Skip to main content
NCBI home page
Thoracic Cancer logoLink to Thoracic Cancer
. 2025 May 5;16(9):e70079. doi: 10.1111/1759-7714.70079

NAT10 Knockdown Improves Cisplatin Sensitivity in Non‐Small Cell Lung Cancer by Inhibiting the TRIM44/PI3K/AKT Pathway

Qi Sun 1, Xiansong Yang 2, Ye Wang 3, Kejia Yang 1, Yuan Weng 1,✉
PMCID: PMC12052513  PMID: 40324967

ABSTRACT

Background

Non‐small cell lung cancer (NSCLC) is a leading cause of cancer‐related deaths worldwide, and cisplatin (DDP) resistance remains a significant challenge in NSCLC treatment.

Methods

Quantitative reverse transcription polymerase chain reaction (qRT‐PCR) was used to analyze NAT10 and tripartite motif containing 44 (TRIM44) mRNA levels. Western blotting assay was used to detect protein expression. Cell viability was analyzed by a cell counting kit‐8 assay. Cell proliferation, apoptosis, invasion, and stem‐like traits were assessed using a 5‐Ethynyl‐2′‐deoxyuridineassay, flow cytometry, Transwell invasion assay, and sphere formation assay, respectively. The association between NAT10 and TRIM44 was identified by an RNA immunoprecipitation assay. A xenograft mouse model was established to evaluate the effect of NAT10 silencing on DDP sensitivity in vivo.

Results

NAT10 expression was upregulated in DDP‐resistant NSCLC tissues and cells. NAT10 knockdown enhanced DDP sensitivity in DDP‐resistant NSCLC cells, accompanied by decreased protein expression of multidrug resistance 1 (MDR1). The silencing of NAT10 also inhibited the proliferation, invasion, and stem‐like traits of DDP‐resistant NSCLC cells, while inducing cell apoptosis. However, NAT10 overexpression displayed the opposite effects. Moreover, NAT10 maintained TRIM44 mRNA stability in an ac4C‐dependent manner. TRIM44 overexpression reversed the NAT10 knockdown‐induced effects on DDP sensitivity and the malignant progression of NSCLC cells. In addition, NAT10 silencing inactivated the PI3K/AKT pathway by regulating TRIM44 in DDP‐resistant NSCLC cells. The treatment of the PI3K/AKT pathway inhibitor, LY294002, mitigated the effects of TRIM44 overexpression on DDP sensitivity and NSCLC cell progression. Further, NAT10 knockdown improved the sensitivity of tumors to DDP in vivo.

Conclusion

NAT10 knockdown improved DDP sensitivity in NSCLC by inhibiting the TRIM44/PI3K/AKT pathway, which may have significant clinical implications for overcoming DDP resistance in NSCLC treatment.

Keywords: DDP, NAT10, non‐small cell lung cancer, PI3K/AKT pathway, TRIM44

NAT10 expression is elevated in DDP‐resistant NSCLC cells. The enhanced expression of NAT10 leads to an increase in TRIM44 expression through an ac4C‐dependent mechanism, which subsequently activates the PI3K/AKT pathway. This activation, in turn, reduces the sensitivity of NSCLC cells to DDP, inhibits apoptosis, and fosters cell proliferation, invasion, and sphere formation.

graphic file with name TCA-16-e70079-g004.jpg

1. Introduction

The persistently high mortality rate associated with lung cancer continues to pose a significant challenge within the sphere of global public health [1]. Non‐small cell lung cancer (NSCLC) is the most common pathological type and poses significant difficulties in treatment and maintains a high fatality rate [2, 3]. Immunotherapy and targeted therapy, owing to their precision and effectiveness, have gained widespread application and recognition in clinical practice [4]. Nevertheless, for patients with advanced NSCLC, platinum‐based chemotherapy remains one of the more effective treatment options [5, 6]. However, in recent years, the emerging issue of platinum resistance has become one of the primary reasons for treatment failure and high mortality rates in NSCLC [5]. Therefore, delving deeper into the mechanisms of platinum resistance holds significant importance for overcoming resistance and enhancing the treatment outcomes for NSCLC patients.

N4‐acetylcytidine (ac4C), a distinctive mRNA modification, is crucial in modulating mRNA stability and enhancing translation efficiency [7]. N‐acetyltransferase 10 (NAT10) is characterized by a complex structure comprising 1025 amino acids, which underscores the multifaceted and intricate nature of its functional repertoire [8]. NAT10 is presently the sole identified enzyme equipped with the ability to catalyze the ac4C RNA modification, and it also acts as a precise regulator influencing RNA stability and translation efficiency [9]. Previous evidence has indicated that NAT10 contributes to the proliferation, invasion, and migration of NSCLC cells [10]. In addition, NAT10‐induced upregulation of growth arrest‐specific 5 (GAS5) contributed to immune cell infiltration in NSCLC [11]. Moreover, NAT10 promoted glycolysis and inhibited cell apoptosis by regulating α‐enolase (ENO1) in NSCLC cells [12]. Previous evidence also demonstrated that its overexpression conferred platinum resistance in breast cancer [13]. However, there is no data regarding its regulation in the sensitivity of DDP in NSCLC.

Tripartite motif containing 44 (TRIM44), as a member of the TRIM family, lacks the typically located N‐terminal ring finger domain but retains the crucial zinc finger domain. This unique structure allows TRIM44 to occupy a niche within ubiquitin hydrolases and ubiquitin‐specific proteases [14]. Therefore, as a member of the “USP‐like‐TRIM” family, TRIM44 possesses deubiquitinating enzyme activity, which enables it to specifically remove ubiquitin chains from target proteins, thereby inhibiting their ubiquitination‐mediated degradation process. An increasing body of research data reveals that TRIM44 can promote cancer cell proliferation, enhance migration and invasion capabilities, as well as induce drug resistance [15, 16]. In lung cancer progression, it has been reported that TRIM44 promotes tumor cell migration and invasion by activating NF‐κB signaling [17]. It also promoted the migration and invasion of lung cancer cells through the circRNA_0020123/miR‐384/TRIM44 axis [18]. In particular, exciting evidence has shown that TRIM44 contributes to DDP resistance in inhibiting lung cancer progression by deubiquitinating filamin A [19].

We predicted the presence of ac4C modification sites in TRIM44 using the PACES website. Consequently, we hypothesized that NAT10 stabilized TRIM44 mRNA expression through ac4C modification, thereby modulating the sensitivity of NSCLC cells to DDP and influencing tumor progression. This hypothesis was investigated in this study, with the aim of developing strategies to overcome resistance in DDP‐resistant NSCLC.

