Abstract
Several studies have previously shown that histone deacetylase 4 (HDAC4) can regulate endoplasmic reticulum stress‐induced apoptosis through the activating transcription factor 4 (ATF4)/CAAT/enhancer binding protein homologous (CHOP) signaling pathway, thereby affecting the progression of osteoarthritis (OA). The present study investigated the regulatory mechanism of HDAC4 in chondrocyte apoptosis in OA using Acan‐CreERT2;HDAC4fl/fl gene knockout mice. Forty mice were divided into four groups: TM‐DMM group [tamoxifen (TM) injection at 2 months of age and destabilization of the medial meniscus (DMM) surgery at 3 months], TM‐sham group (TM injection at 2 months of age and sham surgery at 3 months), no TM‐DMM group (corn oil injection at 2 months of age and DMM surgery at 3 months) and no TM‐sham group (corn oil injection at 2 months of age and sham surgery at 3 months). Apoptosis and cartilage damage were assessed through imaging, histological analysis, immunohistochemistry, reverse transcriptase‐PCR and terminal deoxynucleotidyl transferase‐mediated dUTP nick end labeling staining. HDAC4 knockdown resulted in increased osteophyte formation, significant narrowing of the joint space and increased articular cartilage damage. Furthermore, expression levels of key apoptosis‐related markers, ATF4, CHOP, caspase‐3 and caspase‐9, were significantly higher in the TM groups than in their respective control groups. Taken together, our results suggest that HDAC4 deficiency leads to increased apoptosis induced by the ATF4/CHOP signaling pathway in the pathogenesis of OA. Therefore, upregulation of HDAC4 may represent a potential therapeutic strategy.
Keywords: apoptosis, ATF4/CHOP signaling pathway, HDAC4, osteoarthritis, transgenic mouse
Using the AcanCreERT2;HDAC4fl/fl genetic mouse model, we further investigated the role of histone deacetylase 4 (HDAC4) in chondrocyte apoptosis. We found that knocking down HDAC4 may be associated with chondrocyte apoptosis by upregulating the activating transcription factor 4 (ATF4)/CAAT/enhancer binding protein homologous (CHOP) signaling pathway. Upregulating HDAC4 could potentially serve as a therapeutic target for osteoarthritis.

Abbreviations
- ATF4
activating transcription factor 4
- CHOP
CAAT/enhancer binding protein homologous protein
- DMM
destabilization of the medial meniscus
- ER
endoplasmic reticulum
- HDAC
histone deacetylase
- OA
osteoarthritis
- OARSI
Osteoarthritis Research Society International
- PBS
phosphate‐buffered saline
- RT‐PCR
reverse transcriptase‐PCR
- TM
tamoxifen
- TUNEL
terminal deoxynucleotidyl transferase‐mediated dUTP nick end labeling
Osteoarthritis (OA) primarily affects individuals aged 65 years and older, and is the leading cause of knee dysfunction in this age group [1, 2]. Patients often experience pain and joint stiffness, which interfere with daily activities and significantly reduce their quality of life [3]. As a result of the limited blood supply and lack of effective neural control, the damage in affected joints is difficult to repair [4, 5]. Currently, the exact pathogenesis and molecular mechanisms of OA is still limited. There are no effective pharmacologic treatments available until the disease has progressed to the point where joint replacement is required.
Histone deacetylases (HDACs), also known as lysine deacetylases, regulate chromosome structure and gene expression through deacetylation modifications. They play a crucial role in biological processes such as cell proliferation, differentiation and apoptosis [6, 7]. Among them, HDAC4 has been increasingly implicated in processes like gene expression regulation, cell proliferation, differentiation, senescence and apoptosis. It is also involved in the onset and progression of various diseases, including osteosarcoma, gastric cancer and Huntington's disease [8, 9, 10, 11]. In the context of OA, HDAC4 is a key regulator of chondrocyte function and is considered one of the most studied HDACs in this field [12]. Research has shown that HDAC4 expression decreases during the progression of OA. In vitro experiments have demonstrated that overexpression of HDAC4 can reduce the levels of matrix metalloproteinase‐13, Indian hedgehog and type X collagen, at the same time as increasing the expression of type II collagen and aggrecan. These findings suggest that upregulation of HDAC4 may have a protective effect against the development of OA [13, 14].
Apoptosis, also known as programmed cell death, is a form of controlled, autonomous cell death [15]. This process plays a crucial role in maintaining the dynamic homeostasis of tissues, as well as in the growth and development of organisms. Dysregulation of apoptosis can lead to pathological conditions and contribute to the development of related diseases [16]. Recent studies have shown that apoptosis occurs in articular cartilage, with chondrocyte apoptosis being closely linked to the onset and progression of OA [17]. In normal cartilage, the proportion of cells undergoing apoptosis is typically only 2–5%. However, in osteoarthritic cartilage, this proportion can rise to as high as 18–21% [18]. Therefore, reducing chondrocyte apoptosis is important for regulating cartilage degeneration in OA [19].
