PCR)	SEV	181 bp	F: GGATCACTAGGTGATATCGAGC R: ACCAGACAAGAGTTTAAGAGATATGTATC
Targeted mutation analysis (sequencing)	ACTA1	584 bp	F: CGTGGCTACTCCTTCGTGAC R: CACCACCCACCTTGATCTTCA

4.4. Germ layer differentiation

For mesoderm differentiation, iPSCs (P28) were treated with 6 μM CHIR99021 (Selleck Chemicals) in RPMI 1640 media (Gibco) with B27 Minus Insulin Supplement (B27-Ins) (Gibco) for 48 h. For endoderm differentiation, iPSCs (P40) were cultured for 3 days with 100 ng/mL Activin A in RPMI 1640 plus B27, the first day also with 3 μM CHIR99021 (Matsuno et al., 2016). For ectoderm differentiation, iPSCs (P40) were induced with 500 nM LDN193189 (Selleck Chemicals) and 100 nM BGJ398 (Selleck Chemicals) in RPMI 1640 plus B27 minus insulin for 24 h (Walsh et al., 2020). After differentiation, cells were fixed and stained with germ layer-specific markers (Table 2).

4.5. Karyotyping and cell ID testing

Pelleted iPSCs (P24) and fibroblasts were shipped to ThermoFisher Scientific for Karyostat+ and Cell ID analysis.

4.6. Genotyping

Genomic DNA was extracted from iPSCs (P16) and fibroblasts (P9) using the Quick-DNA Miniprep Plus Kit (Zymo Research). PCR was conducted with primers flanking the mutation region (Table 2) in a VeritiPro Thermocycler (Applied Biosciences) for 30 cycles: 10 s at 98 °C, 15 s at 60 °C, and 1 min at 68 °C. Gel extraction was performed using gel DNA recovery kit (Zymo Research) and purified DNA was sent for Sanger sequencing (Eurofins).

4.7. Transgene detection

Total RNA extraction of P24 iPSCs and day 2 transfected fibroblasts was completed with Direct-zol RNA Miniprep Kit (Zymo Research). RNA was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad). PCR was conducted using SEV, KOS, and GAPDH as primers (Table 2) according to conditions specified in 4.6.

4.8. Mycoplasma detection

Supernatant from day 3 iPSC culture (P44) was collected and tested using the MycoAlert^™ Mycoplasma Detection Kit (Lonza Biosciences).