2. Materials and Methods

2.1. Clinical Samples

DDP‐resistant NSCLC tissues (N = 35) and DDP‐sensitive NSCLC tissues (N = 35) used for analysis in this project were collected from NSCLC patients at the Affiliated Hospital of Jiangnan University. Specimens were collected only after obtaining informed consent from the patients. The related clinical trials involved in this study had been approved by the Ethics Committee of the Affiliated Hospital of Jiangnan University.

2.2. Cell Culture

Human bronchial epithelioid cells (HBE, Procell), NSCLC cells (H1299 and A549), and DDP‐resistant A549 cells (A549/DDP) were purchased from Procell (Beijing, China). DDP‐resistant H1299 cells (H1299/DDP) were provided by BioVector Science Lab, Lnc (Beijing, China). HBE cells were cultured in DMEM, A549 cells were maintained in F12K medium, whereas other types of cells were cultured in RPMI‐1640 medium (Procell), with these media added with 10% fetal bovine serum (Yuanye Bio‐Technology, Shanghai, China) and 1% penicillin/streptomycin (Khayal Bio‐Technology, Wuhan, China). The incubator was buffered with 5% CO2, and the temperature was set to 37°C. In addition, DDP‐resistant NSCLC cells were cultured in a medium added with 1 μg/mL DDP (Abace Biology, Beijing, China) to maintain their resistance.

2.3. Cell Transfection

The small interfering RNA targeting NAT10 (si‐NAT10), NAT10 overexpression plasmid (OE‐NAT10), TRIM44 overexpression plasmid (OE‐TRIM44), and the matched controls (si‐NC and OE‐NC) were provided by GenePharma (Shanghai, China). Transfection was performed when the cell density reached 50%–70%. Lipofectamine 3000 reagent (Thermo Fisher, Waltham, MA, USA), si‐NAT10, si‐NC, OE‐TRIM44, and OE‐NC were diluted in serum‐free medium and incubated for 5 min. The diluted liposome solution was mixed thoroughly with the transfection reagent solution and incubated for 20 min before being added to the 6‐well plates. After 6 h of culture in an incubator, the medium was replaced with a medium containing 10% fetal bovine serum for continued culture for 24–72 h.

2.4. Quantitative Real‐Time Polymerase Chain Reaction (qRT‐PCR)

TRIpure (BioTeke, Beijing, China) was added to the cell and tissue samples for RNA extraction. The concentration and purity of total RNA were measured using a Nanodrop instrument, and qualified samples were placed on ice for later use. The RNA samples were mixed with dNTPs Mix (Invitrogen, Carlsbad, CA, USA) and RNase‐free water. Then, SuperScript III RT (Invitrogen) was added, and the mixture was incubated. The resulting cDNA product was diluted and mixed with Master Mix (CloudSeq, Shanghai, China) and primers (Tsingke, Beijing, China). The qRT‐PCR reaction program was set up according to the Master Mix instructions to analyze the samples. The CT values from the qRT‐PCR reaction were exported, and the 2−∆∆Ct method was used for analysis. NAT10 5′‐TTTCGGAGTTGTTCCGTGCT‐3′ and 5′‐CTTCCGGTGACTGCGCC‐′, TRIM44 5′‐ACTGAAGGCCGCTATGATCG‐3′ and 5′‐TCACATGAGCTGTGGCCATT‐3′, GAPDH 5′‐AATGGGCAGCCGTTAGGAAA‐3′ and 5′‐GCGCCCAATACGACCAAATC‐3′.

2.5. Western Blotting Assay

Cells were collected after trypsin digestion, and tissue samples were cut into small pieces and treated with RIPA solution (Beyotime, Shanghai, China). After centrifugation, the supernatant was carefully transferred to pre‐cooled EP tubes. Protein samples and markers were carefully loaded into gel wells for electrophoresis. The electrophoretic transfer was performed for 55 min at a constant voltage of 100 V in an ice bath. PVDF membranes were fully immersed in non‐fat milk and incubated on a shaker for 2 h for blocking. The membranes were incubated with the primary antibody against NAT10 (ab194297, Abcam, Cambridge, MA, USA), multidrug resistance 1 (MDR1, ab168337, Abcam), TRIM44 (ab236422, Abcam), phosphorylated phosphoinositide 3‐kinase (p‐PI3K, 17 366T, CST, Shanghai, China), PI3K (4249T, CST), phosphorylated protein kinase B (p‐AKT, 4060T, CST), AKT (9272S, CST), or GAPDH (ab181602, Abcam), followed by immersion of the PVDF membranes into the secondary antibody dilution solution for 1 h. ECL developing solution (Beyotime) was added dropwise for protein visualization.

2.6. Cell Counting Kit‐8 (CCK‐8) Assay

Cells were collected, routinely digested with trypsin (Solarbio, Beijing, China), and prepared into cell suspensions with a complete medium. After cell counting, they were seeded into 96‐well plates and placed in an incubator for continued culture. After 24, 48, and 72 h of culture, the original medium in each well was discarded, and CCK‐8 reagent (Solarbio) was added before placing the plates back in the incubator for an additional 1 h of culture. The absorbance was measured at 450 nm. To analyze its 50% inhibitory concentration (IC50), DDP (2, 4, 8, 16, 32, 64, and 128 μM, Abace Biology) was added to the culture wells before adding CCK‐8, and the cells were cultured for 24 h. The cell viability was then analyzed using the aforementioned method.

2.7. 5‐Ethynyl‐2′‐Deoxyuridine (EdU) Assay

Cells were transfected or treated with DDP, and EdU medium (Ribobio, Guangzhou, China) was added to each well for a 2‐h incubation. Cell fixation solution was added to each well and incubated for 30 min. A glycine solution (Ybiotech, Shanghai, China) and TritonX‐100 (Solarbio) were added to each well, and the shaker was used for decolorization incubation for 10 min. Apollo staining reaction solution (Ribobio) was added to each well and incubated for 30 min. DAPI solution (Ybiotech) was incubated with the cells for 30 min. Fluorescence microscopy was used for detection immediately after staining was completed. The EdU positive (EdU+) cells were regarded as the proliferative cells, and the percentage of proliferative cells was calculated as follows: the number of EdU+ cells divided by the number of 4′,6‐Diamidino‐2‐Phenylindole (DAPI)+ cells.

