Skip to main content
NCBI home page
Scientific Reports logoLink to Scientific Reports
. 2025 Apr 29;15:14988. doi: 10.1038/s41598-025-99456-0

The developing role of NRF2 and HMOX1 in treatment response of cutaneous leishmaniasis

Niloofar Mehrolhasani 1, Mahsa Faramarzpour 1,2, Ehsan Salarkia 2, Alireza Keyhani 2, Shahriar Dabiri 1,✉, Simin Shamsi Meymandi 1,✉
PMCID: PMC12041388  PMID: 40301619

Abstract

Anthroponotic cutaneous leishmaniasis (ACL), a neglected parasitic disease, created significant treatment challenges due to rising antimonial resistance, particularly in endemic regions like Iran. This study aimed to investigate the mechanisms behind treatment unresponsiveness in ACL patients. Demographic and clinical characteristics of 21 unresponsive and 10 responsive patients were randomly collected. Leishmania isolates were genotyped using nested polymerase chain reaction (PCR). Real-time PCR assessed the expression levels of two key genes related to treatment unresponsiveness: nuclear factor erythroid 2-related factor 2 (NRF2) and heme oxygenase 1 (HMOX1), along with their associated microRNAs, mir-24a-3p and mir-27b-3p. Gene expression and immunohistochemistry (IHC) assays measured apoptosis activation. Unresponsive patients revealed decreased expression of apoptosis-related genes (Bax, caspase-3, caspase-8) and increased expression of B-cell lymphoma 2 (Bcl2). Furthermore, HMOX1 and NRF2 expression, significant mir-27b-3p upregulation, and mir-24a-3p downregulation were observed in the unresponsive group. These results suggest diminished apoptosis and/or possible potential for chronic progression of Leishmania (L.) tropica infection in unresponsive patients. The increased levels of NRF2 and HMOX1 demonstrate their probable role in drug unresponsiveness. Also, the opposing effects of mir-24a-3p and mir-27b-3p on mentioned genes highlight the necessity for targeted molecular studies to modulate microRNAs expression effectively.

Keywords: Leishmania, MicroRNA, L. tropica, Drug unresponsiveness, NRF2, HMOX1

Subject terms: Clinical genetics, Gene expression, Gene regulation, Epigenetics, Antimicrobial responses, Infectious diseases

Introduction

Leishmaniasis, a neglected tropical disease, is transmitted by female Phlebotomus sandflies and caused by over 20 species of protozoan parasites. Globally, leishmaniasis impresses more than 12 million people and results in 20,000 to 30,000 deaths annually, which underscores its significant impact on global health1. This disease manifests in three primary forms: visceral leishmaniasis (VL), mucocutaneous leishmaniasis (MCL), and cutaneous leishmaniasis (CL). CL, the most frequent variant, leads to skin ulcers and is particularly prevalent in the Americas, Central Asia, the Mediterranean Basin, and Middle East, including Iran2. Over the past three decades, despite substantial attempts to control CL in Iran, the disease continues to persist at high levels, especially in southeastern regions3. Recent studies in southeastern Iran, particularly Kerman province, found that nearly all CL patients were infected with the Leishmania (L.) tropicaspecies4, which accounted for over 97% of cases in 20155. This highlights considerable gaps in both national and international healthcare systems regarding diagnostics, treatments, and vaccinations for CL6.

The lack of an effective leishmaniasis vaccine highlights the need for reliance on chemotherapy. Pentavalent antimonial compounds, primarily sodium stibogluconate (Pentostam®) and meglumine antimonate (Glucantime®), have been in use since the 1920 s. Regardless of their long history, the effectiveness of antimonials is often compromised by toxicity, high costs, and growing resistance7. Noteworthy, antimonials’ unresponsiveness is characterized by a complex interplay of various contributing factors. Social and geographic backgrounds, clinical characteristics, the specific Leishmaniaspecies involved, axenic conditions, environmental factors, and host’s immune response are likely to influence drug unresponsiveness rate8,9.

Host immune responses to Leishmaniainfection are complex, involving diverse cellular and molecular mechanisms to control parasite growth. Apoptosis is a crucial aspect of these responses, serving as a strategy for eliminating infected cells and limiting parasite replication10. Leishmaniaparasites evolve different strategies to evade apoptosis and improve their survival chance within host cells. For instance, the parasite can upregulate anti-apoptotic proteins, downregulate pro-apoptotic factors, and effectively interfere with the balance towards cell survival11,12. These pathways are controlled with various genes, including nuclear factor erythroid 2-related factor 2 (NRF2) and heme oxygenase 1 (HMOX1)13,14. The NRF2-HMOX1 axis creates a paradox in leishmaniasis management. Chronic activation was observed to be associated with reduced apoptosis and oxidative stress tolerance, and suppressed host inflammatory in parasites15. The NRF2 gene is substantial for modulating antioxidant responses and protecting host cells from oxidative stresses initiated by the infection16. However, it may involuntarily promote parasite survival in leishmaniasis by reducing reactive oxygen species (ROS) and suppressing pro-inflammatory cytokines production, which are critical for killing intracellular Leishmaniaparasite17. Additionally, NRF2 activation elevates the expression of various cytoprotective genes, including HMOX1, and impairs host defensive mechanisms against Leishmaniaparasite13,15. HMOX1 gene also plays a parasite-protective role during Leishmaniainfections by inhibiting inflammation and host oxidative burst, and inducing apoptosis in infected macrophages, thus promoting the invasion of infection15. Interestingly, multiple studies confirmed that several microRNAs (miRNAs) are involved in these genes expression level14.