Zhang et al. [20] found that HDAC4 inhibits the transcriptional activity of activating transcription factor 4 (ATF4) and the expression of its related target genes, such as CAAT/enhancer binding protein homologous protein (CHOP), through interaction with ATF4 using HEK293T cells. This inhibition reduces the expression of downstream pro‐apoptotic genes and decreases cell apoptosis. Similarly, Gu et al. [21] observed that HDAC4 expression was reduced in OA patients, whereas ATF4 and CHOP expression were elevated. In vitro experiments, where HDAC4 expression was upregulated or downregulated, showed corresponding decreases or increases in ATF4 and CHOP expression, along with a reduction or increase in chondrocyte apoptosis. Based on these findings, we hypothesize that HDAC4 may regulate chondrocyte apoptosis in cartilage by modulating ATF4. In the present study, we further investigated the role of HDAC4 in chondrocyte apoptosis and joint cartilage damage using Acan‐CreERT2;HDAC4fl/fl gene knockout mice to reduce HDAC4 expression in vivo. Our results highlight HDAC4 as a critical regulatory factor in chondrocyte apoptosis, with significant theoretical and practical implications for understanding and treating OA.
Materials and methods
Transgenic mice
The animal protocol for this experiment was approved by the Laboratory Animal Ethics Committee of the Second Clinical Medical College of Shanxi Medical University (ethical filing number DW2022063). This approval complies with national regulations on the welfare and ethics of experimental animals and adheres to the Guidelines for the Care and Use of Laboratory Animals issued by the Chinese Society for Animal Research. Acan‐CreERT2 transgenic mice (stock no. 019148; Jackson Laboratory, Bar Harbor, ME, USA) [22] and HDAC4fl/fl transgenic mice (purchased from Biocytogen, Beijing, China) were obtained [23, 24].
We mated Acan‐CreERT2 mice with HDAC4fl/fl mice to produce Acan‐CreERT2;HDAC4fl/fl. A small portion of the mouse tails was collected, and DNA was extracted for genotyping to identify AcanCreERT2;HDAC4fl/fl mice. These mice were then maintained as previously described [25]. The biological characteristics of this transgenic mouse are similar to those of ordinary mice, and the mouse can grow and develop normally. However, after injection of tamoxifen (TM) dissolved in corn oil, the Acan‐CreERT2 in its body is activated, enabling the knockout of the HDAC4 gene with the fl/fl structure marker in cartilage tissue. This genotype allows for specific deletion of HDAC4 in cartilage tissue, particularly at the site of aggrecan expression [26, 27, 28]. Forty 2‐month‐old transgenic mice were randomly divided into two groups: one group received intraperitoneal injections of TM (100 μg·g−1·day−1) for 5 consecutive days to induce HDAC4 knockout (TM group, n = 20), whereas the other group received intraperitoneal injections of corn oil as a control (no TM group, n = 20). At 3 months of age, each group underwent either destabilization of the medial meniscus (DMM) surgery or sham surgery, resulting in four experimental groups (n = 10 per group): TM‐DMM, TM‐sham, no TM‐DMM and no TM‐sham. All mice were killed at 5 months of age.
The 40 mice were housed in a specific pathogen‐free barrier environment under a 12 : 12 h light/dark photocycle with controlled temperature and humidity. They were provided with a specific pathogen‐free diet and sterile drinking water. The health status of the mice was monitored daily, and records were taken every 3 days. Mice were killed using 100% CO2 when they reached any of the following humane endpoints: (a) weight loss (15–20% reduction from baseline weight); (b) anorexia (failure to eat for more than 24–48 h); (c) weakness (inability to eat or drink independently); and (d) infection (unresponsive to penicillin treatment). Death was confirmed by the absence of breathing for 2–3 min, lack of heartbeat and no blink reflex. During the course of the experiment, no unexplained deaths occurred.
Surgery was performed on the right knee joints of the mice and, at 5 months of age, all mice were killed. Following euthanasia, the right hind limbs were collected for further analysis. By comparing the outcomes of knockout and non‐knockout mice under both DMM and sham conditions, we aimed to gain further insight into the specific role and mechanisms of HDAC4 in the development of OA.
DMM surgery
To induce traumatic OA in the DMM subgroup, we made a 0.5‐cm incision along the medial side of the patellar ligament with a sterile surgical scalpel, followed by hemostasis and layer‐by‐layer dissection. The patellar ligament was pushed laterally to expose the knee joint capsule, and then, under a microscope, the medial meniscotibial ligament was severed and meniscus was freed to confirm the success of the surgery. After DMM surgery, the medial displacement of the mouse knee joint reduced the weight‐bearing area, leading to increased pressure on the medial side. This mechanical alteration not only exacerbates stress on the inner knee joint, but also also accelerate the development of degenerative conditions, such as cartilage degeneration and osteophyte formation [29, 30]. The Sham group only underwent skin and joint capsule incision without any further intervention. Postoperatively, animals were allowed unrestricted movement with free access to food and water. The DMM surgery for all mice was performed by the same person on the same day.
Imaging observations
The collected mouse hind limbs were X‐rayed with a small animal X‐ray machine (Faxitron Inc., Tucson, AZ, USA). Both anteroposterior and lateral views of the right hind limb were obtained. The anteroposterior scan was conducted to fully expose the knee joint space, while during the lateral scan, the knee joint curvature was maintained at approximately 150°. The exposure settings of the instrument were configured to the fully automatic default settings. According to previously published research, imaging can be classified into four levels [31, 32].
Histological evaluation
The right hind limbs were fixed in 4% paraformaldehyde buffer for 48 h, then rinsed under running water for 30 min. The limbs were subsequently decalcified in 10% EDTA solution for 8 weeks, with the decalcification solution replaced every 5 days. After decalcification, the limbs were rinsed in running water for 2–3 h, then dehydrated using a fully automated dehydrator (Leica, Wetzlar, Germany) with a graded ethanol series. Finally, the specimens were embedded in paraffin, and 5‐μm thick sections were prepared in the coronal plane using a rotary slicer (Leica).