2.8. Flow Cytometry Analysis

Cells from each group were collected, made into a cell suspension, and seeded into 6‐well plates. After transfection or DDP treatment, the cells from each group were digested with trypsin without EDTA (Solarbio). Annexin V buffer (Solarbio) was added to each tube, followed by the addition of Annexin V‐FITC (Solarbio). Then, propidium iodide staining solution (Solarbio) was added to each tube. Flow cytometry was used for immediate detection.

2.9. Transwell Invasion Assay

Matrigel matrix (Abwbio, Shanghai, China) was diluted with serum‐free culture medium (Matrigel matrix:culture medium = 1:4) and applied to the bottom membrane of the upper chambers of the Transwell inserts (Corning, Madison, New York, USA). The inserts were then placed in an incubator and allowed to sit for 5 h. Cells from each group were collected and added to the upper chambers. Meanwhile, complete culture medium containing 10% serum was added to the lower chambers. The system was then placed back in the incubator and cultured for an additional 48 h. 4% paraformaldehyde (Solarbio) was added to the upper chambers to fix the cells. The cells were stained with 1% crystal violet (Solarbio) for 30 min and observed under an inverted microscope for cells that had penetrated the membrane.

2.10. Sphere Formation Assay

RPMI‐1640 medium (Procell) containing cell spheroid formation (with 200 μL B27, 1 μg EGF, 1 μg bFGF) was added to low‐adhesion six‐well plates. After cell treatment, the cells were collected and then resuspended in serum‐free RPMI‐1640. The cells were seeded into the low‐adhesion six‐well plates and placed in an incubator for culture. After approximately 14 days of culture, the ability of tumor cells to form spheroids was observed under a microscope. Sphere efficiency was determined by calculating the ratio of the number of spheres formed to the original number of cells. The spheres with more than 50 μm were included.

2.11. Acetylated RNA Immunoprecipitation (acRIP) Assay

AcRIP analysis was performed on DDP‐resistant cells transfected with si‐NAT10 or si‐NC. Total RNA was extracted and randomly digested into nucleotide chains of 100–200 nt. After RNA was incubated at 70°C for 6 min, EDTA was immediately added to terminate the reaction. The mixture of ac4C (ab252215, Abcam) or IgG antibody (ab172730, Abcam) and magnetic beads (Millipore, Billerica, MA, USA) was incubated with the RNA. After RNA purification, qRT‐PCR was used for TRIM44 mRNA analysis.

2.12. RIP Assay

The assay was performed on DDP‐resistant cells with the Magna RIP assay kit (17–700, Millipore). The NAT10 antibody (ab194297, Abcam) or IgG antibody (ab172730, Abcam) was incubated with the magnetic beads in advance. The mixtures were then subjected to incubation with cell lysates. After RNA purification, qRT‐PCR was used for TRIM44 mRNA analysis.

2.13. Actinomycin D Assay

A549/DDP and H1299/DDP cells were seeded into 6‐well plates and transfected with si‐NAT10 or si‐NC, followed by culture in a cell incubator for 24 h. Actinomycin D (2 μg/mL, Abcam) was prepared, and the cells were cultured in the incubator according to a time gradient (0 h, 3 h, and 6 h). The cells were collected, and total RNA was extracted for qRT‐PCR analysis of TRIM44 mRNA expression.

2.14. Xenograft Mouse Model Assay

Male nude mice (5 weeks of age, N = 20) were purchased from Hunan Slyke Jingda Experimental Animal Co., LTD (Changsha, China). A549/DDP cells stably expressing sh‐NC or sh‐NAT10 were diluted with PBS and adjusted to a cell density of 1 × 107 cells/200 μL. The cell suspension (200 μL) was injected subcutaneously into the upper part of the inguinal area of nude mice. These mice were raised under SPF conditions. On the eighth day after inoculation, DDP (3 mg/kg, Abace Biology) was intravenously injected once a week. The longest and shortest diameters of the subcutaneous tumors in mice were measured every 5 days to analyze the tumor volume. After 28 days, the mice were anesthetized with an overdose of pentobarbital sodium (40 mg/kg, Lianshuo Biotech, Shanghai, China) for euthanasia. The transplanted tumors were excised and photographed. The study was approved by the Animal Care and Use Committee of Affiliated Hospital of Jiangnan University.

2.15. Immunohistochemistry (IHC) Assay

The positive expression rates of NAT10 and TRIM44 in the transplanted tumors were analyzed using anti‐NAT10 (ab194297, Abcam) and anti‐TRIM44 (ab236422, Abcam) according to the IHC assay kit (ENS004.120, Neobioscience, Shenzhen, China) guidebook. A positive result was indicated by a brown staining at the antigen localization site.

2.16. Statistical Analysis

Statistical analysis was performed using GraphPad Prism 8.0 software. All data that followed a normal distribution were expressed as mean ± standard deviation. The comparison of means between two samples was conducted using the t‐test, while the comparison of means among multiple groups was performed with analysis of variance (ANOVA). p < 0.05 was considered statistically significant.

3. Results

3.1. NAT10 Expression Was Upregulated in DDP‐Resistant NSCLC Tissues and Cells

We analyzed NAT10 expression through the TCGA, CPTAC, and TNMplot databases. As shown in Figure 1A–C, compared with normal lung tissues, the expression of NAT10 was significantly upregulated in NSCLC tissues. Subsequently, in comparison with the DDP‐sensitive NSCLC tissues, its expression at mRNA and protein levels was increased in DDP‐resistant NSCLC tissues (Figure 1D,E). We also analyzed NAT10 expression in DDP‐resistant NSCLC cells (H1299/DDP and A549/DDP). The results in Figure 1F revealed that the IC50 values of H1299/DDP and A549/DDP cells were higher than that of NSCLC cells (H1299 and A549), indicating the H1299/DDP and A549/DDP cells were resistant to DDP. As shown in Figure 1G, NAT10 protein expression was higher in H1299 and A549 cells than in HBE cells and was the highest in DDP‐resistant H1299 and A549 cells compared to H1299 and A549 cells. These data demonstrated that NAT10 expression was upregulated in DDP‐resistant NSCLC tissues and cells.

FIGURE 1.