MicroRNAs are a group of short, non-coding RNA molecules that exert regulatory potential over biological and molecular processes at the transcriptional level. This regulation is achieved through pairing with the target messenger RNA (mRNAs)18,19. Specific miRNAs have been reported to influence responsiveness or susceptibility to treatment across various infectious diseases18. For instance, miRNAs play a substantial role in modulating the expression of both pro- and anti-inflammatory cytokines in macrophages of patients unresponsive to treatment for L. donovani20.

Consequently, we aimed to determine the role of two miRNAs (mir-27b-3p and mir-24a-3p), and their corresponding genes (HMOX1 and NRF2) in clinically responsive and unresponsive forms of anthroponotic cutaneous leishmaniasis (ACL) in Kerman province, Iran. Furthermore, we explored pro- and anti- apoptotic proteins activity due to gene expression and immunohistochemical (IHC) profile assays.

Results

Confirmation of L. tropica infection

This study enrolled 21 unresponsive and 10 responsive patients, all diagnosed with affirmed lesions of ACL and living in CL-endemic areas of Kerman Province, Southeast Iran (Fig. 1). The diagnosis and confirmation of leishmaniasis were based on positive direct smear of skin lesions, culture of clinical samples in NNN isolation medium, and nested-PCR. Nested-PCR analysis of all field samples illustrated a distinct 750 bp band21, confirming that L. tropica was the sole causative species in all CL patients involved in the study (Fig. 2).

Fig. 1.

Fig. 1

Open in a new tab

Macroscopic presentation of skin lesions of six representative patients (out of 31 total patients in the study) with confirmed anthroponotic cutaneous leishmaniasis (ACL).(A) a responsive patient with a crusted nodule on the face. (B) a responsive patient with a crusted plaque on the arm. (C) a nodule with a healing ulcer on top on the finger of a responsive patient. (D) an unresponsive patient with a large ulcerated plaque of the face area. (E) an unresponsive patient with a large crusted plaque on the cheek. and(F) an unresponsive patient with an indurated plaque on the cheek.

Fig. 2.

Fig. 2

Open in a new tab

Verification of clinical samples by nested PCR.(1) standard Leishmania tropica (L. tropica) as positive control. (2) isolated sample from a responsive patient and (3) isolated sample from an unresponsive patient. The distinct 750 bp band reveals successful amplification of the CSB2XF target region, which is specific to L. tropica.

Clinical findings

The demographic and clinical characteristics of the study participants demonstrated significant differences between unresponsive and responsive patients:

In unresponsive patients, the average age was 31.3 ± 21.0 years, ranging from 4 to 68 years. This group included 11 women (33.2 ± 23.8) and 10 men (29.2 ± 18.5) (Table 2). Most lesions appeared on the face (54.14%) and hands (23.80%); three patients (14.28%) had lesions on their arms, and only one patient (4.76%) had a lesion on the neck. The duration of illness in unresponsive patients was 15.76 ± 4.7 months, and the mean size of lesions in this group was 1.85 cm2 (Table 2).

Table 2.

Initial demographic and clinical characteristics of unresponsive individuals with ACL.

Patients Sex Age Number Location Size Durations (Month) Culture Nested PCR
1 Female 47 3 Face 0.9*1.2 12 Positive L. tropica 1
2 Female 6 2 Face 1.5*2 18 Positive L. tropica
3 Male 8 1 Foot 1.6*1.7 11 Positive L. tropica
4 Male 36 3 Hands 1.9*1.6 13 Positive L. tropica
5 Female 54 1 Face 1.7*0.4 14 Positive L. tropica
6 Female 4 1 Face 1*1 12 Positive L. tropica
7 Male 12 1 Arm 1.2*1.4 7 Positive L. tropica
8 Male 51 1 Hands 1.6*1.8 14 Positive L. tropica
9 Male 8 1 Face 1*1.1 17 Positive L. tropica
10 Male 19 2 Hands 1.8*2 26 Positive L. tropica
11 Female 9 2 Arm 1.6*2 11 Positive L. tropica
12 Male 51 1 Hands، Face 1.5*0.5 12 Positive L. tropica
13 Female 43 1 Arm 1*1 20 Positive L. tropica
14 Female 21 1 Face 0.5*0.8 18 Positive L. tropica
15 Male 23 4 Hands 2*1.5 14 Positive L. tropica
16 Male 27 3 Foot 2.6*1.3 19 Positive L. tropica
17 Female 68 1 Hands 2.1*1 23 Positive L. tropica
18 Female 11 1 Neck 1.5*1 22 Positive L. tropica
19 Female 40 1 Face 1.6*1 18 Positive L. tropica
20 Female 63 1 Face 2.2*0.9 18 Positive L. tropica
21 Male 57 1 Face 1.6*1.1 12 Positive L. tropica
Open in a new tab

Table 1.

The specific primers sequences.