The sections were baked on a slide warmer (Leica) at 60 °C for 2 h, then sequentially immersed in xylene, absolute ethanol and 95% ethanol. Staining was performed using Safranin O‐Fast Green (Sigma‐Aldrich; Merck KgaA, Darmstadt, Germany). Two independent, blinded observers scored each section, and the scores were averaged for each joint according to the OARSI grading system [33]. The scoring system ranged from 0 to 6 points, with a higher score indicating more severe cartilage degeneration.
Immunohistochemistry
Immunohistochemical staining was performed on paraffin sections to detect the expression of HDAC4, ATF4, CHOP, caspase‐3 and caspase‐9. After dewaxing and rehydration, endogenous peroxidase activity was blocked by incubating the sections with a blocking solution for 10 min, followed by three washes with phosphate‐buffered saline (PBS). Antigen retrieval was carried out using a complex enzyme (Boster, Wuhan, China), with incubation in a 37 °C oven for 1 h, followed by three PBS washes. The sections were then blocked with normal goat serum at room temperature for 30 min, and incubated overnight at 4 °C with the following primary antibodies: anti‐HDAC4 (dilution 1 : 50; catalog. no. A0179; Abclonal, Woburn, MA, USA), anti‐ATF4 (dilution 1 : 50; catalog. no. 10835‐1‐AP; Proteintech, Rosemont, IL, USA), anti‐CHOP (dilution 1 : 50; catalog. no. 15204‐1‐AP; Proteintech), anti‐caspase‐3 (dilution 1 : 50; catalog. no. bs‐0081R; BIOSS, Woburn, MA, USA) and anti‐caspase‐9 (dilution 1 : 50; catalog. no. bs‐0050R; BIOSS). After three PBS washes, a reaction enhancer was added dropwise and incubated for 30 min at 37 °C. Following another PBS wash, horseradish peroxidase‐conjugated secondary antibody (cat. no. PV‐9001; ZSGB‐BIO, Beijing, China) was applied and incubated in an oven at 37 °C for 1 h. Sections were then colorimetrically developed using 3,3′‐diaminobenzidine solution. Stained sections were viewed and photographed using a DM6B microscope (Leica) for subsequent quantitative analysis.
Quantitative reverse transcriptase‐PCR (RT‐PCR)
Cartilage tissue was obtained from the knee joint of the right hind limb of mice in a mortar and grinded using liquid nitrogen. The right hind limbs of five mice were used in each group, and each mouse was an independent sample. To the ground tissue, 1 mL of TRIzol reagent (Invitrogen, Waltham, MA, USA) was added for RNA extraction, and the concentration of extracted RNA was measured using a NanoDrop Onec (Thermo Fisher Scientific, Waltham, MA, USA). RNA was reverse transcribed into cDNA using PrimeScript™ RT Master Mix (Takara). cDNA after reverse transcription was amplified using SYBR Green™ Premix Ex Taq™ II Amplification Kit (Takara, Shiga, Japan) using the following amplification procedure: pre‐denaturation (95 °C for 30 s), denaturation (95 °C for 15 s), annealing (60 °C for 45 s) and annealing (60 °C for 45 s). The amplification program was pre‐denaturation (95 °C for 30s), denaturation (95 °C for 15 s), annealing (60 °C for 45 s), for a total of 40 cycles; at the end of the amplification, the gene expression was calculated by the relative quantification of gene method. The primers used in PCR can are shown in Table 1.
Table 1.
Primers used in RT‐PCR.
| Species | Genes | Forward | Reversed |
|---|---|---|---|
| Mice | HDAC4 | 5′‐CTGCAAGTGGCCCCTACAG‐3′ | 5′‐CTGCTCATGTTGACGCTGGA‐3′ |
| ATF4 | 5′‐TCGATGCTCTCTGTTTCGAATG‐3′ | 5′‐ATTTTCAGCTGGTCCAACGG‐3′ | |
| CHOP | 5′‐CTGCCTTTCACCTTGGAGAC‐3′ | 5′‐CGTTTCCTGGGGGATGAGATA‐3′ | |
| Caspase‐3 | 5′‐TGGGACTGATGAGGAGA‐3′ | 5′‐ACTGGATGAACCACGAC‐3′ | |
| Caspase‐9 | 5′‐GCCAGAGGTTCTCAGACCAG‐3′ | 5′‐TCCCTGGAACACAGACATCA‐3′ | |
| 18S | 5′‐CGGCTACCACATCCAAGGAA‐3′ | 5′‐CGGCTACCACATCCAAGGAA‐3′ |
Terminal deoxynucleotidyl transferase‐mediated dUTP Nick end labeling (TUNEL)
The paraffin sections were permeabilized with 0.1% Triton‐X‐100 in PBS at room temperature for 15–20 min. TUNEL staining was performed according to the instructions provided in the TUNEL Cell Apoptosis Detection Kit‐CY3 (catalog. no. MK1016; Boster). After the staining procedure, an anti‐fade mounting medium was applied to the sections. Fluorescence images were then captured using a fluorescence microscope.