FIGURE 1

Open in a new tab

NAT10 expression was upregulated in DDP‐resistant NSCLC tissues and cells. (A–C) NAT10 expression was analyzed through the TCGA, CPTAC and TNMplot databases. (D and E) NAT10 expression at mRNA and protein levels was analyzed by qRT‐PCR and western blotting assay, respectively, in DDP‐resistant NSCLC tissues and DDP‐sensitivity NSCLC tissues. (F) CCK‐8 assay was performed to detect the IC50 value of DDP in H1299 cells, H1299/DDP cells, A549 cells and A549/DDP cells (N = 3). (G) Western blotting assay was performed to analyze NAT10 protein expression in HBE cells, H1299 cells, H1299/DDP cells, A549 cells and A549/DDP cells (N = 3). *p < 0.05, **p < 0.01, and ***p < 0.001.

3.2. NAT10 Inhibited DDP Sensitivity and Promoted the Malignant Phenotypes of H1299/DDP and A549/DDP Cells

We then analyzed the effect of NAT10 silencing on the sensitivity of DDP‐resistant NSCLC cells to DDP. To achieve this, we transfected NAT10 siRNA (si‐NAT10) and the matched control si‐NC into H1299/DDP and A549/DDP cells. As shown in Figure 2A, the si‐NAT10 treatment effectively reduced the expression of the NAT10 protein, exhibiting a high degree of efficiency. Subsequently, the result showed that NAT10 knockdown decreased the IC50 value of DDP and inhibited the protein expression of multidrug resistance 1 (MDR1) in the cells (Figure 2B,C). Moreover, NAT10 silencing reduced the OD value and the number of EdU‐positive cells (Figure 2D–F), indicating the inhibitory effect of NAT10 knockdown on cell proliferation. In addition, NAT10 knockdown induced apoptosis and inhibited the invasion of H1299/DDP and A549/DDP cells (Figure 2G–I). Moreover, the sphere formation efficiency of H1299/DDP and A549/DDP cells was inhibited after NAT10 knockdown (Figure 2J). We also analyzed the effects of NAT10 overexpression on DDP sensitivity and the malignant phenotypes of NSCLC cells. The results showed that the transfection of the NAT10 overexpression plasmid led to the upregulation of NAT10 expression (Figure S1A). In addition, NAT10 overexpression increased the IC50 value of DDP and promoted MRD1 protein expression (Figure S1B,C). As shown in Figure S1D–J, NAT10 overexpression promoted cell proliferation, inhibited cell apoptosis, promoted cell invasion, and improved sphere formation efficiency. Thus, these data suggested that NAT10 inhibited DDP sensitivity and promoted the malignant progression of NSCLC cells.

FIGURE 2.

FIGURE 2

Open in a new tab

NAT10 knockdown improved DDP sensitivity and inhibited the malignant phenotypes of H1299/DDP and A549/DDP cells. H1299/DDP and A549/DDP cells were divided into the si‐NAT10 group and the si‐NC group. (A) NAT10 protein expression was analyzed by western blotting assay (N = 3). (B) The IC50 value of DDP was analyzed by CCK‐8 assay (N = 3). (C) MDR1 protein expression was assessed by western blotting assay (N = 3). (D–F) Cell proliferation was analyzed by CCK‐8 and EdU assays (N = 3). (G and H) Flow cytometry was performed to analyze cell apoptosis (N = 3). (I) Transwell invasion assay was performed to analyze cell invasion (N = 3). (J) Sphere formation assay was performed to analyze the stem‐like traits of H1299/DDP and A549/DDP cells (N = 3). *p < 0.05, **p < 0.01, and ***p < 0.001.

3.3. NAT10 Maintained TRIM44 mRNA Stability in an ac4C‐Dependent Manner

Through the prediction of the TCGA database, we discovered that four genes were most significantly correlated with NAT10 expression in NSCLC, including CAPRIN1, QSER1, NUP98, and TRIM44 (Figure S2). However, only TRIM44 promoted lung cancer progression and contained ac4C modification sites. Thus, TRIM44 was employed for the study. Through the analysis of the TCGA, ENCORI, and GEPIA database, we discovered that NAT10 had a positive correlation with TRIM44 expression in lung cancer tissues (Figure 3A–C). The qRT‐PCR analysis revealed that TRIM44 mRNA expression was higher in DDP‐resistant NSCLC tissues than in DDP‐sensitive NSCLC tissues (Figure 3D). Moreover, the result showed a positive correlation between TRIM44 expression and NAT10 expression in DDP‐resistant NSCLC tissues (Figure 3E). Through the prediction of the PACES website, we discovered that TRIM44 had ac4C modification sites (Figure 3F). As shown in Figure 3G,H, the ac4C antibody significantly enriched TRIM44, whereas the effect was weakened after NAT10 silencing in H1299/DDP and A549/DDP cells. Comparatively, the RIP assay revealed that TRIM44 expression was higher in the NAT10 antibody group than in the IgG antibody group (Figure 3I). The result also showed that NAT10 knockdown shortened the transcript half‐life of TRIM44 mRNA in H1299/DDP and A549/DDP cells (Figure 3J,K). Further, the data presented that the mRNA and protein expression of TRIM44 were inhibited after NAT10 silencing in H1299/DDP and A549/DDP cells (Figure 3L,M). Thus, NAT10 upregulated TRIM44 expression through the ac4C modification.

FIGURE 3.

FIGURE 3

Open in a new tab

NAT10 maintained TRIM44 mRNA stability in an ac4C‐dependent manner. (A‐C) The TCGA, ENCORI and GEPIA databases were used to analyze the correlation of NAT10 and TRIM44 expression in lung cancer tissues. (D) TRIM44 mRNA expression was detected by qRT‐PCR in DDP‐resistant NSCLC tissues and DDP‐sensitive NSCLC tissues. (E) The correlation of NAT10 and TRIM44 expression was subjected to Pearson correlation analysis in DDP‐resistant NSCLC tissues. (F) Analysis of ac4C modification sites in TRIM44 mRNA through the PACES website. (G–I) The RIP assay was performed to identify the association of NAT10 and TRIM44 in H1299/DDP and A549/DDP cells (N = 3). (J and K) Analysis of TRIM44 mRNA stability through the Actinomycin D assay in H1299/DDP and A549/DDP cells transfected with si‐NC or si‐NAT10 (N = 3). (L and M) The effect of NAT10 knockdown on TRIM44 expression was analyzed by qRT‐PCR and western blotting assays in H1299/DDP and A549/DDP cells (N = 3). **p < 0.01 and ***p < 0.001.