Genes
Template Forward and reverse sequences (5´−3´) Product size (bp)
NRF2 Forward TCCAGTCAGAAACCAGTGGAT 21
Reverse GAATGTCTGCGCCAAAAGCTG
HMOX1 Forward AAGACTGCGTTCCTGCTCAAC 21
Reverse AAAGCCCTACAGCAACTGTCG
Bax Forward CCCGAGAGGTCTTTTTCCGAG 155
Reverse CCAGCCCATGATGGTTCTGAT
Bcl2 Forward GGTGGGGTCATGTGTGTGG 89
Reverse CGGTTCAGGTACTCAGTCATCC
Caspase-3 Forward ATGGAAGCGAATCAATGGA 93
Reverse TGTACCAGACCGAGATGTC
Caspase-8 Forward CAAACTTCACAGCATTAGGGAC 78
Reverse ATGTTACTGTGGTCCATGAGTT
GAPDH* Forward 5-AGGTCGGTGTGAACGGATTTG-3 95
Reverse 5-GGGGTCGTTGATGGCAACA-3
MiRNAs
Template Forward and stem-loop sequences (5´−3´)
mir-24a-3p Stem-loop GTATGCTGCTACCTCGGACCCTGCTTAGTGCCATGCCTGCCATCGAGCAGCATACAACCCC
Forward GCGGCAGGAACTTGTGAGTCTCCT
mir-27b-3p Stem-loop GTATGCTGCTACCTCGGACCCTGCTTAGTGCCATGCCTGCCATCGAGCAGCATAC AACCCA
Forward GCGAGGGCTTAGCTGCTTGTGAGCA
U6 Steam loop GTATGCTGCTACCTCGGACCCTGCTTAGTGCCATGCCTGCCATCGAGCAGCATACAAAAATATGG
Forward GCAAGGATGACACGCAAATTCG
Open in a new tab

*Reference gene.

On the other hand, responsive patients had an average age of 34.8 ± 16.2 years, in range of 9 to 61 years. This group included 7 women (41.4 ± 12.7) and 3 men (19.3 ± 13.7) (Table 3). Similar to unresponsive patients, most lesions were predominantly on the hands (40.0%) and face (30%); two patients (20.0%) had lesions on their arms, and only one patient (10.0%) had a lesion on the foot. Lesion size averaged 1.58 cm², and illness duration was significantly shorter at 4.8 ± 3.1 months (Table 3).

Table 3.

Initial demographic and clinical characteristics of responsive individuals with ACL.

Patients Sex Age Number Location Size Duration (Month) Culture Nested PCR
1 Female 27 1 Hands 1.6*1.2 7 Positive L. tropica 1
2 Female 48 1 Arm 2.1*0.9 4 Positive L. tropica
3 Female 49 2 Hands 1.6*0.5 9 Positive L. tropica
4 Female 61 1 Face 0.5*1.3 8 Positive L. tropica
5 Male 35 1 Arm 1.6*2 9 Positive L. tropica
6 Male 14 2 Hands, Face 1.5*0.4 2 Positive L. tropica
7 Female 28 1 Face 0.5*1.8 2 Positive L. tropica
8 Male 9 1 Hands 1*1.3 4 Positive L. tropica
9 Female 32 1 Foot 1.6*2 2 Positive L. tropica
10 Female 45 3 Hands 1.5*0.9 1 Positive L. tropica
Open in a new tab

These findings suggest that lesion size, and illness duration may correlate with treatment responsiveness.

Expression levels of predicted miRNAs and their target genes in L. tropica-induced ACL

RT-PCR results indicated distinct expression patterns for predicted miRNAs and their target genes. Elevated levels of mir-27b-3p and HMOX1 were observed in unresponsive patients compared to responsive patients (P < 0.001). Higher NRF2 expression was also noted in unresponsive patients compared to responsive patients (P < 0.001), while mir-24a-3p levels were significantly lower in unresponsive patients. These results propose that mir-27b-3p may upregulate HMOX1 expression, while mir-24a-3p may suppress NRF2 activity, contributing to differential treatment outcomes (Fig. 3).

Fig. 3.

Fig. 3

Open in a new tab

Expression levels of miRNAs and their associated genes. The values represent the mean ± SD of three independent evaluations. * Difference between responsive and unresponsive individuals (P < 0.001).

Apoptotic genes expression

Our results revealed that Bcl2, an anti-apoptotic protein, was expressed at much higher levels in unresponsive patients to those who responded to treatment. Conversely, Bax, caspase-3, and caspase-8 were attentionally diminished in unresponsive patients versus responsive ones. These findings highlight reduced apoptosis as a potential mechanism underlying treatment failure. (Fig. 4).

Fig. 4.

Fig. 4

Open in a new tab

Expression levels of apoptotic genes. The values represent the mean ± SD of three independent evaluations. * Difference between responsive and unresponsive individuals (P < 0.001).

Immunohistopathological analysis

IHC findings also supported gene expression data. Apoptotic markers, Bax, caspase-3, and caspase-8, in the IHC findings revealed a decrease in the number of apoptosis-induced cells in lesion samples isolated from unresponsive patients versus the responsive patients. These findings were confirmed by up-regulation of Bcl2 levels in tissues of unresponsive patients to Glucantime® (Fig. 5). The downregulation of apoptotic markers in unresponsive patients suggests a probable reduction in cell death mechanisms, contributing to persistent infection.

Fig. 5.

Fig. 5

Open in a new tab

Immunohistochemical samples of responsive and unresponsive patients with anthropic cutaneous leishmaniasis (ACL). *** mean difference between responsive and unresponsive individuals (P < 0.001).

Discussion

CL represents a concerning health issue in the southeastern of Iran, especially Kerman province22. It was established that the majority of patients over there were infected with ACL caused by L. tropica. Similarly, by employing nested PCR techniques, all patients were infected with L. tropicain our study23.