Statistical analysis
All experimental data are presented as the mean ± SD. Statistical analysis was performed using spss software (IBM Corp., Armonk, NY, USA) and prism, version 9.0 (GraphPad Software Inc., San Diego, CA, USA). Comparisons between two groups were made using a t‐test, whereas one‐way analysis of variance was used to compare data across four groups. Each experiment was repeated at least three times. P < 0.05 was considered statistically significant.
Results
Successful preparation of Acan‐CreERT2 ;HDAC4fl /fl transgenic mice
In this experiment, the Acan‐CreERT2; HDAC4fl/fl transgenic mice were injected with TM, which activated the Cre recombinase enzyme. This activation resulted in the recombination of the loxP sites, leading to the knockout of the HDAC4 gene (Fig. 1A). Tail biopsy analysis confirmed the presence of the HDAC4 allele and the Acan‐Cre transgene (Fig. 1B). Channel 1 shows the PCR results from the transgenic mice used in this study. The homozygous aggrecan gene appears at 200 bp, and the homozygous HDAC4 gene appears at 620 bp. These data indicate that the transgenic mice are homozygous for both the aggrecan and HDAC4 alleles. After tamoxifen injection, RT‐PCR analysis revealed a significant reduction in HDAC4 gene expression in the knockout mice (Fig. 1C). These results demonstrate the successful generation of HDAC4 knockout mice.
Fig. 1.

Construction of Acan‐CreERT2;HDAC4fl/fl conditional HDAC4 knockout mice. (A) Illustration of Acan‐CreERT2;HDAC4fl/fl mice. (B) DNA gel electrophoresis results of mouse tail identification: Channel 1: homozygous aggrecan and HDAC4 genes and is the mouse used in our experiment. Channel 2: homozygous aggrecan gene. Channel 3: homozygous HDAC4 gene. Channel 4: wild‐type mouse. (C) Tissue samples from tamoxifen‐injected genetically engineered mice (Acan‐CreERT2;HDAC4d/d) and non‐tamoxifen‐injected genetically engineered mice (Acan‐CreERT2;HDAC4fl/fl) were collected and analyzed for HDAC4 knockdown or not by quantitative RT‐PCR. All experimental data are presented as the mean ± SD. Each experiment was repeated three times. A t‐test was used to compare the two groups. **P < 0.01.
HDAC4 knockdown resulted in osteocphytes and significant narrowing of the joint space
X‐rays of the collected right hind limbs were performed 8 weeks after DMM surgery. X‐rays of the TM‐DMM group showed significant narrowing of the joint space, increased subchondral bone density and significant osteophytes in this group. No TM‐DMM group had an uneven joint surface, and there was minimal osteophyte formation with narrowing of the joint space, which was mild compared to TM‐DMM group. No obvious abnormality was seen in sham group (Fig. 2A). TM‐DMM osteophyte scores were higher than the other three groups (Fig. 2B).
Fig. 2.

X‐ray analysis of the knee joints of mice 2 months after DMM surgery. (A) Compared with mice injected with corn oil, HDAC4 knockout DMM mice had a narrowed joint space (white arrows) and significant osteophyte (red arrows) formation. DMM, destabilization of the medial meniscus; TM, tamoxifen. (B) Osteophytosis scores in the X‐rays. All experimental data are presented as the mean ± SD. Each experiment was repeated three times. One‐way analysis of variance was used to compare the four groups. *P < 0.05 and ***P < 0.001.
Knockdown of HDAC4 resulted in increased damage to articular cartilage
Based on Safranin O‐Fast Green staining (Fig. 3A), Acan‐CreERT2; HDAC4fl/fl conditional HDAC4 knockout mice exhibited more severe cartilage damage in their knee joints compared to the control group (no TM) 2 months after undergoing DMM surgery. The extent of cartilage damage was further assessed using the Osteoarthritis Research Society International (OARIS) scoring system, with the TM‐DMM group showing significantly higher OARIS scores than the no TM‐DMM group (Fig. 3B). Additionally, we observed an increased OARIS score in the TM‐sham group compared to the no TM‐sham group, suggesting that HDAC4 knockdown contributes to cartilage damage even in the absence of surgical intervention.
Fig. 3.

Knockdown of HDAC4 resulted in more cartilage damage. (A) Safranin O staining in the Acan‐CreERT2;HDAC4d/d + DMM group showing extensive staining loss and severe cartilage damage. Top panel: scale bars = 100 μm. Bottom panel: scale bars = 20 μm. (B) OARSI scores. DMM, destabilization of the medial meniscus; HDAC4, histone deacetylase 4; OARIS, osteoarthritis research society international; TM, tamoxifen. All experimental data are presented as the mean ± SD. Each experiment was repeated three times. One‐way analysis of variance was used to compare the four groups. *P < 0.05, ***P < 0.001 and ****P<0.0001.
Knockdown of HDAC4 resulted in elevated expression of ATF and CHOP, as well as increased apoptosis
To investigate the impact of HDAC4 knockdown on apoptosis, we assessed the expression of key apoptosis‐related proteins using immunohistochemistry. In the sham group, TM injection led to a reduction in HDAC4 expression and a concomitant increase in the expression of ATF4, CHOP, caspase‐3 and caspase‐9. Notably, the TM‐DMM group exhibited a significantly higher expression of these markers compared to both the no TM‐DMM and sham groups, further supporting the role of HDAC4 in regulating apoptosis in articular cartilage (Fig. 4A–E). Additionally, TUNEL staining confirmed these findings, showing a higher chondrocyte positivity rate in the TM‐DMM group compared to both the no TM‐DMM and sham groups, indicative of increased apoptosis in the cartilage following HDAC4 knockdown (Fig. 5).