3.4. TRIM44 Overexpression Attenuated NAT10 Knockdown‐Induced Effects in H1299/DDP and A549/DDP Cells

We continued to analyze the association of NAT10 and TRIM44 in regulating DDP sensitivity and the malignant progression of NSCLC cells. To end this, we transfected NAT10 siRNA, TRIM44 overexpression plasmid, and/or the matched control (si‐NC) into H1299/DDP and A549/DDP cells. The transfection with TRIM44 overexpression plasmid led to increases in TRIM44 expression (Figure 4A). Subsequently, NAT10 knockdown decreased the IC50 value of DDP and inhibited the protein expression of MDR1 in the cells, whereas the effects were relieved after TRIM44 overexpression (Figure 4B,C). NAT10 silencing inhibited cell proliferation, induced cell apoptosis, and suppressed cell invasion, but these effects were counteracted after TRIM44 overexpression (Figure 4D–H). Moreover, ectopic TRIM44 expression attenuated the decreased sphere formation efficiency of H1299/DDP and A549/DDP cells induced by NAT10 knockdown (Figure 4I). Thus, NAT10 knockdown improved DDP sensitivity and inhibited the malignant phenotypes of NSCLC cells by regulating TRIM44.

FIGURE 4.

FIGURE 4

Open in a new tab

TRIM44 overexpression attenuated NAT10 knockdown‐induced effects in H1299/DDP and A549/DDP cells. (A) The efficiency of TRIM44 overexpression was analyzed by western blotting assay in H1299/DDP and A549/DDP cells (N = 3). (B–I) H1299/DDP and A549/DDP cells were divided into the si‐NC group, the si‐NAT10 group, and the si‐NAT10 + OE‐TRIM44 group. (B) The IC50 value of DDP was analyzed by CCK‐8 assay (N = 3). (C) MDR1 protein expression was assessed by western blotting assay (N = 3). (D–F) Cell proliferation was analyzed by CCK‐8 and EdU assays (N = 3). (G) Flow cytometry was performed to analyze cell apoptosis (N = 3). (H) Transwell invasion assay was performed to analyze cell invasion (N = 3). (I) Sphere formation assay was performed to analyze the stem‐like traits of H1299/DDP and A549/DDP cells (N = 3). **p < 0.01 and ***p < 0.001.

3.5. NAT10 Silencing Inactivated the PI3K/AKT Pathway by Regulating TRIM44 in H1299/DDP and A549/DDP Cells

The activation of the PI3K/AKT pathway leads to increased DDP resistance and the malignant progression of NSCLC [20, 21]. We then analyzed the association of the NAT10/TRIM44 axis with the PI3K/AKT pathway in H1299/DDP and A549/DDP cells. The result showed that NAT10 silencing decreased the ratios of p‐PI3K to PI3K and p‐AKT to AKT; however, these effects were relieved after TRIM44 overexpression (Figure 5A,B). Thus, NAT10 knockdown induced the inactivation of the PI3K/AKT pathway by regulating TRIM44 in H1299/DDP and A549/DDP cells.

FIGURE 5.

FIGURE 5

Open in a new tab

NAT10 silencing inactivated the PI3K/AKT pathway by regulating TRIM44 in H1299/DDP and A549/DDP cells. (A and B) The effects of NAT10 knockdown and TRIM44 overexpression on the protein expression of p‐PI3K, PI3K, p‐AKT and AKT were analyzed by western blotting assay in H1299/DDP and A549/DDP cells (N = 3). *p < 0.05, **p < 0.01, and ***p < 0.001.

3.6. LY294002 Treatment Counteracted TRIM44 Overexpression‐Induced Effects on DDP Sensitivity and the Malignant Progression of NSCLC Cells

We subsequently transfected TRIM44 overexpression plasmid and the matched control (OE‐NC) into H1299/DDP and A549/DDP cells, followed by the treatment of LY294002, an inhibitor of the PI3K/AKT pathway. The results showed that TRIM44 overexpression increased the IC50 value of DDP and promoted the protein expression of MDR1 in the cells, whereas these effects were relieved after LY294002 treatment (Figure 6A,B). Ectopic TRIM44 expression promoted cell proliferation and invasion and inhibited cell apoptosis, but these effects were counteracted after LY294002 treatment (Figure 4C–G). Moreover, the LY294002 treatment also attenuated the increased sphere formation efficiency of H1299/DDP and A549/DDP cells induced by TRIM44 overexpression (Figure 4H). Thus, TRIM44 overexpression inhibited DDP sensitivity and promoted the malignant progression of NSCLC cells by regulating the PI3K/AKT pathway.

FIGURE 6.

FIGURE 6

Open in a new tab

LY294002 treatment counteracted TRIM44 overexpression‐induced effects on DDP sensitivity and the malignant progression of NSCLC cells. H1299/DDP and A549/DDP cells were divided into the OE‐NC group, the OE‐TRIM44 group, and the OE‐TRIM44 + LY294002 group. (A) The IC50 value of DDP was analyzed by CCK‐8 assay (N = 3). (B) MDR1 protein expression was assessed by western blotting assay (N = 3). (C–E) Cell proliferation was analyzed by CCK‐8 and EdU assays (N = 3). (F) Flow cytometry was performed to analyze cell apoptosis (N = 3). (G) Transwell invasion assay was performed to analyze cell invasion (N = 3). (H) Sphere formation assay was performed to analyze the stem‐like traits of H1299/DDP and A549/DDP cells (N = 3). *p < 0.05, **p < 0.01, and ***p < 0.001.

3.7. NAT10 Knockdown Improved DDP Sensitivity in Inhibiting Tumor Progression In Vivo

A xenograft mouse model was established using A549/DDP cells transfected with lentivirus encoding NAT10 shRNA or control lentivirus to validate the in vitro data regarding the effect of NAT10 silencing on DDP sensitivity. The results showed that DDP treatment inhibited tumor growth, including decreased tumor volume and weight, and these effects were enhanced after combination treatment of DDP and NAT10 shRNA (Figure 7A,B). Moreover, DDP treatment promoted the protein expression of NAT10 and TRIM44 in the tumor tissues resulting from A549/DDP cells; however, these effects were attenuated after combination treatment of DDP and NAT10 shRNA (Figure 7C,D). The effects of NAT10 and DDP on the protein expression of NAT10 and TRIM44 in the tumor tissues resulting from A549/DDP cells were also confirmed by IHC assay (Figure 7E). Thus, NAT10 knockdown improved the sensitivity of tumors to DDP in vivo.

FIGURE 7.