In recent decades, the development of treatment-unresponsiveness in leishmaniasis has been one of the most significant obstacles to effective and efficient treatment in patients, globally. Various studies reported the presence of multiple mechanisms participated in drug-response processes both in the parasite and simultaneously, in host immune cells8. Clarifying appropriate markers of responsiveness can assist in identifying and controlling nonresponsive patients with ACL, presumably referring to antimonial compound-unresponsive leishmaniasis4.

Our patients’ demographic features and clinical characteristics indicated that lesions were most frequent on the face and hands, respectively (P-value < 0.001). This finding was correlated with previous studies8,24, potentially as lesions on the face and hands are more noticeable, prompting patients to seek to treatment. Notably, over 64% of our referred patients were women, despite previous studies reporting that most infected patients are men8. We suggest that this result may be due to women being more concerned about the cosmetic impact of ACL lesions. Moreover, unresponsive patients had longer duration of treatment compared to patients was responsive to Glucantime®. An increase in the size and persistence of plaques, nodules, or ulcers was observed in unresponsive patients, in contrast to responsive patients, whose lesions were healing by the end of the treatment period. This observation correlated with previous findings8. In general, incomplete, irregular, and poor treatment of CL can occasionally lead to the development of drug-unresponsive Leishmaniavariants25.

HMOX1 is a stress-inducible enzyme that catalyzes heme breakdown, converting it into biliverdin, carbon monoxide, and free iron. Beyond its traditional role in heme catabolism, recent studies highlighted its protective functions against oxidative damage26. In addition, NRF2 is a crucial transcription factor that regulates cellular responses to inflammation. When activated, NRF2 enhances antioxidant defenses and suppresses pro-inflammatory gene expression. It has been established that HMOX1 and NRF2 levels raised in untreated patients and weaken the immune system, resulting the disease to become chronic in case of Leishmania species such as L. donovani and L. infantum13,15. We also observed higher levels of HMOX1 and NRF2 in unresponsive patients rather than responsive group with ACL induced by L. tropica.

As previously mentioned, miRNAs have a crucial role in regulating treatment-responsiveness or -sensitivity in various infectious diseases, including leishmaniasis18. For instance, studies have shown that certain miRNAs are correlated with parasite load, inflammatory responses, apoptosis inhibition and treatment response in L. braziliensis27 and L. donovani28 infections. As a result, in this study we investigated the role of mir-24a-3p and mir-27b-3p in L. tropicainfection drug-response. Mir-24a-3p was observed that serves as an activator for caspase-3 and 7, leading to apoptosis initiation29. On the other hand, mir-27b-3p acts as a factor in boosting the role of transforming growth factor beta (TGF-β) in enhancing the performance of T helper 2 (Th2) cells in cytokine secretion. Increased secretion of this cytokine can lead to a shift in immune response towards Th2 cells, resulting in suppression of immune reactions and consequently leading to chronic diseases30. It was demonstrated that high levels of this miRNA in infected macrophages with L. majorresulted in decreased activity of T helper 1 (Th1) and increased activity of Th231. In unresponsive patients, both HMOX1 and mir-27b-3p levels were significantly elevated, indicating that mir-27b-3p may enhance the expression of the HMOX1 gene. This is consistent with Lago et al. findings which specific miRNAs create an environment that benefits the pathogen27. On the other hand, while NRF2 levels were greater in these unresponsive individuals compared to those who responded to treatment, mir-24a-3p levels were notably lower. This observation suggests that mir-24a-3p may inhibit NRF2 expression in L. tropica-infected host cells. The interplay between these miRNAs and their target genes highlights a complex regulatory network that could influence leishmaniasis pathophysiology, contribute to a reduced inflammation, chronic infection, persistent lesions and treatment failure in patients unresponsive to treatment.

Apoptosis is a crucial process modulated by the Bcl2 family of proteins, which contains both pro-apoptotic (e.g., Bax) and anti-apoptotic (e.g., Bcl2) members. Bax enhances mitochondrial outer membrane permeabilization (MOMP), resulting in the release of apoptogenic factors and the subsequent activation of caspase-9, which initiates the caspase cascade. This cascade includes caspase-6 and caspase-3, which are responsible for executing cell death by dismantling cellular components. Additionally, caspase-8 can activate the extrinsic apoptosis pathway in response to death receptor signaling. The balance between these proteins determines cell destiny and highlights apoptosis critical role in cellular homeostasis and disease states32. The role of apoptosis in enhancing the success rate of leishmaniasis treatment has also been substantiated in previous studies33–35. Results of our study indicated a decrease in expression of the Bax, caspase-3, and caspase-8 proteins and an increase in the Bcl2 protein in unresponsive patient samples compared to responsive groups, suggesting a lower level of apoptosis, specifically the caspase-dependent apoptosis, in the unresponsiveness group. This phenomenon likely allows infected macrophages to survive longer, provides a niche for parasite replication and contributes to the chronicity of the lesions.

The IHC profile served as another crucial tool for investigating the pathogenesis of the disease. Aligned with mentioned results, IHC profile also revealed that apoptosis induction was lower in tissues of unresponsive patients compared to those healed. In our observations, cells exhibiting apoptotic gene expression were prominent. Alternatively, in the unresponsive forms, Bcl2 positive cells were more obvious.

Notably, we faced several limitations in this study, including a relatively small sample size and the fact that the study was conducted in a specific region, which may not reflect the genetic diversity and environmental factors influencing L. tropica-induced leishmaniasis in other endemic regions. In addition, this study did not track patients over time to assess long-term outcomes or changes in gene expression throughout the disease progression. Therefore, further studies with larger sample size are needed, along with longitudinal studies to track changes in gene expression and treatment outcomes over time.