Fig. 4.

Immunohistochemical staining and RT‐PCR for the expression of HDAC4, ATF4, CHOP, caspase‐3 and caspase‐9 in transgenic murine osteoarthritis model. (A–E) Immunohistochemical staining showed HDAC4, ATF4, CHOP, caspase‐3 and caspase‐9 in 8‐week‐old DMM and sham transgenic mice and quantitative analysis of immunohistochemical staining. Top: scale bar = 150 μm. Bottom: scale bar = 50 μm. (F) RT‐PCR for HDAC4, ATF4, CHOP, caspase‐3 and caspase‐9 expression in 2‐month‐old DMM and sham transgenic mice. ATF4, activating transcription factor 4; CHOP, C/EBP homologous protein; DMM, destabilization of the medial meniscus; HDAC4, histone deacetylase 4; RT‐PCR, reverse transcription‐quantitative polymerase chain reaction; TM, tamoxifen. All experimental data are presented as mean ± standard deviation (mean ± SD). Each experiment was repeated three times. One‐way analysis of variance was used to compare the four groups. *P < 0.05, **P < 0.01, ***P < 0.001 and ****P<0.0001, ns, not significant.
Fig. 5.

Decrease of HDAC4 resulted in increased apoptosis in Acan‐CreERT2;HDAC4fl/fl gene mice. (A) TUNEL staining results showed in chondrocyte apoptosis. Scale bar = 20 μm. (B) Quantitative analysis of TUNEL. Staining showed that highest positive rate of apoptosis in the TM‐DMM group, followed by moderate in TM‐sham and no TM‐DMM, and the lowest rate in the no TM‐sham group. DMM, destabilization of the medial meniscus; TM, tamoxifen; TUNEL, terminal deoxynucleotidyl transferase‐mediated dUTP nick end labeling. All experimental data are presented as the mean ± SD. Each experiment was repeated three times. One‐way analysis of variance was used to compare the four groups. **P < 0.01, ***P < 0.001 and ****P<0.0001.
In addition, RT‐PCR analysis further validated the immunohistochemical results. In both the DMM and sham groups, the expression of HDAC4 was lower in the TM groups compared to the no TM groups. Conversely, the expression levels of ATF4, CHOP, caspase‐3 and caspase‐9 were significantly higher in the TM groups than in their respective no TM groups (Fig. 4F).
Discussion
In the present study, we successfully established the Acan‐CreERT2;HDAC4fl/fl mouse model using knockout technology to investigate the role of HDAC4 in the regulation of apoptosis in OA following DMM. OA and apoptosis were assessed through radiological imaging, Safranin O‐Fast Green staining, immunohistochemistry and TUNEL assays. X‐ray analysis of knee joints from HDAC4 knockout mice showed joint space narrowing and the formation of osteophytes on the tibial plateau and femoral condyles compared to mice without HDAC4 knockout. Safranin O‐Fast Green staining revealed severe cartilage damage in the HDAC4 knockout mice. Additionally, both immunohistochemistry and RT‐PCR analyses demonstrated significantly increased expression of apoptosis markers caspase‐3 and caspase‐9 in the HDAC4 knockout group. TUNEL staining further confirmed a significant increase in apoptosis in this group compared to the other three groups. These findings clearly highlight the critical role of HDAC4 in regulating apoptosis during OA in this mouse model.
The results of the present study also show that, in the TM‐sham group, although X‐ray imaging did not reveal joint space narrowing or osteophyte formation compared to the normal group, there was an increase in the OARIS score and elevated expression of ATF4/CHOP. This suggests that OA may be developing, even in the absence of overt radiographic changes. These findings are consistent with previous studies indicating that reduced HDAC4 accelerates OA progression, whereas upregulation of HDAC4 may exert a protective effect against OA. In the no TM‐DMM group, compared to the normal group, although HDAC4 immunohistochemistry results showed no statistically significant difference, a downward trend in HDAC4 expression was observed. RT‐PCR analysis further demonstrated a decrease in HDAC4 expression. Additionally, levels of ATF4/CHOP and apoptosis‐related markers were elevated, suggesting a link between cartilage damage and chondrocyte apoptosis. These findings imply that the elevated apoptosis markers may contribute to a detrimental feedback loop, exacerbating cartilage degeneration and further promoting OA progression [19, 34].
HDAC4 is expressed with notable tissue specificity, primarily in the brain, muscle, and cartilage [35, 36]. It has been shown to play a crucial role in the development of OA by inhibiting chondrocyte hypertrophy and maintaining cartilage integrity [37, 38]. Apoptosis is a key factor in degenerative diseases, including OA, because chondrocyte apoptosis disrupts the balance between cartilage synthesis and degradation, leading to increased damage to the cartilage matrix [17, 39]. Previous studies have demonstrated that HDAC4 is predominantly localized in the cytoplasm, where it interacts with ATF4 to regulate its activity. Through this interaction, HDAC4 inhibits the expression of ATF4 and its downstream target genes, thereby suppressing apoptotic processes [20]. In the present study, we utilized Acan‐CreERT2;HDAC4fl/fl conditional knockout mice to reduce HDAC4 expression, resulting in increased levels of ATF4 and CHOP. This elevation in ATF4 and CHOP was associated with a corresponding increase in chondrocyte apoptosis, further highlighting the importance of HDAC4 in cartilage homeostasis.