FIGURE 7

Open in a new tab

NAT10 knockdown improved DDP sensitivity and inhibited tumor formation in vivo. Nude mice were injected with A549/DDP cells transfected with lentivirus encoding NAT10 shRNA or control lentivirus, followed by DDP or PBS treatment. (A) Tumor volume was analyzed every 5 days for 4 cycles since DDP or PBS treatment. (B) The weight of tumors in each group was analyzed after 28 days of lentivirus injection. (C and D) The protein expression of NAT10 and TRIM44 was analyzed by western blotting assay in the tumors resulting from A549/DDP cells (N = 5). (E) The positive expression of NAT10 and TRIM44 was assessed by the IHC assay in the tumors resulting from A549/DDP cells (N = 5). *p < 0.05, **p < 0.01, and ***p < 0.001.

4. Discussion

Chemotherapy is a crucial treatment modality for NSCLC patients requiring systemic therapy at various stages. The introduction of chemotherapy has led to an increase in the 5‐year survival rate by 5%–15% [22]. In particular, DDP‐based chemotherapy regimens have been widely recognized as the standard first‐line treatment [23]. However, many NSCLC patients ultimately succumb to disease recurrence and progression due to the development of resistance to DDP [24]. To more effectively combat this resistance, we need to delve into the mechanisms of DDP resistance in NSCLC to improve the response rate and survival rate of NSCLC patients to DDP treatment. We showed that NAT10 silencing decreased TRIM44 expression to improve DDP sensitivity in NSCLC by inhibiting the PI3K/AKT pathway.

NAT10 exerts an important role in cancer progression. For example, NAT10 interacted with chloride intracellular channel 3 (CLIC3) to promote bladder cancer cell proliferation by reducing p21 expression [25]. In addition, NAT10 activated to promote ac4C modification of FOXP1 mRNA, further exerting an oncogenic role in initiating crosstalk between cervical cancer cell glycolysis and immunosuppression [26]. NAT10 has also been associated with the progression of lung cancer and the development of resistance to DDP. High NAT10 expression was associated with a poor survival rate of NSCLC patients, and its silencing inhibited tumor cell invasion through the epithelial‐mesenchymal transition pathway [10]. In addition, NAT10 was overexpressed in NSCLC, and its upregulation induced tumor cell proliferation and migration by interacting with c‐myc [27]. These data showed its cancer‐promoting effect on NSCLC development. As reported by Liu et al., DDP treatment transcriptionally activated NAT10, and the increased NAT10 expression increased the number of DDP‐treated cells [28]. Xie et al. also reported that NAT10 enhanced ac4C‐associated DNA repair of AHNAK nucleoprotein to confer DDP resistance in bladder cancer [29]. Thus, NAT10 is responsible for the development of DDP resistance. Based on the above evidence, we explored the role of NAT10 in regulating the sensitivity of DDP in inhibiting NSCLC progression. The results showed that NAT10 expression was upregulated in DDP‐resistant NSCLC tissues and cells. Its silencing improved DDP sensitivity, inhibited the proliferation, invasion, and stem‐like traits of NSCLC cells, and induced cell apoptosis. However, NAT10 expression displayed the opposite effects. Additionally, the reduction of NAT10 expression significantly increased the sensitivity of tumors derived from DDP‐resistant NSCLC cells to DDP treatment. NAT10 silencing also led to a reduction in the values of p‐PI3K/PI3K and p‐AKT/AKT. Thus, NAT10 silencing displayed therapeutic promise in the treatment of NSCLC.

The progression of lung cancer involves the regulation of TRIM44. Ma et al. pointed out that TRIM44 expression was enhanced in NSCLC tissues and cells, and its increased expression induced the migration and invasion of NSCLC cells and inhibited cell apoptosis through the circ_0020123/miR‐384/TRIM44 pathway [18]. In addition, it was reported that TRIM44 promoted lung cancer cell metastasis through the NF‐κB and mTOR signaling pathways [17, 30]. We explored its effect on the regulation of NAT10 in DDP resistance in NSCLC. We discovered its high expression and positive correlation with TRIM44 in DDP‐resistant NSCLC cells. NAT10 silencing inhibited TRIM44 expression in tumor tissues and DDP‐resistant NSCLC cells. In addition, NAT10 maintained its mRNA stability through the ac4C modification. TRIM44 overexpression also relieved NAT10 silencing‐induced effects on the malignant progression of NSCLC cells. Overexpression of TRIM44 was capable of reverting the effects induced by NAT10 silencing due to the following reason: the reduction in NAT10 levels resulted in a decrease in the cellular expression of TRIM44. The introduction of a TRIM44 overexpression plasmid, however, mitigated this effect by restoring TRIM44 expression to levels that counterbalance the reduction induced by NAT10 silencing. Follow‐up studies revealed that overexpression of TRIM44 mitigated the enhanced sensitivity to DDP induced by NAT10 knockdown, suggesting a promotional role of TRIM44 in the development of DDP resistance. This finding was supported by data from the study conducted by Zhang et al. [19]. In terms of mechanism, TRIM44 conferred resistance to DDP in BRCA1‐ and FLNA‐dependent manners [19]. Our study showed that TRIM44 activated the PI3K/AKT pathway to confer DDP resistance in NSCLC. It has been reported that the PI3K/AKT pathway promotes β‐catenin transfer to the nucleus by activating glycogen synthase kinase‐3β, thus upregulating MDR‐related target genes [31]. The pathway also increased the expression of ABC transporters to enhance DDP efflux and resistance [32, 33]. Thus, the TRIM44/PI3K/AKT pathway was required for the regulation of NAT10 in the resistance of NSCLC to DDP.

However, the study was based primarily on in vitro and in vivo models. Further validation in a larger cohort of patients with NSCLC is necessary to confirm the clinical relevance of these findings. In addition, NAT10 silencing leads to a reduction in the phosphorylation of PI3K and AKT. The rationale behind this observation is unclear and requires further explanation. This could include studies on the direct interactions between NAT10 and components of the PI3K/AKT pathway, the effects of NAT10 silencing on the expression and activity of PI3K and AKT, and the role of NAT10 in the regulation of gene expression and protein synthesis related to these kinases.

Taken together, NAT10 knockdown in NSCLC cells increased sensitivity to DDP. This effect was attributed to the downregulation of the TRIM44/PI3K/AKT pathway. We not only identify NAT10 as a key player in DDP resistance mechanisms in NSCLC but also highlight the TRIM44/PI3K/AKT pathway as a potential therapeutic target. This discovery opens up novel strategies for enhancing treatment efficacy and improving the prognosis for DDP‐resistant NSCLC patients.