In conclusion, our study explored the role of NRF2 and HMOX1 in human L. tropica-induced CL and their relationship with treatment-response. For the first time, as far as the authors are aware, our study demonstrated that NRF2 and HMOX1: (I) displayed significant expression changes in treatment-responsive patients compared to those who respond well to treatment. (II) are linked to the mir-24a-3p and mir-27b-3p, with miR-24a-3p negatively regulating NRF2 expression, while miR-27b-3p appeared to enhance HMOX1 levels; (III) contribute to the diminished apoptosis observed in unresponsive patients by modulating apoptotic and anti-apoptotic pathways; (IV) highlight a potential mechanism whereby their elevated expression may facilitate parasite survival, chronic infection, expanding and persistent cutaneous lesions, and treatment unresponsiveness. Additionally, these results suggest that targeting miR-24a-3p and miR-27b-3p could provide a novel therapeutic strategy to improve treatment outcomes for patients with unresponsive forms of cutaneous leishmaniasis. Utilizing whole-genome and RNA sequencing in future investigations can help to uncover additional genetic factors related to treatment-unresponsiveness.

Methods

Ethical statement

Ethical approval was achieved from the Ethical Committee of Kerman University of Medical Sciences as well as Iran National Committee for Ethics in Biomedical Research under the ethical number of IR.KMU.AH.REC.1402.134 on November 2023. Tissues were not sourced from executed prisoners or prisoners of conscience. Written informed consent for tissue isolation and the publication of data or lesion captures was obtained from all patients, while respecting their anonymity. For participants under the age of 18, written consent was obtained from their parents or legal guardians according to ethical standards. All procedures were performed in compliance with declaration of Helsinki for experiments involving humans. Unresponsive patients were referred to the university teaching hospitals for subsequent evaluation and laboratory tests to consider combination therapy. Demographic data were collected in a confidential manner.

Study region

This study was conducted at Afzalipour Hospital in Kerman, in southeastern of Iran as a referral center for the management of patients with CL. All patients referred to the Salk treatment center within this hospital and received Glucantime®(Sanofi-Aventis, Paris, France) treatment at no costs, based on the World Health Organization (WHO) protocol. This protocol was first implemented following the catastrophic earthquake and subsequent CL outbreak in Bam, Kerman province36. This center is staffed by qualified doctors and trained personnel, ensuring comprehensive care for CL patients.

Responsive and unresponsive individuals

Responsive cases were defined as patients who showed absolute re-epithelialization of the lesion without any relapse after six months of follow-up, following a single course of Glucantime®, either alone or in conjunction with cryotherapy. Conversely, unresponsive patients were defined as individuals who continued to exhibit active lesions despite undergoing two treatment courses of Glucantime®. This medication was administered either systemically at a dosage of 20 mg/kg per day for 3 weeks, or intralesionally once a week for 12 weeks, combined with cryotherapy using liquid nitrogen37.

Clinical presentations

Patients were selected at random from those with ACL lesions who were referred to Afzalipour hospital between January 2022 and February 2024. A total of 31 patient were obtained, including 21 individuals from unresponsive to Glucantime® and 10 from those who were responsive. Subsequently, their baseline demographic and clinical characteristics, including number, location, size, and duration of lesions were assembled, separately. Sample isolates were identified at Pathology and Stem Cell Research Center, School of Medicine, Kerman University of Medical Sciences in Kerman.

Sampling procedure

Isolates were obtained by excising tissue from the edge of the lesions using a scalpel with a No. 15 blade for scraping. A smear was prepared from the samples, fixed by methanol, stained with Giemsa, and accurately observed by a light microscope to confirm the presence of Leishman bodies (amastigotes). In parallel, samples were cultured in Novy–MacNeal–Nicolle medium (NNN) at PH = 7.2 and 24 ± l °C for one week in case of parasite isolation for nested polymerase chain reaction (PCR). Moreover, a portion of each sample was set aside for RNA isolation and further assays.

Verification of Leishmania isolates

DNA extraction

DNA extraction was performed on promastigotes isolated from the clinical samples using the QIAamp DNA Mini Kit (Qiagen, Germany). Following the manufacturer’s instructions, 15 µL of proteinase K was added to 1.5 mL microtubes, initially. Next, lesion samples along with 200 µL of BL buffer, were introduced into each microtube. The microtubes were then Vortexed and incubated in a water bath at 56 °C for 30 min. Afterward, samples were centrifuged as kit’s instructions, and the extracted DNA was stored at −18 °C.

Nested PCR assay

The nested PCR procedure involved two consecutive steps, as previously described elsewhere21. In summary, two ordinary primers, CSB2XF (CGAGTAGCAGAAACTCCCGTTCA) and CSB1XR (ATTTTTCGCGATTTTCGCAGAACG), were employed as external primers. For the next round, specific internal primers 13Z (ACTGGGGGTTGGTGTAA AATAG) and LiR (TCGCAGAACGCCCCT) were used. The terminal PCR products were analyzed utilizing 1.5% agarose gel electrophoresis and visualized with a UV transilluminator (Uvitech, Cambridge, UK). It was previously established that L. tropica generates the largest PCR product among Leishmania species, measuring 750 bp. Additionally, it can be easily distinguished from L. major, which has a PCR product of 560 bp21.