HDAC4 induces chondrocyte apoptosis by regulating the ATF4/CHOP pathway. ATF4 is a critical transcription factor involved in several key biological processes, including protein synthesis, amino acid metabolism and cellular responses to oxidative stress [40]. Furthermore, ATF4 activates the expression of another transcription factor, CHOP. Previous studies have demonstrated that mice lacking CHOP exhibit significant protection against endoplasmic reticulum (ER) stress‐induced apoptosis, indicating that CHOP plays a vital role in promoting apoptosis by inhibiting anti‐apoptotic signaling and regulating the cell cycle and metabolism [41, 42, 43, 44, 45]. The roles of ATF4 and CHOP in initiating ER stress processes, particularly how they activate ER stress signaling pathways to induce apoptosis, have been well established [46]. Our findings are consistent with these previous reports. We observed that knockdown of HDAC4 in an osteoarthritis model led to increased levels of ATF4 and CHOP, resulting in enhanced chondrocyte apoptosis.
Gu et al. [21] previously demonstrated that the expression of HDAC4 is reduced in OA cartilage, whereas the levels of ATF4, CHOP, caspase12 and apoptotic cells are elevated. In their study, modulation of HDAC4 expression, either through overexpression or suppression, led to corresponding changes in the levels of ATF4, CHOP, caspase12 and apoptosis. In an anterior cruciate ligament transection rat model, the injection of an HDAC4 adenovirus showed that HDAC4 can inhibit apoptosis induced by the ATF4/CHOP signaling pathway, thus mitigating joint cartilage damage. These findings suggest that HDAC4 exerts an anti‐apoptotic effect by blocking the ATF4/CHOP pathway, offering a potential therapeutic target for osteoarthritis treatment. Consistent with the previous findings of our research group [21], we can observe in this study that, when HDAC4 is knocked out, the expression levels of ATF4, CHOP, caspase‐3, caspase‐9 and apoptotic cells are all increased. In the present study, we used Acan‐CreERT2;HDAC4fl/fl knockout mice for the first time to investigate the role of HDAC4 in regulating chondrocyte apoptosis and ATF4 in OA. The HDAC4 knockout mice specifically target the deletion of HDAC4 in chondrocytes, allowing for a more precise examination of the long‐term effects of HDAC4 loss on chondrocyte apoptosis and OA progression [26, 47]. This approach avoids the confounding factors related to injection‐induced injury that could potentially influence the results. By contrast, adenoviral injections generally produce short‐term effects and may be subject to variability as a result of infection efficiency and immune responses, which could introduce discrepancies in the results [48, 49]. Compared to adenoviral injection in rat knee joints, the HDAC4 knockout mouse model provides a more robust demonstration of the reliability of our findings. Additionally, the use of Acan‐CreERT2;HDAC4fl/fl knockout mice addresses the gap in the in vivo studies by Gu, where the downregulation of HDAC4 was not fully examined, thus enhancing the persuasiveness of our conclusions, thereby strengthening the validity and significance of our conclusions.
In conclusion, our data indicate that decreased HDAC4 may be associated with chondrocyte apoptosis via upregulation of ATF4/CHOP pathway. Thus, upregulation of HDAC4 may be a new potential therapy for OA treatment.
Conflicts of interest
The authors declare that they have no conflicts of interest.
Peer review
The peer review history for this article is available at https://www.webofscience.com/api/gateway/wos/peer‐review/10.1002/2211‐5463.13965.
Author contributions
JH, YX and PL designed the project. JH prepared the manuscript. JH, XD and RZ performed the experiments. JH and XC create the animal model. CW and PL revised the manuscript. All authors contributed to data analysis and integration, visualization and figure generation, and approved the final version of the manuscript submitted for publication.
Acknowledgements
This study was supported by the Research Grant Program for Returned Scholars of Shanxi Province (2022‐199), the Key Research and Development Project of Shanxi Province ‘Intelligent Research and Application of Gait Analysis in Locomotor Injury Diseases Based on Big Data Platform’ (202202150401019) and Shanxi Province Higher Education ‘Billion Project’ Science and Technology Guidance Project (BYGL013).
Edited by Irene Diaz‐Moreno
Data accessibility
The data that support the findings of this study are available from the corresponding author upon reasonable request.
References
- 1. Miller ME, Rejeski WJ, Messier SP and Loeser RF (2001) Modifiers of change in physical functioning in older adults with knee pain: the observational arthritis study in seniors (OASIS). Arthritis Rheum 45, 331–339. [DOI] [PubMed] [Google Scholar]
- 2. Johnson VL and Hunter DJ (2014) The epidemiology of osteoarthritis. Best Pract Res Clin Rheumatol 28, 5–15. [DOI] [PubMed] [Google Scholar]
- 3. Glyn‐Jones S, Palmer AJ, Agricola R, Price AJ, Vincent TL, Weinans H and Carr AJ (2015) Osteoarthritis. Lancet 386, 376–387. [DOI] [PubMed] [Google Scholar]
- 4. Buckwalter JA, Anderson DD, Brown TD, Tochigi Y and Martin JA (2013) The roles of mechanical stresses in the pathogenesis of osteoarthritis: implications for treatment of joint injuries. Cartilage 4, 286–294. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Arden N and Nevitt MC (2006) Osteoarthritis: epidemiology. Best Pract Res Clin Rheumatol 20, 3–25. [DOI] [PubMed] [Google Scholar]
- 6. Araki Y and Mimura T (2017) Matrix metalloproteinase gene activation resulting from Disordred epigenetic mechanisms in rheumatoid arthritis. Int J Mol Sci 18, 905. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Shen Y, Wei W and Zhou DX (2015) Histone acetylation enzymes coordinate metabolism and gene expression. Trends Plant Sci 20, 614–621. [DOI] [PubMed] [Google Scholar]
- 8. Sun Y and Qin B (2018) Long noncoding RNA MALAT1 regulates HDAC4‐mediated proliferation and apoptosis via decoying of miR‐140‐5p in osteosarcoma cells. Cancer Med 7, 4584–4597. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Zang WJ, Hu YL, Qian CY, Feng Y, Liu JZ, Yang JL, Huang H, Zhu YZ and Xue WJ (2022) HDAC4 promotes the growth and metastasis of gastric cancer via autophagic degradation of MEKK3. Br J Cancer 127, 237–248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Federspiel JD, Greco TM, Lum KK and Cristea IM (2019) Hdac4 interactions in Huntington's disease viewed through the prism of multiomics. Mol Cell Proteomics 18, S92–S113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Zhao J, Shen X, Cao X, He H, Han S, Chen Y, Cui C, Wei Y, Wang Y, Li D et al. (2020) HDAC4 regulates the proliferation, differentiation and apoptosis of chicken skeletal muscle satellite cells. Animals (Basel) 10, 84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Chen Z, Zhang Z, Guo L, Wei X, Zhang Y, Wang X and Wei L (2020) The role of histone deacetylase 4 during chondrocyte hypertrophy and endochondral bone development. Bone Joint Res 9, 82–89. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Gu XD, Wei L, Li PC, Che XD, Zhao RP, Han PF, Lu JG and Wei XC (2019) Adenovirus‐mediated transduction with histone deacetylase 4 ameliorates disease progression in an osteoarthritis rat model. Int Immunopharmacol 75, 105752. [DOI] [PubMed] [Google Scholar]
- 14. Li P, Wei X, Guan Y, Chen Q, Zhao T, Sun C and Wei L (2014) MicroRNA‐1 regulates chondrocyte phenotype by repressing histone deacetylase 4 during growth plate development. FASEB J 28, 3930–3941. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Kerr JF, Wyllie AH and Currie AR (1972) Apoptosis: a basic biological phenomenon with wide‐ranging implications in tissue kinetics. Br J Cancer 26, 239–257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Häcker G (2000) The morphology of apoptosis. Cell Tissue Res 301, 5–17. [DOI] [PubMed] [Google Scholar]
- 17. Thomas CM, Fuller CJ, Whittles CE and Sharif M (2011) Chondrocyte death by apoptosis is associated with the initiation and severity of articular cartilage degradation. Int J Rheum Dis 14, 191–198. [DOI] [PubMed] [Google Scholar]
- 18. Héraud F, Héraud A and Harmand MF (2000) Apoptosis in normal and osteoarthritic human articular cartilage. Ann Rheum Dis 59, 959–965. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Hwang HS and Kim HA (2015) Chondrocyte apoptosis in the pathogenesis of osteoarthritis. Int J Mol Sci 16, 26035–26054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Zhang P, Sun Q, Zhao C, Ling S, Li Q, Chang YZ and Li Y (2014) HDAC4 protects cells from ER stress induced apoptosis through interaction with ATF4. Cell Signal 26, 556–563. [DOI] [PubMed] [Google Scholar]
- 21. Gu X, Li F, Che X, Wei X and Li P (2024) HDAC4 represses ER stress induced chondrocyte apoptosis by inhibiting ATF4 and attenuates cartilage degeneration in an osteoarthritis rat model. BMC Musculoskelet Disord 25, 467. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Henry SP, Jang CW, Deng JM, Zhang Z, Behringer RR and de Crombrugghe B (2009) Generation of aggrecan‐CreERT2 knockin mice for inducible Cre activity in adult cartilage. Genesis 47, 805–814. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Vega RB, Matsuda K, Oh J, Barbosa AC, Yang X, Meadows E, McAnally J, Pomajzl C, Shelton JM, Richardson JA et al. (2004) Histone deacetylase 4 controls chondrocyte hypertrophy during skeletogenesis. Cell 119, 555–566. [DOI] [PubMed] [Google Scholar]
- 24. Dong Z, Ma Z, Yang M, Cong L, Zhao R, Cheng L, Sun J, Wang Y, Yang R, Wei X et al. (2022) The level of histone deacetylase 4 is associated with aging cartilage degeneration and chondrocyte hypertrophy. J Inflamm Res 15, 3547–3560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Maeda Y, Nakamura E, Nguyen MT, Suva LJ, Swain FL, Razzaque MS, Mackem S and Lanske B (2007) Indian hedgehog produced by postnatal chondrocytes is essential for maintaining a growth plate and trabecular bone. Proc Natl Acad Sci U S A 104, 6382–6387. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Babinet C (2000) Transgenic mice: an irreplaceable tool for the study of mammalian development and biology. J Am Soc Nephrol 11, S88–S94. [PubMed] [Google Scholar]