Author Contributions

Conceptualization and methodology: Xiansong Yang and Ye Wang. Formal analysis and data curation: Ye Wang, Qi Sun, and Kejia Yang. Validation and investigation: Kejia Yang and Yuan Weng. Writing – original draft preparation and writing – review and editing: Qi Sun, Xiansong Yang, and Ye Wang. Approval of final manuscript: all authors.

Ethics Statement

The present study was approved by the ethical review committee of Affiliated Hospital of Jiangnan University. Written informed consent was obtained from all enrolled patients.

Consent

Patients agree to participate in this work.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

FIGURE S1. NAT10 inhibited DDP sensitivity and promoted the malignant phenotypes of H1299/DDP and A549/DDP cells. H1299/DDP and A549/DDP cells were divided into the OE‐NC group and the OE‐NAT10 group. (A) NAT10 protein expression was analyzed by western blotting assay (N = 3). (B) The IC50 value of DDP was analyzed by CCK‐8 assay (N = 3). (C) MDR1 protein expression was assessed by western blotting assay (N = 3). (D–F) Cell proliferation was analyzed by CCK‐8 and EdU assays (N = 3). (G and H) Flow cytometry was performed to analyze cell apoptosis (N = 3). (I) Transwell invasion assay was performed to analyze cell invasion (N = 3). (J) Sphere formation assay was performed to analyze the stem‐like traits of H1299/DDP and A549/DDP cells (N = 3). *p < 0.05, **p < 0.01, and ***p < 0.001.

TCA-16-e70079-s001.tif (4MB, tif)

FIGURE S2. The TCGA database was used to predict the genes with positive association with NAT10 expression in NSCLC. The illustration diagram shows the top four genes.

TCA-16-e70079-s002.tif (709.1KB, tif)

Funding: This work was supported by Research Project of Wuxi Municipal Health Commission, MS201923.

Data Availability Statement

The analyzed data sets generated during the present study are available from the corresponding author on reasonable request.

References

  • 1. Kratzer T. B., Bandi P., Freedman N. D., et al., “Lung Cancer Statistics, 2023,” Cancer 130 (2024): 1330–1348. [DOI] [PubMed] [Google Scholar]
  • 2. Siegel R. L., Miller K. D., Fuchs H. E., and Jemal A., “Cancer Statistics, 2022,” CA: A Cancer Journal for Clinicians 72 (2022): 7–33. [DOI] [PubMed] [Google Scholar]
  • 3. Ozan K. and Fadime D., “An Investigation of the Relationship Between 18F‐FDG PET/CT Parameters of Primary Tumors and Lymph Node Metastasis in Resectable Non‐Small Cell Lung Cancer,” Current Radiopharmaceuticals 17 (2024): 111–116. [DOI] [PubMed] [Google Scholar]
  • 4. Ruiz‐Cordero R. and Devine W. P., “Targeted Therapy and Checkpoint Immunotherapy in Lung Cancer,” Surgical Pathology Clinics 13 (2020): 17–33. [DOI] [PubMed] [Google Scholar]
  • 5. Lv P., Man S., Xie L., Ma L., and Gao W., “Pathogenesis and Therapeutic Strategy in Platinum Resistance Lung Cancer,” Biochimica Et Biophysica Acta. Reviews on Cancer 1876 (2021): 188577. [DOI] [PubMed] [Google Scholar]
  • 6. Zhang C., Kang T., Wang X., Song J., Zhang J., and Li G., “Stimuli‐Responsive Platinum and Ruthenium Complexes for Lung Cancer Therapy,” Frontiers in Pharmacology 13 (2022): 1035217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Dominissini D. and Rechavi G., “N(4)‐Acetylation of Cytidine in mRNA by NAT10 Regulates Stability and Translation,” Cell 175 (2018): 1725–1727. [DOI] [PubMed] [Google Scholar]
  • 8. Xie L., Zhong X., Cao W., Liu J., Zu X., and Chen L., “Mechanisms of NAT10 as ac4C Writer in Diseases,” Molecular Therapy ‐ Nucleic Acids 32 (2023): 359–368, 10.1016/j.omtn.2023.03.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Zhang Y., Lei Y., Dong Y., et al., “Emerging Roles of RNA ac4C Modification and NAT10 in Mammalian Development and Human Diseases,” Pharmacology & Therapeutics 253 (2024): 108576. [DOI] [PubMed] [Google Scholar]
  • 10. Guo Q., Yu W., Tan J., et al., “Remodelin Delays Non‐Small Cell Lung Cancer Progression by Inhibiting NAT10 via the EMT Pathway,” Cancer Medicine 13 (2024): e7283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Wang Z., Luo J., Huang H., et al., “NAT10‐Mediated Upregulation of GAS5 Facilitates Immune Cell Infiltration in Non‐Small Cell Lung Cancer via the MYBBP1A‐p53/IRF1/Type I Interferon Signaling Axis,” Cell Death Discovery 10 (2024): 240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Yuan Y., Li N., Zhu J., Shao C., Zeng X., and Yi D., “Role of NAT10‐Mediated Ac(4)C Acetylation of ENO1 mRNA in Glycolysis and Apoptosis in Non‐Small Cell Lung Cancer Cells,” BMC Pulmonary Medicine 25 (2025): 75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Qi P., Chen Y. K., Cui R. L., et al., “Overexpression of NAT10 Induced Platinum Drugs Resistance in Breast Cancer Cell,” Zhonghua Zhong Liu Za Zhi 44 (2022): 540–549. [DOI] [PubMed] [Google Scholar]
  • 14. Urano T., Usui T., Takeda S., et al., “TRIM44 Interacts With and Stabilizes Terf, a TRIM Ubiquitin E3 Ligase,” Biochemical and Biophysical Research Communications 383 (2009): 263–268. [DOI] [PubMed] [Google Scholar]
  • 15. Li C. G., Hu H., Yang X. J., et al., “TRIM44 Promotes Colorectal Cancer Proliferation, Migration, and Invasion Through the Akt/mTOR Signaling Pathway,” OncoTargets and Therapy 12 (2019): 10693–10701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Zhu X., Wu Y., Miao X., et al., “High Expression of TRIM44 Is Associated With Enhanced Cell Proliferation, Migration, Invasion, and Resistance to Doxorubicin in Hepatocellular Carcinoma,” Tumour Biology 37 (2016): 14615–14628. [DOI] [PubMed] [Google Scholar]
  • 17. Luo Q., Lin H., Ye X., Huang J., Lu S., and Xu L., “Trim44 Facilitates the Migration and Invasion of Human Lung Cancer Cells via the NF‐κB Signaling Pathway,” International Journal of Clinical Oncology 20 (2015): 508–517. [DOI] [PubMed] [Google Scholar]
  • 18. Ma Q., Huai B., Liu Y., et al., “Circular RNA circ_0020123 Promotes Non‐Small Cell Lung Cancer Progression Through miR‐384/TRIM44 Axis,” Cancer Management and Research 13 (2021): 75–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Zhang S., Cao M., Yan S., et al., “TRIM44 Promotes BRCA1 Functions in HR Repair to Induce Cisplatin Chemoresistance in Lung Adenocarcinoma by Deubiquitinating FLNA,” International Journal of Biological Sciences 18 (2022): 2962–2979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Tan A. C., “Targeting the PI3K/Akt/mTOR Pathway in Non‐Small Cell Lung Cancer (NSCLC),” Thoracic Cancer 11 (2020): 511–518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Liu Y., Hu Q., and Wang X., “AFAP1‐AS1 Induces Cisplatin Resistance in Non‐Small Cell Lung Cancer Through PI3K/AKT Pathway,” Oncology Letters 19 (2020): 1024–1030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.“QuickStats: Age‐Adjusted Prevalence*,† of Adults Aged ≥18 Years with Hypertension§ Who Are Aware They Have Hypertension,¶ by Sex and Race/Ethnicity — National Health and Nutrition Examination Survey, United States, 2011–2014,” MMWR. Morbidity and Mortality Weekly Report 65 (2016): 553. [DOI] [PubMed] [Google Scholar]
  • 23. Ettinger D. S., Wood D. E., Aisner D. L., et al., “NCCN Guidelines Insights: Non‐Small Cell Lung Cancer, Version 2.2023,” Journal of the National Comprehensive Cancer Network 21 (2023): 340–350. [DOI] [PubMed] [Google Scholar]
  • 24. Xiao L., Lan X., Shi X., et al., “Cytoplasmic RAP1 Mediates Cisplatin Resistance of Non‐Small Cell Lung Cancer,” Cell Death & Disease 8 (2017): e2803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Shuai Y., Zhang H., Liu C., et al., “CLIC3 Interacts With NAT10 to Inhibit N4‐Acetylcytidine Modification of p21 mRNA and Promote Bladder Cancer Progression,” Cell Death & Disease 15 (2024): 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Chen X., Hao Y., Liu Y., et al., “NAT10/ac4C/FOXP1 Promotes Malignant Progression and Facilitates Immunosuppression by Reprogramming Glycolytic Metabolism in Cervical Cancer,” Advanced Science 10 (2023): e2302705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Wang Z., Huang Y., Lu W., et al., “C‐Myc‐Mediated Upregulation of NAT10 Facilitates Tumor Development via Cell Cycle Regulation in Non‐Small Cell Lung Cancer,” Medical Oncology 39 (2022): 140. [DOI] [PubMed] [Google Scholar]
  • 28. Liu H., Ling Y., Gong Y., Sun Y., Hou L., and Zhang B., “DNA Damage Induces N‐Acetyltransferase NAT10 Gene Expression Through Transcriptional Activation,” Molecular and Cellular Biochemistry 300 (2007): 249–258. [DOI] [PubMed] [Google Scholar]
  • 29. Xie R., Cheng L., Huang M., et al., “NAT10 Drives Cisplatin Chemoresistance by Enhancing ac4C‐Associated DNA Repair in Bladder Cancer,” Cancer Research 83 (2023): 1666–1683. [DOI] [PubMed] [Google Scholar]
  • 30. Xing Y., Meng Q., Chen X., et al., “TRIM44 Promotes Proliferation and Metastasis in Non‐Small Cell Lung Cancer via mTOR Signaling Pathway,” Oncotarget 7 (2016): 30479–30491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Oh S., Kim H., Nam K., and Shin I., “Silencing of Glut1 Induces Chemoresistance via Modulation of Akt/GSK‐3β/β‐Catenin/Survivin Signaling Pathway in Breast Cancer Cells,” Archives of Biochemistry and Biophysics 636 (2017): 110–122. [DOI] [PubMed] [Google Scholar]
  • 32. Lampada A., O'Prey J., Szabadkai G., Ryan K. M., Hochhauser D., and Salomoni P., “mTORC1‐Independent Autophagy Regulates Receptor Tyrosine Kinase Phosphorylation in Colorectal Cancer Cells via an mTORC2‐Mediated Mechanism,” Cell Death and Differentiation 24 (2017): 1045–1062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Tazzari P. L., Cappellini A., Ricci F., et al., “Multidrug Resistance‐Associated Protein 1 Expression Is Under the Control of the Phosphoinositide 3 Kinase/Akt Signal Transduction Network in Human Acute Myelogenous Leukemia Blasts,” Leukemia 21 (2007): 427–438. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

FIGURE S1. NAT10 inhibited DDP sensitivity and promoted the malignant phenotypes of H1299/DDP and A549/DDP cells. H1299/DDP and A549/DDP cells were divided into the OE‐NC group and the OE‐NAT10 group. (A) NAT10 protein expression was analyzed by western blotting assay (N = 3). (B) The IC50 value of DDP was analyzed by CCK‐8 assay (N = 3). (C) MDR1 protein expression was assessed by western blotting assay (N = 3). (D–F) Cell proliferation was analyzed by CCK‐8 and EdU assays (N = 3). (G and H) Flow cytometry was performed to analyze cell apoptosis (N = 3). (I) Transwell invasion assay was performed to analyze cell invasion (N = 3). (J) Sphere formation assay was performed to analyze the stem‐like traits of H1299/DDP and A549/DDP cells (N = 3). *p < 0.05, **p < 0.01, and ***p < 0.001.

TCA-16-e70079-s001.tif (4MB, tif)

FIGURE S2. The TCGA database was used to predict the genes with positive association with NAT10 expression in NSCLC. The illustration diagram shows the top four genes.

TCA-16-e70079-s002.tif (709.1KB, tif)

Data Availability Statement

The analyzed data sets generated during the present study are available from the corresponding author on reasonable request.

Articles from Thoracic Cancer are provided here courtesy of Wiley

RESOURCES