Predicting microRNAs

To predict NRF2 and HMOX1 related miRNAs, we utilized TargetScanHuman 8.0 (TargetScanHuman 8.0) and miRTarBase (miRTarBase) algorithms. TargetScan identifies miRNA targets by finding conserved 8 mer, 7 mer, and 6 mer sites matching the seed region38. Subsequently, predicted miRNAs were checked with miRTarBase database as mentioned elsewhere39. According to the algorithm’s reports, two specific miRNAs were selected: mir-24a-3p, associated with NRF2, and mir-27b-3p, linked to HMOX1.

RNA extraction and cDNA synthesis

Total RNA was extracted from the initial isolates of 31 unresponsive and responsive patients using the High Pure RNA isolation kit (Roche-Mannheim, Germany) according to the producer’s instructions. DNase1 (Roche-Mannheim, Germany) was utilized to remove any contaminating DNA. Afterward, the quality and quantity of the RNA samples were assessed employing a Nanodrop (ND-2000, Thermo Scientific Fisher, USA). Complementary DNA (cDNA) synthesis was carried out employing the PrimeScript RT reagent Kit (Takara, Tokyo, Japan) based on the provided guideline. This mixture was first incubated at 37 °C for 15 min, followed by a 5 s incubation at 85 °C to inactivate the reverse transcriptase. Eventually, the cDNA was diluted in distilled water that is free of DNase and RNase.

Synthesis of cDNA based on stem-loop miRNA method

After extracting RNA from the samples, the real-time stem-loop primer developed by Bonyakhteh was applied, which is part of the BONmiR High Sensitivity MicroRNA 1 st Strand cDNA Synthesis Kit (BN-0011.17.2, Bonyakhteh, Tehran, Iran). Universal cDNA synthesis was performed using a thermocycler with the following conditions: 10 min at 25 °C, 60 min at 42 °C, and 10 min at 70 °C. The synthesized cDNA was then kept at − 20 °C for future real-time PCR (RT-PCR).

RT-PCR assay

MiRNA expression

The study employed RT-PCR to analyze miRNAs expression, using U6 as internal control (Table 1). The RT-PCR reactions were performed using a Rotor-Gene 6000 real-time PCR cycler (Corbett, Qiagen) with the BON qPCR Master mix protocol (Bonyakhteh, Tehran, Iran, BN-0011.17.4.1). The PCR reactions were then conducted under the following conditions: initial denaturation (95 °C for 2 min), and amplification cycles, including 45 cycles of 95 °C for 5 s and 62 °C for 20 s. This experiment was done in triple conditions.

Gene expression

RT-PCR was executed to verify the differences in expression level four apoptosis-related and two treatment-unresposiveness indicators within the responsive and unresponsive isolates. The primers were detected by Primer Bank (PrimerBank). Subsequently, their efficiency was evaluated using sequential dilutions of pooled cDNA in RT-PCR, with the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) primer acting as the housekeeping gene for normalization. The sequences of the genes amplified in this study are provided in Table 1. This assay was conducted using SYBR Premix Ex Taq II (Takara, Japan) on a Rotor-Gene 6000 real-time PCR cycler. The RT-PCR amplification was executed in triplicate, starting with an initial denaturation step at 95 °C for 20 s, followed by 40 cycles of 94 °C for 10 s, 60 °C for 20 s, and 72 °C for 20 s. To confirm reaction specificity, melt curve analysis was conducted.

Immunohistochemistry

The skin samples were accurately placed in 10% buffered formalin for routine tissue processing and were ultimately embedded in paraffin blocks for tissue sectioning and Hematoxylin and Eosin staining. The IHC assay was then performed employing Bax (Zytomed, ID code: 502_17990, Germany) and Bcl2 (monoclonal antibody, mouse, ID code: PDMO16- lot_H147, USA) markers based on the manufacturer’s protocols. The expression levels of apoptotic proteins were assessed by determining the stained cells and calculating the average across ten microscopic fields (400×). Quantitative analysis of Bax and Bcl2 protein expression was done by ImageJ software (National Institutes of Health and the Laboratory for Optical and Computational Instrumentation) within the IHC profiler program40. The results were displayed as a percentage value.

Statistical analysis

Data were analyzed using SPSS v.20 and GraphPad Prism v.10. One-way ANOVA test was applied to determine the differences between the responsive and unresponsive groups. The following equation was used to calculate comparative threshold (CT): [ΔCT = CT (target) - CT (reference)]. Moreover, the relative expression was considered using the ΔCT approach and 2−ΔCT method was employed as a relative quantification strategy for RT-PCR data analysis. Ultimately, a P-value of less than 0.05 was chosen statistically significant. Data were reported as mean ± standard deviation (SD).

Acknowledgements

We would like to thank all the personnel of the Leishmaniasis Research Center and Pathology and Stem Cell Research Center or Kerman University of Medical Sciences, Iran for their efforts in performing this study.

Author contributions

N.M. Designed the project and obtained written consents from the patients. A.K. and M.F. predicted the miRNAs. N.M. and S.S.M. collected demographic and clinical data and isolated sample tissue from patients’ lesion for experimental assays. A.K., E.S. and M.F. performed the experiment and then analyzed the results, designed figures, and wrote the manuscript. S.D. performed and analyzed the IHC profile. S.S.M. supervised the project and revised the primary manuscript. All authors read and approved the final version of the paper.

Funding

This study was supported by Kerman University of Medical Sciences [No 402000358].