- 27. Feil R, Brocard J, Mascrez B, LeMeur M, Metzger D and Chambon P (1996) Ligand‐activated site‐specific recombination in mice. Proc Natl Acad Sci U S A 93, 10887–10890. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Kellendonk C, Tronche F, Casanova E, Anlag K, Opherk C and Schütz G (1999) Inducible site‐specific recombination in the brain. J Mol Biol 285, 175–182. [DOI] [PubMed] [Google Scholar]
- 29. Ji ML, Jiang H, Li Z, Geng R, Hu JZ, Lin YC and Lu J (2022) Sirt6 attenuates chondrocyte senescence and osteoarthritis progression. Nat Commun 13, 7658. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Glasson SS, Blanchet TJ and Morris EA (2007) The surgical destabilization of the medial meniscus (DMM) model of osteoarthritis in the 129/SvEv mouse. Osteoarthr Cartil 15, 1061–1069. [DOI] [PubMed] [Google Scholar]
- 31. Huang L, Li P, Guo L, Li L, Yuan J, Zhao R, Li H and Wei X (2022) Zinc finger protein 521 attenuates osteoarthritis via the histone deacetylases 4 in the nucleus. Bioengineered 13, 14489–14502. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 32. Li L, Wei X, Wang D, Lv Z, Geng X, Li P, Lu J, Wang K, Wang X, Sun J et al. (2020) Positive effects of a young systemic environment and high growth differentiation factor 11 levels on chondrocyte proliferation and cartilage matrix synthesis in old mice. Arthritis Rheumatol 72, 1123–1133. [DOI] [PubMed] [Google Scholar]
- 33. Glasson SS, Chambers MG, Van Den Berg WB and Little CB (2010) The OARSI histopathology initiative – recommendations for histological assessments of osteoarthritis in the mouse. Osteoarthr Cartil 18, S17–S23. [DOI] [PubMed] [Google Scholar]
- 34. Zamli Z and Sharif M (2011) Chondrocyte apoptosis: a cause or consequence of osteoarthritis? Int J Rheum Dis 14, 159–166. [DOI] [PubMed] [Google Scholar]
- 35. Fischle W, Kiermer V, Dequiedt F and Verdin E (2001) The emerging role of class II histone deacetylases. Biochem Cell Biol 79, 337–348. [PubMed] [Google Scholar]
- 36. Wang Z, Qin G and Zhao TC (2014) HDAC4: mechanism of regulation and biological functions. Epigenomics 6, 139–150. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Cao K, Wei L, Zhang Z, Guo L, Zhang C, Li Y, Sun C, Sun X, Wang S, Li P et al. (2014) Decreased histone deacetylase 4 is associated with human osteoarthritis cartilage degeneration by releasing histone deacetylase 4 inhibition of runt‐related transcription factor‐2 and increasing osteoarthritis‐related genes: a novel mechanism of human osteoarthritis cartilage degeneration. Arthritis Res Ther 16, 491. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Gu X, Li F, Gao Y, Che X and Li P (2022) HDAC4 mutant represses chondrocyte hypertrophy by locating in the nucleus and attenuates disease progression of posttraumatic osteoarthritis. BMC Musculoskelet Disord 23, 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Thomas CM, Fuller CJ, Whittles CE and Sharif M (2007) Chondrocyte death by apoptosis is associated with cartilage matrix degradation. Osteoarthr Cartil 15, 27–34. [DOI] [PubMed] [Google Scholar]
- 40. Sharif M, Whitehouse A, Sharman P, Perry M and Adams M (2004) Increased apoptosis in human osteoarthritic cartilage corresponds to reduced cell density and expression of caspase‐3. Arthritis Rheum 50, 507–515. [DOI] [PubMed] [Google Scholar]
- 41. Harding HP, Zhang Y, Zeng H, Novoa I, Lu PD, Calfon M, Sadri N, Yun C, Popko B, Paules R et al. (2003) An integrated stress response regulates amino acid metabolism and resistance to oxidative stress. Mol Cell 11, 619–633. [DOI] [PubMed] [Google Scholar]
- 42. Zinszner H, Kuroda M, Wang X, Batchvarova N, Lightfoot RT, Remotti H, Stevens JL and Ron D (1998) CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev 12, 982–995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Oyadomari S, Koizumi A, Takeda K, Gotoh T, Akira S, Araki E and Mori M (2002) Targeted disruption of the Chop gene delays endoplasmic reticulum stress‐mediated diabetes. J Clin Invest 109, 525–532. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Song B, Scheuner D, Ron D, Pennathur S and Kaufman RJ (2008) Chop deletion reduces oxidative stress, improves beta cell function, and promotes cell survival in multiple mouse models of diabetes. J Clin Invest 118, 3378–3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Tabas I and Ron D (2011) Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress. Nat Cell Biol 13, 184–190. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Han J, Back SH, Hur J, Lin YH, Gildersleeve R, Shan J, Yuan CL, Krokowski D, Wang S, Hatzoglou M et al. (2013) ER‐stress‐induced transcriptional regulation increases protein synthesis leading to cell death. Nat Cell Biol 15, 481–490. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Hickman‐Davis JM and Davis IC (2006) Transgenic mice. Paediatr Respir Rev 7, 49–53. [DOI] [PubMed] [Google Scholar]
- 48. Wold WS and Toth K (2013) Adenovirus vectors for gene therapy, vaccination and cancer gene therapy. Curr Gene Ther 13, 421–433. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Leikas AJ, Ylä‐Herttuala S and Hartikainen JEK (2023) Adenoviral gene therapy vectors in clinical use‐basic aspects with a special reference to replication‐competent adenovirus formation and its impact on clinical safety. Int J Mol Sci 24, 16519. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.