Data availability

The results of gene expression assay during the current study are available in the Mendeley Data repository, dataset S1 - Mendeley Data. In addition, personal data of participants are not publicly available due to maintaining the confidentiality of patients’ information but are available from the corresponding author (S.S.M.) on reasonable request.

Declarations

Competing interest

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Shahriar Dabiri, Email: dabiri12@yahoo.com.

Simin Shamsi Meymandi, Email: Meymandi.s@gmail.com.

References

  • 1.Leishmaniasis. Available from: https://www.paho.org/en/topics/leishmaniasis
  • 2.Leishmaniasis. Available from: (2023). https://www.who.int/news-room/fact-sheets/detail/leishmaniasis., https://www.who.int/news-room/fact-sheets/detail/leishmaniasis
  • 3.Nasiri, Z. et al. Cutaneous leishmaniasis in Iran: A review of epidemiological aspects, with emphasis on molecular findings. Parasite29, 47. 10.1051/parasite/2022047 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bamorovat, M. et al. Risk factors for anthroponotic cutaneous leishmaniasis in unresponsive and responsive patients in a major focus, Southeast of Iran. PLoS One. 13, e0192236. 10.1371/journal.pone.0192236 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Sharifi, I. et al. A comprehensive review of cutaneous leishmaniasis in Kerman Province, southeastern iran-narrative review Article. Iran. J. Public. Health. 44, 299–307 (2015). [PMC free article] [PubMed] [Google Scholar]
  • 6.Yamey, G. The world’s most neglected diseases. BMJ. 10.1136/bmj.325.7357.176 (2002). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Mitropoulos, P., Konidas, P. & Durkin-Konidas, M. New world cutaneous leishmaniasis: updated review of current and future diagnosis and treatment. J. Am. Acad. Dermatol.63, 309–322. 10.1016/j.jaad.2009.06.088 (2010). [DOI] [PubMed] [Google Scholar]
  • 8.Bamorovat, M. et al. Major risk factors and histopathological profile of treatment failure, relapse and chronic patients with anthroponotic cutaneous leishmaniasis: A prospective case-control study on treatment outcome and their medical importance. PLoS Negl. Trop. Dis.15, e0009089. 10.1371/journal.pntd.0009089 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Muhammed Hassan, G., Zuhair Ali, H. & Muhammed Hussein, W. Evaluation of IL-8, nitric oxide and macrophage inhibitory factor as clinical circulatory markers in patients with cutaneous leishmaniasis, before and during sodium stibogluconate treatment. Cytokine173, 156450. 10.1016/j.cyto.2023.156450 (2024). [DOI] [PubMed] [Google Scholar]
  • 10.Basmaciyan, L., Azas, N. & Casanova, M. Different apoptosis pathways in leishmania parasites. Cell. Death Discovery. 4, 90. 10.1038/s41420-018-0092-z (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Srivastav, S. et al. Leishmania donovani prevents oxidative burst-mediated apoptosis of host macrophages through selective induction of suppressors of cytokine signaling (SOCS) proteins. J. Biol. Chem.289, 1092–1105. 10.1074/jbc.M113.496323 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Akarid, K. et al. Leishmania major-mediated prevention of programmed Cell death induction in infected macrophages is associated with the repression of mitochondrial release of Cytochrome C. J. Leukoc. Biol.76, 95–103. 10.1189/jlb.1001877 (2004). [DOI] [PubMed] [Google Scholar]
  • 13.Blot, C. et al. Leishmania infantum exploits the anti-ferroptosis effects of Nrf2 to escape cell death in macrophages. Cell. Rep.43, 114720. 10.1016/j.celrep.2024.114720 (2024). https://doi.org:. [DOI] [PubMed] [Google Scholar]
  • 14.Ashrafizadeh, M. et al. MicroRNA-mediated regulation of Nrf2 signaling pathway: implications in disease therapy and protection against oxidative stress. Life Sci.244, 117329. 10.1016/j.lfs.2020.117329 (2020). https://doi.org:. [DOI] [PubMed] [Google Scholar]
  • 15.Saha, S., Roy, S., Dutta, A., Jana, K. & Ukil, A. Leishmania donovani targets host transcription factor NRF2 to activate antioxidant enzyme HO-1 and transcriptional repressor ATF3 for Establishing infection. Infect. Immun.89, e0076420. 10.1128/iai.00764-20 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ma, Q. Role of nrf2 in oxidative stress and toxicity. Annu. Rev. Pharmacol. Toxicol.53, 401–426. 10.1146/annurev-pharmtox-011112-140320 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Reverte, M. et al. The antioxidant response favors leishmania parasites survival, limits inflammation and reprograms the host cell metabolism. PLoS Pathog.17, e1009422. 10.1371/journal.ppat.1009422 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Wang, Y., Liang, Y. & Lu, Q. MicroRNA epigenetic alterations: predicting biomarkers and therapeutic targets in human diseases. Clin. Genet.74, 307–315. 10.1111/j.1399-0004.2008.01075.x (2008). [DOI] [PubMed] [Google Scholar]
  • 19.Rezaei, M. et al. A systematic review, meta-analysis, and network analysis of diagnostic MicroRNAs in glaucoma. Eur. J. Med. Res.28, 137. 10.1186/s40001-023-01093-8 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Mukherjee, B. et al. Probing the molecular mechanism of aggressive infection by antimony resistant leishmania donovani. Cytokine145, 155245. 10.1016/j.cyto.2020.155245 (2021). [DOI] [PubMed] [Google Scholar]
  • 21.Noyes, H. A., Reyburn, H., Bailey, J. W. & Smith, D. A nested-PCR-based schizodeme method for identifying leishmania kinetoplast minicircle classes directly from clinical samples and its application to the study of the epidemiology of leishmania tropica in Pakistan. J. Clin. Microbiol.36, 2877–2881. 10.1128/jcm.36.10.2877-2881.1998 (1998). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Aflatoonian, M. R. et al. Associated-risk determinants for anthroponotic cutaneous leishmaniasis treated with Meglumine antimoniate: A cohort study in Iran. PLoS Negl. Trop. Dis.13, e0007423. 10.1371/journal.pntd.0007423 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bamorovat, M. et al. Leishmania tropica isolates from non-healed and healed patients in Iran: A molecular typing and phylogenetic analysis. Microb. Pathog. 116, 124–129. 10.1016/j.micpath.2018.01.021 (2018). [DOI] [PubMed] [Google Scholar]
  • 24.Khosravi, A. et al. Clinical features of anthroponotic cutaneous leishmaniasis in a major focus, southeastern Iran, 1994–2014. Iran. J. Parasitol.12, 544–553 (2017). [PMC free article] [PubMed] [Google Scholar]
  • 25.Natera, S. et al. Leishmania spp.: proficiency of drug-resistant parasites. Int. J. Antimicrob. Agents. 29, 637–642. 10.1016/j.ijantimicag.2007.01.004 (2007). [DOI] [PubMed] [Google Scholar]
  • 26.Ryter, S. W. Heme Oxygenase-1: an anti-Inflammatory effector in cardiovascular, lung, and related metabolic disorders. Antioxid. (Basel). 10.3390/antiox11030555 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lago, T. et al. MicroRNAs regulating macrophages infected with leishmania L. (V.) Braziliensis isolated from different clinical forms of American tegumentary leishmaniasis. Front. Immunol.10.3389/fimmu.2023.1280949 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Tiwari, N. et al. Identification and characterization of MiRNAs in response to leishmania donovani infection: delineation of their roles in macrophage dysfunction. Front. Microbiol.8, 314. 10.3389/fmicb.2017.00314 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lasjerdi, Z. et al. Comparative expression profile analysis of Apoptosis-Related MiRNA and its target gene in leishmania major infected macrophages. Iran. J. Parasitol.15, 332–340. 10.18502/ijpa.v15i3.4197 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Tie, Y., Tang, F., Peng, D., Zhang, Y. & Shi, H. TGF-beta signal transduction: biology, function and therapy for diseases. Mol. Biomed.3, 45. 10.1186/s43556-022-00109-9 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Hamidi, F. et al. TGF-β targeted by miR-27a modulates Anti-Parasite responses of immune system. Iran. J. Parasitol.18, 390–399. 10.18502/ijpa.v18i3.13762 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Singh, R., Letai, A. & Sarosiek, K. Regulation of apoptosis in health and disease: the balancing act of BCL-2 family proteins. Nat. Rev. Mol. Cell. Biol.20, 175–193. 10.1038/s41580-018-0089-8 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Solano-Gálvez, S. G., Álvarez-Hernández, D. A. & Gutiérrez-Kobeh, L. Vázquez-López, R. Leishmania: manipulation of signaling pathways to inhibit host cell apoptosis. Ther. Adv. Infect. Dis.8, 20499361211014977. 10.1177/20499361211014977 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Cianciulli, A., Porro, C., Calvello, R., Trotta, T. & Panaro, M. A. Resistance to apoptosis in leishmania infantum-infected human macrophages: a critical role for anti-apoptotic Bcl-2 protein and cellular IAP1/2. Clin. Exp. Med.18, 251–261. 10.1007/s10238-017-0482-1 (2018). [DOI] [PubMed] [Google Scholar]
  • 35.Faramarzpour, M. et al. Investigating mechanisms of apoptosis of humic acid on Leishmania tropica: An in vitro and in silico approach. Heliyon, e43017 https://doi.org: (2025). 10.1016/j.heliyon.2025.e43017
  • 36.Aflatoonian, M. R. et al. A review of impact of Bam earthquake on cutaneous leishmaniasis and status: epidemic of old foci, emergence of new foci and changes in features of the disease. J. Arthropod Borne Dis.10, 271–280 (2016). [PMC free article] [PubMed] [Google Scholar]
  • 37.Dowlati, Y. Cutaneous leishmaniasis: clinical aspect. Clin. Dermatol.14, 425–431. 10.1016/0738-081X(96)00058-2 (1996). [DOI] [PubMed] [Google Scholar]
  • 38.Lewis, B. P., Shih, I., Jones-Rhoades, M. W., Bartel, D. P. & Burge, C. B. Prediction of mammalian MicroRNA targets. Cell115, 787–798. 10.1016/S0092-8674(03)01018-3 (2003). [DOI] [PubMed] [Google Scholar]
  • 39.Hsu, S. D. et al. MiRTarBase: a database curates experimentally validated microRNA–target interactions. Nucleic Acids Res.39, D163–D169. 10.1093/nar/gkq1107 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH image to imageJ: 25 years of image analysis. Nat. Methods. 9, 671–675 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The results of gene expression assay during the current study are available in the Mendeley Data repository, dataset S1 - Mendeley Data. In addition, personal data of participants are not publicly available due to maintaining the confidentiality of patients’ information but are available from the corresponding author (S.S.M.) on reasonable request.

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES