Abstract
Background
Transcriptional activation of otherwise repressed retrotransposable elements (RTEs) is a hallmark of cancer, shaping tumour progression and immunogenicity by multifaceted, yet incompletely understood, mechanisms.
Methods
We used an extended pan-cancer transcriptome assembly to identify potential effects of RTEs on the genes within which they have integrated or those in proximity. These were subsequently verified in test cases by further analysis of transcriptional profiles in cancer patient data, and by in vitro studies involving restoration of gene activity, and proliferation and migration assays in cancer cell lines.
Results
We report that cancer-specific transcriptional activation of RTEs causes frequent reduction or loss of gene function. Exonisation and alternative splicing of RTEs creates non-functional RNA and protein isoforms and derepressed RTE promoter activity initiates antisense transcription, both at the expense of the canonical isoforms. Contrary to theoretical expectation, transcriptionally activated RTEs affect genes with established tumour-promoting functions, including the common essential RNGTT and the lung cancer-promoting CHRNA5 genes. Furthermore, the disruptive effect of RTE activation on adjacent tumour-promoting genes is associated with slower disease progression in clinical data, whereas experimental restoration of gene activity enhances tumour cell growth and invasiveness in vitro.
Conclusions
These findings underscore the gene-disruptive potential of seemingly innocuous germline RTE integrations, unleashed only by their transcriptional utilisation in cancer. They further suggest that such metastable RTE integrations are co-opted as sensors of the epigenetic and transcriptional changes occurring during cellular transformation and as executors that disrupt the function of tumour-promoting genes.
Supplementary Information
The online version contains supplementary material available at 10.1186/s13073-025-01479-9.
Keywords: Cancer, Retrotransposable elements, Isoform switching, Transcriptional disruption
Background
Similar to all mammalian genomes, the human genome has amassed over 4 million recognisable integrations of retrotransposable elements (RTEs) of diverse subfamilies, some of which are primate-specific, such as the human endogenous retrovirus (HERV) H subfamily of long terminal repeat (LTR) RTEs and the Alu subfamily of non-LTR RTEs [1]. While the vast majority of human RTEs have lost the ability to retrotranspose, new germline integrations of active RTEs are acquired slowly but continually [2].
RTE integration poses a significant risk of insertional mutagenesis, which is higher for the recently acquired or active subfamilies. Highly deleterious mutations may be quickly counterselected, whereas less damaging integrations are retained for longer evolutionary times. The genetic diversity generated by RTE integration, as well as the regulatory sequences they carry, can be co-opted in the evolution of new physiological host functions and transcriptional networks [3, 4]. Indeed, RTE enhancer and promoter activities are co-opted in the regulatory networks of placentation or the interferon (IFN) response genes [5], and alternative RTE exons in the diversification of protein isoforms and function [4]. The repetitive nature of RTEs provides templates for non-allelic homologous recombination, leading to genomic rearrangements and gene fusions, which in turn may create alternative or novel protein isoforms with selectable function in physiology or in cancer [6, 7].
In addition to evolutionary selection, epigenetic control of RTEs further mitigates the potentially damaging effect of RTE integrations on host gene function by preventing their independent transcription or inclusion in host gene transcripts [8]. Epigenetic repression acts faster than evolutionary processes and allows for the latter to determine the ultimate fate of a given RTE integration. However, epigenetic repression is reversible and can be lost, particularly following the major epigenetic changes seen in cancer [8]. In turn, RTE release from epigenetic control may allow for previously hidden effects on the gene near or within which they have integrated to manifest.
Altered transcriptional activity of RTEs has been consistently observed in most cancer types, associated with substantial effects on the cancer transcriptome [8, 9]. RTE transcriptional inclusion in cancer results in aberrant transcription and splicing patterns, often in a cancer type-specific fashion [10]. However, given its high degree of complexity, the functional consequences of the aberrant cancer transcriptome created by RTE derepression are not yet fully understood. RTEs can be co-opted in driving elevated or ectopic expression of genes with tumour-promoting, or in creating tumorigenic protein isoforms. Instances of such onco-exaptation events include the elevated expression of CSF1R and IRF5 in Hodgkin’s lymphoma [11, 12], the ectopic expression of CALB1 (encoding calbindin) in squamous lung cancer [13], and the creation of an oncogenic form of ALK (anaplastic lymphoma kinase) in melanoma [14]. Moreover, comprehensive analysis of epigenetically reactivated RTE promoter activity has identified > 100 potential onco-exaptation events involving oncogenes in diverse cancer types [15].
Owing to the increase in tumour cell fitness they confer, RTE-mediated activation of tumour-promoting genes would be increasingly enriched over the course of tumour progression and molecular evolution, making such onco-exaptation events easier to identify in cancer transcriptomes. In contrast, effects of epigenetically reactivated RTEs that compromise the function of an essential gene would also compromise tumour cell fitness and would, therefore, be counterselected during tumour evolution, giving the appearance of rarer occurrence. However, the potential of transcriptionally reactivated RTEs to disrupt the function of tumour-promoting genes may be a selectable trait in host species evolution.
Here, we investigated the degree to which gene function may be compromised by transcriptionally reactivated RTEs in cancer. We made use of our increasing understanding of the complexity of cancer transcriptomes and identified cancer-specific transcript isoforms, created by transcriptional inclusion of RTEs at the expense of the protein-coding canonical isoform of adjacent genes. Counterintuitively, many of the affected genes have an established tumour-promoting role, and, in test cases, restoration of their expression accelerates tumour cell-intrinsic growth and invasiveness.
Methods
Publicly available RNA-sequencing (RNA-seq) samples used in this study
RNA-seq samples (poly(A) selected RNA), representing 31 primary and one metastatic indications (n = 24 per indication), were obtained from the Cancer Genome Atlas Program (TCGA) [16], as previously described [10]. For further validation, additional samples were downloaded for specific cancer indications and matching normal tissues (COAD, colon adenocarcinoma n = 239; EAC, oesophageal adenocarcinoma n = 78; KIRC, kidney renal clear cell carcinoma n = 538; LUAD, lung adenocarcinoma n = 419; LUSC, lung squamous cell carcinoma n = 362; MESO, mesothelioma n = 24; OV, ovarian serous cystadenocarcinoma n = 419; primary SKCM, skin cutaneous melanoma n = 101; metastatic SKCM n = 224; normal colon n = 39; normal oesophagus n = 9; normal kidney n = 71; normal lung n = 24; normal ovary n = 12; normal skin n = 36). Additional RNA-seq samples from normal tissues were obtained from the Genotype-Tissue Expression (GTEx) Project [17] (n = 2–156 per tissue type), as previously described [10]. The data files were downloaded from the database of Genotypes and Phenotypes (dbGaP) [18] accession numbers phs000178.v10.p8.c1 and phs000424.v7.p2.c1. RNA-seq samples from cancer cell lines (n = 933) were downloaded from the Cancer Cell Line Encyclopedia (CCLE) [19]. Other publicly available dataset supporting the findings of this study included the following: RNA-seq data from a renal cell carcinoma cell line RCC4 with restored expression of the von Hippel-Lindau (VHL) tumour suppressor protein (GSE120887) [20]; ISO-seq data from ESCC cell line TE5 and normal immortalised oesophageal squamous epithelial cell line SHEE (PRJNA515570) [21]; long-read RNA-seq data from HEK293 T and A549 cells [22]. Details of sample collection, ethics approvals and metadata can be found each respective study.
RNA preparation and sequencing
For bulk RNA-seq of A498 cells with deletion in HERVE 6q15, RNA was extracted from cell lines using RNeasy kit (Qiagen, Cat #74,104) and library prep was performed with NEBNext Ultra II Directional PolyA mRNA kit (NEB, Cat #E7760). Samples were then sequenced on a NovaSeq (Illumina). Raw data were deposited at the EMBL-EBI repository (E-MTAB-14514) [23].
Transcript identification, read mapping and quantitation
Samples from TCGA were downloaded through the gdc-client application as.bam files, which were subsequently parsed with a custom Bash pipeline using GNU parallel [24], and converted to.fasta files using SAMtools v1.8 [25]. RNA-seq data from TCGA, GTEx, CCLE and listed previous studies were mapped to our de novo cancer transcriptome assembly and counted as previously described [10]. Briefly, transcripts per million (TPM) values were calculated for all transcripts in the transcript assembly [10] with a custom Bash pipeline and Salmon v0.8.2 [26], which uses a probabilistic model for assigning reads aligning to multiple transcript isoforms, based on the abundance of reads unique to each isoform [26]. Read count tables were additionally imported into Qlucore Omics Explorer v3.9 (Qlucore, Lund, Sweden) for further downstream expression analyses and visualisation. Splice junctions were visualised using the Integrative Genome Viewer (IGV) v2.4.19 [27]. Long-read RNA-seq samples were aligned to the GRCh38/hg38 human genome using minimap2 v2.17 [28]. For assemblies of long-read RNA-seq reads, the obtained.bam files were first converted to bed12 using bam2bed12.py script from FLAIR suit [29]. High-confidence isoforms were selected using “collapse” function from flair.py script [29].
Hypoxia scores
The hypoxia scores [30] for all TCGA samples were kindly provided by Prof. David Mole (Nuffield Department of Medicine, University of Oxford). The hypoxia scores for KIRC samples were filtered; however, mismatches in sample names due to updates by TCGA to the naming system of files meant the mean hypoxia score per patient was used here. Of the 479 KIRC patients with hypoxia scores calculated for tumour samples, 406 had hypoxia scores for one sample, 70 for two samples, and three patients had the mean hypoxia score calculated from three samples.
Repeat annotation and enrichment analysis
Repeat regions were annotated as previously described [31]. Briefly, hidden Markov models (HMMs) representing known human repeat families (Dfam 2.0 library v150923) were used to annotate GRCh38 using RepeatMasker, configured with nhmmer. RepeatMasker annotates LTR and internal regions separately; thus, tabular outputs were parsed to merge adjacent annotations for the same element. Dfam 2.0 differs from later releases by 81 out of 1407 repeat families, with 97 families added and 16 families removed in Dfam 3.8. These differences are partly due to reclassification of existing families and to inclusion of certain low-copy composite repeats. Enrichment analysis of repeat types was performed using Fisher’s exact test in MATLAB (version R2022b, TheMathWorks), followed by the Bonferroni-Holm method to correct for multiple testing. The RTE content, as well as RTE exonisation in specific loci of interest, was further manually inspected and validated on IGV using the Telomere-to-Telomere (T2 T)-CHM13 genome sequence [32] and the Dfam 3.6 release.
Functional gene annotation by gene ontology
Pathway analyses were performed using g:Profiler [33] with genes ordered by the degree of differential expression. p values were estimated by hypergeometric distribution tests and adjusted by multiple testing correction using the g:SCS (set counts and sizes) algorithm, integral to the g:Profiler server [33].
Survival analysis and hazard ratio calculations
Overall survival time was downloaded for TCGA data alongside all other metadata. Survival analysis was run using R and RStudio (version 2023.12.0 Build 369). Univariate and multivariate analyses, hazard ratio calculations and survival curve plotting were performed using GraphPad Prism (version 10.3).
Comparative genomics and sequence alignments
Multiple genomic sequence alignments were carried out using the comparative genomic tool from Ensembl [34]. For sequence divergence of the HERVE 6q15 and HERVH Xp22.2 proviruses, the following primate species were compared: Homo sapiens (human), Pan troglodytes (chimp), Pan paniscus (bonobo), Gorilla gorilla (gorilla), Pongo abelii (orangutan) and Nomascus leucogenys (gibbon). Absolute complexity scores were calculated using Vector NTI 11.5.
Cell lines
All cell lines were obtained from the Cell Services facility of The Francis Crick Institute and verified as mycoplasma-free. All human cell lines were further validated by DNA fingerprinting (Table 1).
Table 1 .
Cell lines used in this study
| Cell line | RRID | Base media | FBS | L-glutamine | Penicillin | Streptomycin |
|---|---|---|---|---|---|---|
| A498 | CVCL_1056 | DMEM | 10% | – | 100 U/mL | 0.1 mg/mL |
| OE19 | CVCL_1622 | RPMI 1640 | 10% | 2 mM | 100 U/mL | 0.1 mg/mL |
| A549 | CVCL_0023 | DMEM | 10% | – | 100 U/mL | 0.1 mg/mL |
| HEK293 T | CVCL_0063 | IMDM | 5% | 2 mM | 100 U/mL | 0.1 mg/mL |
| HCC4006 | CVCL_1269 | RPMI 1640 | 10% | 2 mM | 100 U/mL | 0.1 mg/mL |
All base media sourced from Gibco, penicillin–streptomycin solution from Millipore-Sigma (P4333-100ML), L-glutamine from Merck (G7513-100ML), and FBS from Thermo Fisher Scientific
Cell transfections
HEK293 T and A549 cells were seeded at a density of 200,000 cells/well in 2 mL of culture media 24 h prior transfection in 6-well plates. Cells were then transfected with 5 µg of plasmid each expressing the following sequence (see Tables 2, 3, 4, 5 and 6): CHRNA5 (pcDNA3.1-CHRNA5, Genewiz) or CHRNA5[AluSz] (pcDNA3.1-CHRNA5[AluSz], Genewiz) or CHRNA5-Full intron 5 (pcDNA3.1-CHRNA5-Full intron 5, Genewiz) or CHRNA5-RTE deleted (pcDNA3.1-CHRNA5-RTE deleted, Genewiz) using Lipofectamine 3000 transfection reagent (Thermo Fisher). Cells were then seeded for immunofluorescence staining.
Table 2 .
PCR primers used in this study
| Gene name | Forward | Reverse |
|---|---|---|
| HERVE(RNGTT) KO validation | TTCTAAAAGATCATCAGTCAGC | CCACCAAATTACATGCAT |
| HERVE(RNGTT)−5′ arm specific | TTCTAAAAGATCATCAGTCAGC | GGACTATAACCATTATATGGGA |
| HERVE(RNGTT)−3′ arm specific | ACTAACAGTACAGATGTACAGATAC | CCACCAAATTACATGCAT |
| CHRNA5-FL | TGACTATGGTGGAATAAAAG | AAAGCCCAAGAGATCCAA |
| CHRNA5-SF | TGACTATGGTGGAATAAAAG | GAAGAAGATCTGCATTTGTA |
Table 3 .
RT-qPCR primers used in this study
| Gene name | Forward | Reverse |
|---|---|---|
| RNGTT | ACTTGAAGGAAATTTTGCCA | GGCTTCCATTTCAAAATATC |
| CHRNA5 | AGATGGAACCCTGATGACTATGGT | AAACGTCCATCTGCATTATCAAAC |
| CHRNA5-FL | AAATTCATAGCCCAGGTT | AAAGCCCAAGAGATCCAA |
| CHRNA5-SF | TCACTCAGAAAGAGGAAACT | GAAGAAGATCTGCATTTGTA |
| HPRT | TGACACTGGCAAAACAATGCA | GGTCCTTTTCACCAGCAAGCT |
Values were normalised to HPRT expression using the ΔCT method
Table 4 .
gRNAs used in this study
| Name | Sequence |
|---|---|
| RNGTT 5′ arm 1 | GAGTATCTGACTGTGACTAA |
| RNGTT 5′ arm 2 | AGACAACTAATATCAAGAGA |
| RNGTT 3′ arm 1 | AGTCAGGTACAAGCCAACAT |
| RNGTT 3′ arm 2 | ACAGATGTACAGATACTTAT |
Table 5 .
Amplicon Sanger sequencing primers used in this study
| Gene name | Forward | Reverse |
|---|---|---|
| HERVE(RNGTT) KO validation | TTCTAAAAGATCATCAGTCAGC | CCACCAAATTACATGCAT |
Table 6 .
Amplicon next-generation sequencing primers used in this study
| Gene name | Forward | Reverse |
|---|---|---|
| HERVH Xp22.2 2-C | tcgtcggcagcgtcagatgtgtataagagacagCCGCTAAGCCGAGAAGATCTGGG | gtctcgtgggctcggagatgtgtataagagacagTCGAGAGGAAAGGGCTGTGTCC |
| HERVH Xp22.2 2–6 | tcgtcggcagcgtcagatgtgtataagagacagTCAGTCTTCAGCCGCTAAGCCG | gtctcgtgggctcggagatgtgtataagagacagTGTGCCACATAAGGTGTCCACG |
| HERVH Xp22.2 2-altend | tcgtcggcagcgtcagatgtgtataagagacagAATCAGGCAGCGTCAGTCTT | gtctcgtgggctcggagatgtgtataagagacagAACAGCTGTGCCACATAAGG |
| HERVH Xp22.2 2-end | tcgtcggcagcgtcagatgtgtataagagacagTCTTCAGCCGCTAAGCCG | gtctcgtgggctcggagatgtgtataagagacagAAGACTGTGAGAACCCCAGG |
| HERVH Xp22.2 6-end | tcgtcggcagcgtcagatgtgtataagagacagTGGAATTAACAACGTGGACACC | gtctcgtgggctcggagatgtgtataagagacagTGAGAGGATGGTCTAGGGCT |
| HERVH Xp22.2 6-altend | tcgtcggcagcgtcagatgtgtataagagacagTGGAATTAACAACGTGGACACC | gtctcgtgggctcggagatgtgtataagagacagGCATGCTTCTCAGATACAGGT |
Lower-case and upper-case characters denote the sequencing library adaptors and isoform-specific sequences, respectively. PCR reactions were cleaned-up using the AMPure XP beads (Beckman Coulter) and were sequenced on the Illumina MiSeq platform with a PE 250-bp run configuration on a Nano flowcell
Polymerase chain reaction (PCR)
PCR was performed using KOD Hot Start Master Mix (Sigma) with the following primers (Table 2):
Reverse transcriptase-based quantitative PCR (RT-qPCR)
RNA was extracted using the RNeasy kit (Qiagen). cDNA was synthesised using the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher), and qPCR performed using Applied Biosystems Fast SYBR Green (Thermo Fisher) using the following primers (Table 3):
Cas9-mediated editing
The HERVE provirus in the RNGTT locus was targeted by the following guide RNA (gRNA) sequences (Table 4):
The above gRNA sequences were synthesised by IDT in Alt-RTMCRISPR-Cas9 sgRNA form and resuspended in TE buffer. A498 cells were cultured to confluence, passaged and seeded into a 6-well dish at a density of 200,000 cells/well. The next day, all four sgRNAs (300 ng per sgRNA) were resuspended with Lipofectamine Cas9 Plus reagent (12.5 µL) and Alt-R™.p.Cas9-GFP V3 (6250 ng) in OptiMEM (125 µL), mixed with 7.5 µL Lipofectamine CRISPRMAX reagent in 125 µL OptiMEM. Twenty-four hours later, positively transfected cells were single cell sorted based on their green fluorescent protein (GFP) status using a BD FACSAria II (BD Biosciences) onto 96-well plates. After 4–6 weeks, genomic DNA samples were taken from all clones using DNeasy Blood & Tissue Kit (Qiagen). The deleted allele was confirmed with primers—HERVE(RNGTT) KO validation and the wild-type allele was amplified with primers—HERVE(RNGTT)−5′ arm specific and HERVE(RNGTT)−3′ arm specific to confirm homozygous excision of HERVE provirus.
Amplicon Sanger sequencing
Genomic DNA PCR products from A498 cells were sent to Genewiz for PCR clean-up and Sanger sequencing with the following sequencing primers (Table 5):
Amplicon next-generation sequencing
Amplicons from HCC4006 cell cDNA specific for the HERVH Xp22.2-AS isoforms were amplified using the following primers (Table 6):
Immunofluorescence
HEK293 T cells transfected with pcDNA3.1-CHRNA5 or pcDNA3.1-CHRNA5[AluSz] were grown on 1.5-mm coverglass dishes (MatTek, Cat #P35G-1.5–20-C) that were fixed using 10% neutrally buffered formalin (Genta Medical) for 15 min. Non-specific staining of non-permeabilised cells was blocked with 1% bovine serum albumin (Sigma-Aldrich). Primary antibody incubation for influenza hemagglutinin (HA)-tag antibody (Santa Cruz Biotechnology, sc-7392) was performed overnight at 4 °C at a 1:100 dilution. Secondary antibody incubation using Goat Anti-Mouse IgG H&L AlexaFluor594 Antibody (Abcam, Cat #ab150116) was carried out the next day for 1 h at room temperature at a 1:1000 dilution. Nuclear staining was performed using Hoechst 33,342 (Thermo Fisher). Samples were imaged on the Zeiss Observer.Z1 (Carl Zeiss Meditec AG) using Micro-Manager 2.0 software.
Retroviral transduction
Stably transduced cell lines were produced through viral infection and single cell sorting on GFP and mCherry using the MoFLO XDP cell sorter (BD Biosciences, Flow Cytometry Team, The Francis Crick Institute). Virus was generated using HEK293 T cells plated at a density of 1.5 × 106 cells per 60 mm well incubated with a mixture of serum-free IMDM (Sigma-Aldrich, I3390), GeneJuice (VWR International Ltd., 70,967–4), and 5 μL of plasmid DNA. Plasmids used were vesicular stomatitis virus glycoprotein (VSVg) plasmid (pcVG-wt), pHIT60, and the open reading frames of the sequences of interest cloned into the pRV-IRES-GFP or pRV-IRES-mCherry vector (see Tables 2, 3, 4, 5 and 6). Cloning the open reading frames into the vector was carried out Genewiz LLC and was followed by sequencing to verify the plasmid structure. Virus-containing supernatant was collected and added to HEK293 T cells (plated at a density of 8.5 × 104 cells per 35 mm well) along with polybrene (Sigma-Aldrich, TR-1003-G), and spun at 1200 RPM for 45 min. After 3 days, populations were single cell sorted on GFP, or mCherry expression using a BD FACSAria II (BD Biosciences) (Flow Cytometry STP, The Francis Crick Institute).
Protein preparation for western blot
Cells were washed twice with phosphate-buffered saline (PBS) stored at 4 °C before being incubated on ice with radioimmunoprecipitation assay (RIPA, Sigma-Aldrich, R0278-50ML) buffer for 30 min to lyse the cells. The mixture was then spun at 14,000 RPM for 10 min at 4 °C. The protein concentration of the lysate was measured using the Pierce™ BCA protein assay kit (Thermo Scientific, 23,225). Stock solutions at a protein concentration of 500 μg/mL were made by mixing 100 μL of sample buffer (Laemmli 2 × concentrate, Sigma-Aldrich, S3401-10 VL), with 100 μg of protein lysate and RIPA buffer to a final volume of 200 μL. Stock solutions were heat denatured at 95 °C for 5 min before being frozen at − 20 °C.
Western blot
Sample stock solutions were thawed on ice before being boiled at 95 °C for 5 min. Ten micrograms of protein per sample was loaded into a 4–20% Mini-PROTEAN® TGX™ precast polyacrylamide gel (Bio-Rad, 4,561,094) alongside a protein ladder (PageRuler Plus Prestained Protein Ladder, 10 to 250 kDa, ThermoFisher, 26,619). The gel electrophoresis was run in a Mini-PROTEAN® Tetra Vertical Electrophoresis Cell (Bio-Rad) filled with protein running buffer (Media Team, The Francis Crick Institute) at 180 V for 40 min. Samples were transferred to a 0.2-μm nitrocellulose membrane (Trans-Blot Turbo Mini 0.2 μm Nitrocellulose Transfer Pack, Bio-Rad, 1,704,158) using the Trans-Blot Turbo dry transfer system (Bio-Rad, 1,704,150) turbo setting for mini TGX gels before blocking with 5% skimmed milk (Marvel) in Tris-buffered saline with 0.5% Tween-20 (TBS-T, Media Team, The Francis Crick Institute) for 1 h. Membranes were stained overnight at 4 °C with the anti-FLAG antibody (Sigma-Aldrich, F1804) diluted at 1:1000 in 5% skimmed milk in TBS-T. Membranes were washed with TBS-T at room temperature before the horseradish peroxidase (HRP)-conjugated anti-mouse secondary antibody (Abcam, ab6728) was added, diluted at 1:1000 in 3% skimmed milk in TBS-T and incubated at room temperature for 1 h. Membranes were then washed in TBS-T and visualised by enhanced chemiluminescence using Clarity™ Western ECL Substrate (Bio-Rad, 1,705,060) on a ChemiDoc XRS + (Bio-Rad).
Transwell migration assay
Cell migratory capacity was examined by transwell migration assay that uses chemotactic gradient to assess how cells migrate through a porous membrane. Cells were trypsinised and resuspended in serum-free media. They were then seeded into Millicell Hanging Cell Culture Insert (Millipore, PTEP24H48) at a density of 20 × 103 for A498 and A549 clones, while the lower chamber contained fresh culture media with 30% FBS. The cells were allowed to migrate for at least 48 h. The inserts were washed with PBS and fixed with 10% neutrally buffered formalin (Genta Medical) for 10 min. Those cells that did not migrate were removed. The cells on the lower surface of the insert were washed with PBS again, stained with crystal violet solution (Sigma Aldrich, V5265). The cells on each insert were counted in 4 random fields under Zeiss Observer.Z1 (Carl Zeiss Meditec AG) using Micro-Manager 2.0 software.
Cell growth assays
Growth and proliferation of A498 parental control (1E7), A498 HERVE 6q15−/− (2D11) clone, A549 parental and canonical CHRNA5 and CHRNA5[AluSz] expressing A549 clones was assessed by real-time quantitative live-cell imaging using the Incucyte Live-Cell Analysis System (Sartorius). Cells were seeded into 96-well plates 24 h prior measurement in Incucyte system at a density of 2000 and 1000 cells per well for A498 and A549, respectively. Image and confluency measurement were taken every 3 h for at least 72 h. Cell growth data for RNGTT-deficient cell lines in CCLE were downloaded from Dependency Map (DepMap) portal [35].
Statistical analyses
Statistical comparisons were made using GraphPad Prism 10.3 (GraphPad Software), SigmaPlot 14.0, Qlucore Omics Explorer v3.9, or R (versions 3.6.1–4.0.0). Parametric comparisons of normally distributed values that satisfied the variance criteria were made by unpaired or paired Student’s t-tests or one-way analysis of variance (ANOVA) tests with Bonferroni correction for multiple comparisons. Data that did not pass the variance test were compared with non-parametric two-tailed Mann–Whitney rank sum tests (for unpaired comparisons) or Kruskal–Wallis test with Dunn’s multiple comparisons correction.
Results
Widespread potential for RTE-mediate disruption of adjacent gene function
To identify cases where aberrant transcriptional inclusion of RTEs may affect local gene function, we searched for gene loci that exhibit a specific switch in RNA isoform expression. To this end, we used a cancer transcriptome assembly that captures diverse RTE-overlapping transcripts and quantified transcript abundance using Salmon, which uses a probabilistic model for assignment of reads aligning to multiple transcript isoforms [10]. We subsequently selected transcripts that were either upregulated or downregulated in a given cancer type compared with its respective normal tissue (Fig. 1A–C). Intersection of the two lists identified transcripts that, despite exhibiting contrasting transcriptional behaviour (referred to here as discordant transcripts), were transcribed from the same locus (Fig. 1A, B). For example, from a total of 225,544 transcripts differentially expressed between KIRC and normal kidney tissue, 62.9% were from loci that produced transcriptionally discordant RNA isoforms (Fig. 1A–C), suggesting extensive changes in RNA isoform balance in this cancer type. Similar results were also obtained from analysis of COAD, LUAD, LUSC and EAC, although the proportion of discordant transcripts was lower (11.3–34.3%) in these cancer types (Fig. 1C). Moreover, nearly half of the loci producing transcriptionally discordant RNA isoforms in KIRC were also found in at least one other cancer type, and this fraction was much higher (82.5–92.2%) for the remaining types (Fig. 1C). Compared with the entire previously assembled transcriptome, Alu, MIR and L1 elements were particularly enriched in discordant transcripts from all types of cancer analysed, whereas LTR elements displayed a cancer type-specific pattern of enrichment (Fig. 1D). These findings suggested extensive imbalances in RNA isoform expression in cancer through increased RTE utilisation and indicated common underlying mechanisms operating in multiple cancer types. Given the potential of alternative isoforms generated by RTE co-option to affect gene function or create new function, we next investigated specific effects on nearby or encompassing genes in detail.
Fig. 1.
Widespread shifts in the balance of RNA isoform expression in cancer. A Heatmap of expression of 87,861 and 54,202 discordant transcripts that are upregulated and downregulated (≥ 1.5 fold-change, p ≤ 0.05, q ≤ 0.05), respectively, in TCGA KIRC samples, compared with normal kidney tissue, and overlap with loci producing transcripts in both categories. B Total number of differentially expressed transcripts (≥ 1.5 fold-change, p ≤ 0.05, q ≤ 0.05) (top), differentially expressed discordant transcripts (middle), and loci producing discordant transcripts (bottom) between the indicated cancer types and their respective normal tissue (KIRC n = 538, normal kidney n = 71; COAD n = 239, normal colon n = 39; LUAD n = 419, normal lung n = 24; LUSC n = 362, normal lung n = 24; EAC n = 78, normal oesophagus n = 9). C Fold-change of individual discordant transcripts (symbols) overlapping with the indicated loci in KIRC samples. D Fold-enrichment for the indicated RTE subgroups in discordant transcripts, compared with the entire transcriptome. All indicated RTE subgroups were significantly enriched (p ≤ 0.05)
Downregulation of RNGTT transcription by an intronic HERVE integration
An example of a locus producing discordant transcripts in KIRC was RNGTT (RNA guanylyltransferase and 5′-phosphatase), encoding the mRNA capping enzyme with RNA 5′-triphosphate monophosphatase and guanylyltransferase activities. In its penultimate intron, RNGTT harbours a HERVE provirus, integrated in reverse orientation relative to RNGTT (Fig. 2A). This HERVE provirus, referred to here as HERVE 6q15, is known to be highly expressed in KIRC and to encode immunogenic retroviral proteins, which contribute to tumour immune control [36–39]. However, the consequences of its transcriptional induction on RNGTT have not been previously considered. We found that transcription of RNGTT and the intronic HERVE provirus exhibited an inverse pattern in KIRC (Fig. 2B–D). HERVE 6q15 was not expressed in normal kidney tissue but was highly induced in ~ 50% of KIRC cases, with significantly higher expression in later stages of the disease (Fig. 2B, C). In contrast, RNGTT expression was significantly reduced in KIRC, compared with normal kidney tissue, and this reduction was more pronounced in cases with higher HERVE 6q15 expression (Fig. 2B, D), suggesting that transcriptional activation of the HERVE integration negatively impacted RNGTT expression. A similar negative correlation between RNGTT and HERVE 6q15 transcription was also observed in RNA-seq data from individual renal cell carcinoma cell lines obtained from CCLE (Fig. 1E, F), where possible confounding effects of non-tumour cells in tumour samples can be excluded.
Fig. 2.
Effect of HERVE activation on RNGTT transcription. A Gene structure and integrated HERVE provirus, GENCODE-annotated and assembled transcripts, and RNA-seq traces of 24 combined KIRC and kidney renal papillary cell carcinoma (KIRP) samples at the RNGTT locus. B Expression of transcripts overlapping HERVE 6q15 or the canonical RNGTT in normal kidney tissue and KIRC samples, ordered according to HERVE 6q15 expression. CHERVE 6q15 expression in TPM in the same samples as in B (p value calculated with Mann–Whitney test), and according to tumour stage (I n = 271, II n = 59, III n = 123, IV n = 82; p values calculated with Kruskal–Wallis test with Dunn’s multiple comparisons correction). DRNGTT expression (TPM) in normal kidney tissue (n = 71) and in KIRC samples with low (n = 322) and high (n = 216) HERVE 6q15 expression (p values calculated with Kruskal–Wallis test with Dunn’s multiple comparisons correction). E Expression of transcripts overlapping HERVE 6q15 or the canonical RNGTT in renal cell carcinoma cell lines in CCLE, in columns ordered according to HERVE 6q15 expression. FRNGTT expression (TPM) in renal cell carcinoma cell lines with low (n = 9) and high (n = 13) HERVE 6q15 expression (p value calculated with two-tailed Student’s t-test). G Ratio of HERVE 6q15 to RNGTT expression in renal cell carcinoma cell lines in CCLE (left), and RNGTT expression (assessed by RT-PCR and plotted relatively to HPRT1 expression) in A498 cells with (clone 1E7, HERVE 6q15+/+) or without (clone 2D11, HERVE 6q15−/−) the HERVE 6q15 provirus (right). Symbols represent replicates of 4 independent experiments, connected with lines (p value calculated with two-tailed paired Student’s t-test). H Heatmap of differential gene expression (≥ twofold-change, p ≤ 0.05, q ≤ 0.05) of between HERVE 6q15+/+ and HERVE 6q15−/− A498 cells (left). Columns represent independent replicates. Gene ontology (GO) functional annotation of the differentially expressed genes (right) (p values calculated with g:Profiler using hypergeometric distribution tests and adjusted for multiple hypothesis testing using the g:SCS (set counts and sizes) algorithm, integral to the g:Profiler server [33]. I Mean confluency (± SD, n = 6 from 1 experiment) (left) and mean cell number (± SEM, n = 3 from 1 experiment) (right) of HERVE 6q15+/+ and HERVE 6q15−/− A498 cell cultures over time (p values calculated by two-tailed Student’s t-test of the area under the curve (AUC) values and by two-tailed Student’s t-test for day 10, respectively). J Representative images of HERVE 6q15+/+ and HERVE 6q15−/− A498 cell morphology 2 or 3 days after plating. K In vitro migration of HERVE 6q15+/+ (1E7) and HERVE 6q15−/.− (2D11) A498 cells. Symbols represent independent measurements (n = 12, 4 fields of view from 3 independent experiments; p value calculated with two-tailed Student’s t-test)
In agreement with prior reports [37], HERVE 6q15 transcription in KIRC was directly correlated with the degree of hypoxia (Additional file 1: Fig. S1 A, B), although the strength of this correlation was likely affected by the reliability of current hypoxia scores to reflect the pseudohypoxic state of this cancer type [30]. However, a direct effect of hypoxia on HERVE 6q15 transcription was evident by analysis of RNA-seq data from renal cell carcinoma RCC4 cells with restored expression of the VHL tumour suppressor [20] (GSE120887) (Additional file 1: Fig. S1 C, D). Hypoxia significantly increased HERVE 6q15 expression in VHL-expressing RCC4 cells, but did not affect levels of RNGTT transcription, which were already very low and substantially lower than those of HERVE 6q15 in these cells (Additional file 1: Fig. S1 C, D).
The enzymatic activities encoded by RNGTT play an indispensable role in RNA capping, by catalysing the first step of a complex series of reactions leading to the addition of the methyl-7-guanosine cap on the 5′ ends of nascent RNAs [40]. In turn, RNA capping affects all subsequent aspects of RNA processing and function, including translation potential [40]. Accordingly, RNGTT is a common essential gene, required for growth of virtually all cancer cell lines (Additional file 1: Fig. S2), and its direct pro-tumour activity is associated with worse prognosis on most cancer types [40–42].
Given that high levels of HERVE 6q15 transcription in most renal cell carcinoma cell lines may have reduced RNGTT transcription to levels that cannot be further reduced without compromising cell viability (Additional file 1: Fig. S2), we investigated a direct effect of HERVE 6q15 on RNGTT, with the reverse experiment. We selected renal cell carcinoma A498 cells, which express a high HERVE 6q15 to RNGTT ratio (Fig. 1G), and used CRISPR/Cas9 editing to remove the HERVE provirus, together with two immediately adjacent L1 integrations (Additional file 1: Fig. S3). Assessed by RT-qPCR and compared with the HERVE 6q15+/+ clone (1E7), expression of RNGTT was upregulated by ~ 63% in the HERVE 6q15−/− clone (2D11) (Fig. 1G). RNGTT upregulation following HERVE 6q15 deletion in A498 cells was accompanied by extensive transcriptional changes, with upregulation of genes involved in cell adhesion and migration, and downregulation of genes involved in metabolic processes (Fig. 1H). Consistent with their transcriptional profile and the pro-tumour activities of RNGTT, HERVE 6q15−/− 2D11 cells exhibited increased in vitro growth, altered morphology and increased migration (Fig. 1I–K). Lastly, supporting opposing transcriptional profiles, RNGTT and HERVE 6q15 levels also showed the opposite correlation with KIRC survival, which was however an indirect result of HERVE 6q15 association with later stages of the disease (Additional file 1: Fig. S4). Together, these results support a model of HERVE 6q15 transcriptional induction during KIRC progression, which reduces, but does not abolish pro-tumour RNGTT expression.
Regulation of cadherin 4 by THE1 A-driven antisense transcription.
We have previously identified an antisense transcript, initiated by a THE1 A retroelement and referred to as THE1 A[CDH4-AS], which is spanning two introns of the CDH4 gene (encoding cadherin 4) and expressed specifically in cutaneous and uveal melanomas [10]. To examine a possible effect of transcriptional activation of the intronic THE1 A element on CDH4 transcription, we correlated the two in RNA-seq data from TCGA SKCM samples (Fig. 3). This analysis revealed a pattern of mutual exclusivity between THE1 A[CDH4-AS] and CDH4 transcription in both primary and metastatic SKCM, irrespective of disease stage (Fig. 3A). However, compared with normal skin samples, the transcriptional activation of the THE1 A element and concomitant downregulation of CDH4 transcription were considerably more pronounced in primary than in metastatic disease (Fig. 3B, C). Indeed, whereas significantly reduced in primary melanoma, overall CDH4 transcription remained high in metastatic melanoma, particularly in samples with low THE1 A[CDH4-AS] transcription (Fig. 3B, C).
Fig. 3.

Effect of THE1 A activation on CDH4 transcription. A Expression of transcripts overlapping THE1 A[CDH4-AS] or the canonical CDH4 in primary and metastatic SKCM samples. B THE1 A[CDH4-AS] and canonical CDH4 expression (TPM) in normal skin tissue (n = 36) and in primary (n = 101) and metastatic (n = 224) SKCM samples (p values calculated with Kruskal–Wallis tests with Dunn’s multiple comparisons correction). C CDH4 expression (TPM) in primary and metastatic SKCM samples with low (n = 66 and n = 161, respectively) and high (n = 35 and n = 89, respectively) THE1 A[CDH4-AS] expression (p value calculated with Mann–Whitney test). D Overall survival of primary and metastatic SKCM patients, stratified by THE1 A[CDH4-AS] expression (p values calculated with log-rank tests)
Cadherin 4, also known as R-cadherin (retinal), is a member of the calcium-dependent adhesion molecule superfamily, important in forming adherens junctions and in organ development [43, 44]. Cadherin-regulated cellular adhesion and detachment also determines migration and invasiveness of tumour cells and, consequently, the ability of several cancer types to metastasise [45, 46]. In the skin, E-cadherin (epidermal) and P-cadherin (placental) mediate heterotypic adhesion of neural crest-derived melanocytes with the surrounding epithelial cells [47]. Loss of E-cadherin and P-cadherin, and gain of N-cadherin (neuronal), known as cadherin switching [46], facilitates melanoma cell metastasis and is associated with worse prognosis of SKCM [48]. While its role in melanoma is less well studied, R-cadherin mediates adhesion with N-cadherin [43] and its overexpression in epidermoid carcinoma A431 cells causes the loss of E-cadherin and P-cadherin, through competition for the intracellular adaptor proteins catenins [49]. An involvement of R-cadherin in cadherin switching is further supported by reports of an essential role in tumorigenesis and metastasis in human osteosarcoma [50] and in a murine model of glioma [51], and of a tumour suppressive function in human colorectal and gastric cancers [52].
Consistent with a role for CDH4 in the metastatic process suggested by findings in other cancer types, we found that transcriptional co-option of THE1 A[CDH4-AS] specifically in SCKM differentiates primary and metastatic disease and is differentially associated with survival in the two subtypes (Fig. 3D). This association indicated that THE1 A[CDH4-AS]-mediated suppression of CDH4 in primary melanomas restrains their metastatic potential, whereas the failure to establish or the loss of such transcriptional effect facilitates metastasis.
HERVH-driven downregulation of endosomal single-stranded RNA sensors TLR7 and TLR8.
The TLR7 and TLR8 paralogue genes, two members of the Toll-like receptor (TLR) family, are arranged in tandem on chromosome Xp22.2, followed by a HERVH provirus, referred to here as HERVH Xp22.2 (Fig. 4A). Our assembly identified a number of antisense transcripts, initiated by the bidirectional promoter activity of the HERVH Xp22.2 provirus, using a total of 10 alternative exons spread throughout the locus and extending to the upstream gene PRPS2 (phosphoribosyl pyrophosphate synthetase 2) (Fig. 4A). Some of the assembled transcripts partially matched the annotated TLR8-AS1 transcripts in GENCODE 46 (ENST00000451564) and RefSeq (NR_030727), which appeared incomplete (Fig. 4A). Splice junction analysis of RNA-seq data from TCGA LUAD samples revealed two main groups of HERVH Xp22.2-initated antisense transcripts (collectively referred to as HERVH Xp22.2-AS), one terminating between the TLR7 and TLR8 loci and one terminating within the PRPS2 locus (Fig. 4A). To validate the complex splicing pattern, we amplified the corresponding cDNAs from key splicing isoforms expressed in lung adenocarcinoma HCC4006 cells. Deep-sequencing of the amplicons confirmed the alternative use of middle and terminal exons, as well as the balance of shorter and longer HERVH Xp22.2-AS isoforms (Fig. 4A).
Fig. 4.
Effect of HERVH activation on TLR7 and TLR8 transcription. A Gene structure and integrated HERVH provirus at the PRPS2-TLR7-TLR8 locus, GENCODE- and RefSeq-annotated and assembled transcripts, splice junction analysis of LUAD RNA-seq data, amplicons used for transcript validation, splice junction analysis of amplicon sequencing, and RNA-seq traces of LUAD samples with (top two) or without (bottom two) HERVH transcriptional activation. B Expression of transcripts overlapping HERVH Xp22.2 or the canonical TLR7 or TLR8 in normal lung (n = 36) and ovary (n = 12) tissue, and in MESO (n = 24), LUAD (n = 419), LUSC (n = 362) and OV (n = 419) samples. C Overall survival of LUAD (left) and OV (right) patients, stratified by HERVH Xp22.2 expression (p values calculated with log-rank tests)
Across several cancer types and respective normal tissues, HERVH Xp22.2-AS was transcriptionally activated in a substantial proportion of samples from OV, MESO and testicular germ cell tumours (TGCT), and a smaller proportion of samples from other cancers, including LUAD and LUSC, but remained inactive in normal tissues, with the possible exception of a small number of Epstein-Barr virus (EBV)-transformed B cell lines (Additional file 1: Fig. S5 A). Notably, HERVH Xp22.2-AS transcription was strongly anti-correlated with TLR7 and TLR8 transcription in cancers where it was expressed (Fig. 4A, B; Additional file 1: Fig. S5B). Indeed, whereas normal lung tissue expressed TLR7 and TLR8 highly and proportionally, without detectable HERVH Xp22.2-AS expression, ~ 13% of LUAD samples expressed high levels of HERVH Xp22.2-AS, but not of TLR7 and TLR8 (Additional file 1: Fig. S5B), indicating an inhibitory effect of HERVH Xp22.2-AS transcriptional activation on sense transcription. This effect appeared to extend also to the PRPS2 locus, which was expressed only in LUAD samples, but not in normal lung tissue, and exhibited a significant anti-correlation with HERVH Xp22.2-AS expression (Additional file 1: Fig. S5B). Similar results were obtained also in LUSC, as well as MESO and OV, where HERVH Xp22.2-AS was highly expressed and TLR7 and TLR8 were downregulated in nearly half of the cases (Fig. 4B).
TLR7 and TLR8 are endosomal sensors of single-stranded RNA [53] that play essential roles in the defence against viral infection and in the induction of B cell systemic autoimmunity [54]. Recent studies have indicated an essential, yet dual role for TLR7 and TLR8 also in cancer progression and immune control [55, 56]. Whereas their ligation in immune cells may enhance anti-tumour activity, TLR7 and TLR8 are also expressed in tumour cells where they mediate a pro-tumour effect [55, 56]. Indeed, tumour cell-intrinsic expression of TLR7 and TLR8 promotes their growth and survival in vitro [57, 58] and is associated with poor clinical outcome in non-small cell lung carcinomas (NSCLC) [59–61]. This pro-tumour effect of TLR7 is further supported by studies in animal models [59].
A pro-tumour effect of tumour cell-intrinsic TLR7 and TLR8 expression would predict that their downregulation by HERVH Xp22.2-AS transcriptional activation has an anti-tumour effect. Although survival analyses of TLR7 and TLR8 expression are confounded by their expression both in tumour cells and in immune cells, the strict tumour specificity of HERVH Xp22.2-AS expression reflects tumour cell-intrinsic transcriptional states. Indeed, we found that higher HERVH Xp22.2-AS expression in tumour samples is significantly associated with better prognosis in both LUAD and OV (Fig. 4B), consistent with a protective effect of HERVH Xp22.2-AS transcriptional activation.
Downregulation of APOBEC3B expression by MER11 C element co-option
Similar to TLR7 and TLR8 paralogues, members of the apolipoprotein B editing complex 3 (APOBEC3) family of enzymes are encoded by genes arranged in a cluster on chromosome 22 (Fig. 5A, B). They catalyse cytidine deamination in DNA or RNA substrates, which can potently inhibit virus and RTE replication, but can also drive genomic diversity and instability in cancer [62, 63]. Current evidence implicates APOBEC3 A and APOBEC3B as the two enzymes primarily responsible for the mutational signatures in human cancers and indicates a role for APOBEC3B in the regulation of APOBEC3 A [64]. Expression of human APOBEC3B in mice enhances their susceptibility to tumours and also causes male infertility [65], supporting a pro-tumour role, as well as a detrimental effect on the genetic integrity of the male germline.
Fig. 5.
Effect of MER11 C activation on APOBEC3B transcription. A Gene structure and integrated MER11 C, L2c and MER96B RTEs at the APOBEC3B locus, and RNA-seq traces of TGCT samples with (top two) or without (bottom two) MER11 C transcriptional activation. B Gene structure at the extended APOBEC3 gene cluster. C Expression (TPM) of APOBEC3B-AS1 and the indicated APOBEC3 genes in TGCT samples with low (n = 14) and high (n = 10) APOBEC3B-AS1 expression (p values calculated with Mann–Whitney test and Student’s t-test for APOBEC3B-AS1 and APOBEC3B, respectively)
In this locus, we have identified a transcript matching annotated transcript APOBEC3B-AS1 (ENST00000513758) and transcribed in the reverse orientation in relation to the APOBEC3 genes (Fig. 5A, B). This transcript was initiated by a MER11 C element integrated between the APOBEC3B and APOBEC3 C genes and extended over the first 3 APOBEC3B exons (Fig. 5A, B). High APOBEC3B-AS1 expression was highly specific to TGCT samples, with very low expression in other cancer types or normal tissues (Additional file 1: Fig. S6). Importantly, transcriptional activation of the MER11 C element in TGCT samples was accompanied by reduction specifically in transcription of the overlapping APOBEC3B gene, whereas transcription of all other APOBEC3 genes in this cluster remained unaffected (Fig. 5C).
Reduction of ENPP3 potential by a switch to non-functional isoforms
The ENPP3 (ectonucleotide pyrophosphatase/phosphodiesterase 3) locus produced multiple discordant transcripts, the majority of which were highly upregulated (Fig. 1B). In addition to ENPP3, the locus also contained two other annotated genes, CTAGE9 and OR2 A4, both located in intron 16 of ENPP3 and transcribed in the reverse orientation (Fig. 6A). Inspection of the locus identified several novel isoforms created by transcriptional inclusion of RTEs (Fig. 6A). These included a transcript using L2a and AluSx elements (ENPP3[L2a/AluSx]) also in intron 16 as alternative terminal exon and polyadenylation site (Fig. 6A). They also included a transcript using AluSx3 and L2a elements as alternative second and terminal exons, respectively (ENPP3[AluSx3/L2a]), partially matching annotated GENCODE 46 transcript ENST00000427707 (Fig. 6A). Two additional transcripts were created by the use of a PABL_B element as alternative promoter ([PABL_B]ENPP3) or an AluSg element as an alternative terminal exon (ENPP3[AluSg]) (Fig. 6A). Compared with normal kidney tissue, expression of ENPP3 was found significantly elevated in KIRC samples, in agreement with prior reports [66, 67], as was expression of alternative ENPP3 isoforms, as well as of CTAGE9 and an L1MDa integration straddling CTAGE9, whereas expression of OR2 A4 was similar (Fig. 6B; Additional file 1: Fig. S7 A). Alternative ENPP3 isoform expression accounted for a substantial proportion (~ 32%) of total ENPP3 transcription, with stable balance through progressive stages of the disease, and was primarily driven by the ENPP3[L2a/AluSx] and ENPP3[AluSx3/L2a] transcripts (Fig. 6B; Additional file 1: Fig. S7B). Notably, whereas other ENPP3 isoforms were expressed proportionally with the canonical isoform, expression of ENPP3[L2a/AluSx] and CTAGE9 did not follow this pattern and appeared to be independently regulated (Fig. 6C).
Fig. 6.
Effect of local RTEs on ENPP3 functional and non-functional isoform balance. A Gene structure and exonised RTEs, GENCODE-annotated and assembled transcripts, and RNA-seq traces of 24 combined KIRC and KIRP samples at the ENPP3 locus. B Expression of transcripts overlapping the indicated ENNP3 isoforms or overlapping genes and RTEs in normal kidney tissue and KIRC samples, ordered according to canonical ENPP3 expression. C Correlation of ENPP3 isoform and CTAGE9 expression (TPM) in KIRC samples (n = 538) (p values calculated with linear regression). CTAGE9 expression is capped at 30 TPM. D Overall survival hazard ratios (HRs) for the indicated variables in KIRC patients (ENPP3 canonical high n = 311, reference low n = 210; ENPP3[L2a/AluSx] high n = 214, reference low n = 307; CTAGE9 high n = 174, reference low n = 347; Age n = 521; Stage II n = 56, III n = 123, IV n = 82, reference I n = 257; Gender, male n = 338, reference female n = 183; Ethnicity, Asian n = 8, African n = 55, reference White n = 450). Error bars represent 95% CIs (p values calculated with Cox proportional hazards regression). E Overall survival of KIRC patients, stratified by ENPP3 expression (left) or the fraction of the canonical ENPP3 isoform in total ENPP3 expression (right) (p values calculated with log-rank tests)
ENPP3, also known as CD203c, is a type II transmembrane protein that catalyses the hydrolysis of extracellular nucleotides [68]. It was originally identified as a basophil and mast cell activation marker, regulating allergic inflammation by hydrolysing extracellular ATP [68, 69]. More recently, ENPP3 has also been implicated in the regulation of extracellular levels of cGAMP (2′3′-cyclic guanosine monophosphate), a second messenger for the activation of the STING (stimulator of interferon genes) pathway and the production of type I IFNs in viral infection and cancer [70]. Supporting a pro-tumour role, loss of ENPP3 cGAMP hydrolase activity in mice renders them more resistant to primary tumour growth and metastasis [70]. In addition to regulating the tumour immune environment, cell-intrinsic expression of ENPP3 has been reported to promote cell migration [71] and to be essential for the growth of renal cell carcinoma cell lines [67], further supporting a pro-tumour function. We, therefore, considered the potential activity of the alternative ENPP3 isoforms.
Exonisation of the AluSx3 element after the first coding exon of in the ENPP3[AluSx3/L2a] isoform creates a premature termination after codon 53, producing a severely truncated product (UniProt ID: E7ETI7), unlikely to retain any function. The ENPP3[L2a/AluSx] isoform has the potential to produce a larger protein, retaining the transmembrane helix and most of the phosphodiesterase domain, but missing the nuclease domain (Additional file 1: Fig. S8 A), which could exert altered enzymatic activities. However, in contrast to the canonical isoform, which was readily detectable upon overexpression in HEK293 T cells, the ENPP3[L2a/AluSx] isoform failed to produce a product of the expected or higher mass, indicative of protein instability (Additional file 1: Fig. S8B). These results suggested that alternative ENPP3 isoforms are non-functional and their production is, therefore, at the expense of the canonical, thereby compromising the maximum capacity of the locus to produce the ENPP3 enzymatic activity. In turn, the reduction in ENPP3 potential could impede tumour progression. In multivariate analyses, overall ENPP3 transcription was associated with favourable outcome in KIRC, as previously reported [66, 67], whereas CTAGE9, which encodes the cutaneous T cell lymphoma-associated antigen 9, showed the inverse association (Fig. 6D). Pertinently, a low proportion of canonical ENPP3 among ENPP3 isoforms was significantly associated with better survival in KIRC (Fig. 6E), supporting a model where the degree of switching to non-functional ENPP3 isoforms through RTE co-option correlated with disease outcome.
Loss of tumour cell-intrinsic CHRNA5 function by Alu exonisation
CHRNA5 (cholinergic receptor nicotinic alpha 5 subunit) encodes the alpha 5 subunit of heteropentameric nicotinic acetylcholine receptor (nAChR) complexes, which initiate signalling cascades upon ligand-gated ion influx [72]. Multiple studies have linked a genetic variant in CHRNA5 exon 5 (rs16969968) with susceptibility to lung cancer, both through indirect effects on nicotine dependence and smoking behaviour, and through direct tumour cell-intrinsic effects [73–76]. A direct effect of CHRNA5 expression on tumour cell-intrinsic growth, migration and invasion has been supported by several in vitro studies, although the outcome is likely dependent on the expression pattern of other nAChR subunits expressed in each experimental system [77–80].
The regulated use of alternative splice donor sites within exon 5 generates several annotated CHRNA5 isoforms that all use the canonical terminal exon 6 [81, 82] (Fig. 7A). We have identified a novel transcript, referred to here as CHRNA5[AluSz], which uses an intronic AluSz element as alternative terminal exon and polyadenylation site (Fig. 7A). AluSz exonisation was confirmed by RT-PCR in HEK293 T, lung adenocarcinoma A549 and oesophageal adenocarcinoma OE19 cells (Additional file 1: Fig. S9), as well as by analysis of long-read RNA-seq data from HEK293 T and A549 cells [22], and oesophageal squamous cell carcinoma (ESCC) TE5 and normal immortalised oesophageal squamous epithelial SHEE cells [21] (Additional file 1: Fig. S10 A). Remarkably, CHRNA5[AluSz] appeared to be the dominant isoform in fully transformed A549 and TE5 cells, whereas the balance shifted in favour of the canonical isoform in HEK293 T and non-transformed SHEE cells (Additional file 1: Fig. S10 A). Predominant expression of the CHRNA5[AluSz] isoform was also apparent when assessed by RT-qPCR in A549 cells (Fig. 7B) and was also observed in analysis of RNA-seq data from NSCLC and ESCC cell lines in CCLE, whereas several neuroblastoma cell lines, originating from a tissue where CHRNA5 is physiologically highly expressed, exhibited expression additionally of the canonical isoform (Additional file 1: Fig. S10B). These results implied that, despite not being previously identified, CHRNA5[AluSz] is the major isoform expressed particularly in cancer. Consistent, with this notion, both the canonical and the CHRNA5[AluSz] isoforms were highly upregulated in several cancer types, compared with the respective normal tissues, with expression of the CHRNA5[AluSz] approaching or often exceeding that of the canonical isoform (Additional file 1: Fig. S11).
Fig. 7.
Characterisation of the CHRNA5[AluSz] isoform. A Gene structure and location of exonised AluSz, assembled CHRNA5[AluSz] transcript, and RNA-seq traces of 24 combined LUAD and LUSC samples at the CHRNA5 locus. BCHRNA5 and CHRNA5[AluSz] expression (assessed by RT-PCR and plotted relatively to HPRT1 expression) in A549 cells. Symbols represent replicates (n = 3) from a single experiment (p value calculated with two-tailed Student’s t-test). CLeft, Schematic representation of CHRNA5 cDNA minigene constructs retaining only intron 5 either with the reference complement of RTEs (full intron 5) or with the AluSz and adjacent L1PB1 and AluSx4 elements deleted (RTE-deleted), and of the amplicon used to measure expression. Right, Total CHRNA5 expression (assessed by RT-PCR and plotted relatively to HPRT1 expression), and ratio of CHRNA5[intron5] to CHRNA5[exon6] in parental A549 cells or those transfected with either construct. Symbols represent replicates (n = 3) from a single experiment (p values calculated with two-tailed Student’s t-tests between the full intron 5 and RTE-deleted transfections). D Representative crystal violet staining of in vitro migrated parental A549 cells and A549 cells expressing the canonical CHRNA5, the CHRNA5[AluSz] or both isoforms (left) (scale bar = 200 µm), and quantitation of the migrated cell number of each genotype (right). Symbols represent independent measurements (n = 8, 4 fields of view from 2 independent experiments; p values calculated with Kruskal–Wallis test with Dunn’s multiple comparisons correction). E Correlation of CHRNA5 and CHRNA5[AluSz] expression in LUAD samples (n = 419) (p value calculated with linear regression). F Overall survival of LUAD patients, stratified by CHRNA5 expression (left) or the ratio of CHRNA5[AluSz] to CHRNA5 expression (right) (p values calculated with log-rank tests)
To examine the effect of the intronic RTEs on CHRNA5[AluSz] expression, we tested minigene constructs of CHRNA5 cDNA retaining only intron 5 with the reference complement of RTEs or with the AluSz and adjacent L1PB1 and AluSx4 elements deleted (Fig. 7C). Overall CHRNA5 transcription from either minigene construct transfected into A549 cells exceeded endogenous CHRNA5 expression by at least one order of magnitude, but deletion of intronic RTEs resulted in higher levels of transcription compared with the full intron 5 (Fig. 7C). Moreover, deletion of the intronic RTEs caused a significant shift in the balance of the two isoforms in favour of the canonical isoform terminating in exon 6 (CHRNA5[exon6]), although isoforms produced by continued transcription into intron 5 (CHRNA5[intron5]) still remained dominant (Fig. 7C). These results suggested that, although not essential, the presence of the specific RTEs in CHRNA5 intron 5 favours the production of the intronically terminated CHRNA5 isoform over the canonical.
Given its high expression, we next assessed the potential of the CHRNA5[AluSz] isoform to produce a functional protein. At the protein level, AluSz exonisation replaces the last 52 amino acids, which are encoded by canonical exon 6 and include the 4 th transmembrane helix of CHRNA5, with as shorter sequence, predicted to remain cytoplasmic (Additional file 1: Fig. S12 A, B). Expression of HA-tagged versions of the canonical CHRNA5 and CHRNA5[AluSz] protein isoforms showed equivalent cell-surface expression in HEK293 T, visualised by immunofluorescence (Additional file 1: Fig. S12 C), indicating efficient translation and plasma membrane trafficking of both. To examine the potential biological activity of the CHRNA5[AluSz] protein, we stably expressed either isoform in A549 cells (Additional file 1: Fig. S13). Neither isoform significantly affected the in vitro growth rate of A549 cells (Additional file 1: Fig. S14). Consistent with prior reports [79, 80], expression of the canonical isoform dramatically enhanced migration of A549 cells, whereas expression of CHRNA5[AluSz] had no apparent effect (Fig. 7D). These results suggested that the loss of the last transmembrane helix resulted in a non-functional CHRNA5 isoform. Interestingly, acquired mutations resulting in an identical truncation of CHRNA6 have been found responsible for evolved insect resistance to insecticides [83], further highlighting the essential function of the last transmembrane helix. To test whether incorporation of the truncated CHRNA5[AluSz] protein into heteropentamers could potentially interfere with the function of the canonical, we co-expressed both isoforms in A549 cells (Additional file 1: Fig. S13). In this setting, cell migration was still significantly enhanced in doubly-expressing A549 cells, at levels comparable with those of A549 cells expressing the canonical isoform only (Fig. 7D). These findings argued against a negative effect of CHRNA5[AluSz], in agreement with the lack of ligand binding by the CHRNA5 subunit [72].
Collectively, these results indicated that the switch to CHRNA5[AluSz] expression we observed in cancer would severely compromise the levels of canonical CHRNA5 that would otherwise be produced and, in turn, reduce the pro-tumour effects of CHRNA5 expression. A similar effect could also be achieved by alternative splicing within exon 5, causing a frame-shift in the translation of the exon 6 and producing a similarly truncated isoform (NCBI ID: NP_001382100). Although other alternative, non-functional isoforms can be detected [81, 82], the CHRNA5[AluSz] appears to be the dominant isoform (Additional file 1: Fig. S10). Expression of CHRNA5[AluSz] was significantly correlated with that of the canonical isoform in LUAD samples, although their ratio varied considerably among individual cases (Fig. 7E). In agreement with a pro-tumour role, high overall CHRNA5 transcription was associated with worse prognosis in LUAD (Fig. 7F). However, a higher fraction of CHRNA5 transcription diverted to the CHRNA5[AluSz] isoform was associated with better prognosis in the same cohort (Fig. 7F), suggesting a protective effect of a switch to the non-functional isoform.
Evolutionary consideration of RTEs affecting tumour-promoting genes
The individual examples of RTE effects on tumour-promoting genes indicated distinct potential mechanisms underlying the transcriptional activation and utilisation of the RTEs involved. In the cases of ENPP3 and CHRNA5, transcription of which is strongly upregulated in tumours, it was possible that the epigenetic changes or selection processes that lead to their upregulation are also responsible for transcriptional utilisation of embedded RTEs that are subsequently exonised, partially counteracting the upregulation of the functional gene isoforms. The RTEs involved in these cases are short, intronic repeats of the Alu and L2a families, that appear to have integrated into the ENPP3 and CHRNA5 loci between 75 and 100 million years ago (Fig. 8A), in line with the evolutionary age of the respective families [1], and have been preserved in the human genome.
Fig. 8.
Evolutionary conservation of RTEs affecting tumour-promoting genes. A Estimation of the evolutionary age of the specific RTE integrations (underlined) in the indicated genes, based on genomic sequence alignments. B Nucleotide sequence homology over the proviral length of the HERVE 6q15 (8.4 Kb) and HERVH Xp22.2 (5.3 Kb) integrations between humans and the indicated species. Negative values of absolute complexity denote dissimilarity and numbers in brackets represent percent sequence identity. The gap in the gorilla HERVH Xp22.2 sequence is due to low-quality sequence
In contrast, other loci, including RNGTT, the TLR7 and TLR8 loci, and CDH4, are constitutively or inducibly expressed also in healthy tissue and their expression in tumours is downregulated by the independent transcriptional activation of nearby RTEs. The RTEs involved in these cases are LTR elements, integrated more recently in evolutionary history (Fig. 8A), that have retained the ability to initiate transcription. The HERVE 6q15 and HERVH Xp22.2 loci, regulating RNGTT and the TLR7 and TLR8 loci, respectively, represent complete or near complete proviruses that are well conserved since their integration into the genome of primate ancestors (Fig. 8B). Indeed, sequence identity of the HERVE 6q15 provirus between humans and the other higher primates, in which it is found, is comparable or higher than that expected by estimates of the rate of synonymous mutations in coding genes [84], whereas the slightly older HERVH Xp22.2 provirus is relatively less conserved and has sustained a large deletion in the gibbon genome (Fig. 8B). While these examples do not allow broad generalisation, they do highlight the potential for evolutionary conserved RTEs to participate in the negative regulation of tumour-promoting genes.
Discussion
Evolutionary selection against deleterious effects is constantly depleting the germline of RTE integrations that pose a threat to nearby genes [85]. Nevertheless, numerous recent germline RTE integrations can adversely affect gene function, when the mechanisms that normally prevent their transcription and inclusion in gene transcripts fail. Our data indicate that transcriptional activation of RTEs causes widespread disruption of the transcriptional programme in cancer. Although they would be expected to be counterselected during tumour evolution, we identified several exemplar cases where transcriptional activation of embedded RTEs disrupts the function of a tumour-promoting or essential gene. Our assembly was guided by the current reference genome (GRCh38/hg38), which may be incomplete both in terms of sequence and RTE annotation. The recent release of the single haploid T2 T-CHM13 assembly [32] completed sequence gaps and uncovered thousands of additional RTE integrations [86]. With greater appreciation of the degree of human genetic diversity, including in RTE content, more cases of RTE effects will be expected to be captured in future studies. The identification of such cases also offers the possibility of developing therapeutic interventions aiming to augment the negative impact of RTEs on the function of nearby tumour-promoting genes, while sparing an essential function of the same genes in non-transformed cells, where these RTEs are not activated.
Transcriptionally activated RTEs appear to disrupt the function of adjacent protein-coding genes by two main mechanisms. The first is reduction in the transcription of the protein-coding isoform by RTE-initiated antisense transcription, as exemplified here by RNGTT, CDH4, TLR7 and APOBEC3B. Antisense transcription has long been recognised as a mechanism of gene regulation more broadly [87]. Furthermore, RTEs have also been implicated in the initiation of cis antisense transcripts that may regulate gene expression under physiological conditions [88]. Of note, RTE integrations driving cis natural antisense transcripts are enriched near the 3′ UTR of genes and belong to relatively older L2 and MIR subfamilies of non-LTR elements, implying they have been selected during evolution [88]. In contrast, RTEs identified here as regulators of cancer-promoting genes are primarily intergenic or intronic integrations of HERVs and other LTR elements, suggesting that the transcriptional activation of otherwise suppressed RTEs may extend regulation by antisense transcription to a new set of genes specifically in cancer.
The second mechanism by which transcriptionally activated RTEs can disrupt gene function is a switch to the production of non-functional isoforms by RTE-exonisation and alternative splicing. Switch to a non-functional isoform can be at the expense of the canonical protein-coding isoform, with mutually exclusive expression of the two. However, non-functional RTE-exonising isoforms may also be expressed proportionally with the canonical, yet considerably reduce the functional output the gene would otherwise produce. Such an effect on gene function would still be strong, particularly when the non-functional isoform becomes the dominant isoform, as in the case of CHRNA5[AluSz]. The switch to non-functional isoforms appears to involve younger RTEs of the Alu and L1 subfamilies, the transcriptional utilisation of which is shared by diverse cancer types. A cancer-specific switch to non-functional isoforms may also explain the previously noted poor correlation between abundance of RNA transcripts, the quantitation of which often ignores the functional potential, and protein levels encoded from at least some genes in cancer [89].
Widespread RTE-mediated loss of function of tumour-promoting genes, as suggested by our findings, is seemingly at odds with the expected effect on tumour fitness that would disadvantage such events during tumour evolution, but may be further supported by recent evidence. A hypoxia-responsive LTR12B RTE has been reported to act as a cryptic promoter of an alternative isoform of POU5 F1, encoding the pluripotency transcription factor OCT4, producing a likely non-functional version of this tumour-promoting protein in renal cell carcinoma [90]. Similarly, antisense transcription has been reported to regulate levels of the E3 ubiquitin ligase HECTD2, which would otherwise exert a clear tumour-promoting effect in melanoma [91].
Transcriptional activation of intronic RTEs has also been linked with incomplete mRNA splicing, which reduces levels of fully spliced, functional mRNA isoforms and, consequently, tumour cell fitness [92]. Although prior examples in cancer may be limited, similar events have been reported to affect gene function also in physiological conditions. For example, a truncated, non-functional form of ACE2 is produced during infection or inflammation by an IFN-responsive MIRb element, acting as an alternative promoter [93]. The use of an intronic L2a element as an alternative terminal exon creates a CD274 isoform that encodes a soluble version of PD-L1, which not only lacks suppressive activity, but also antagonises the immunosuppressive, membrane-bound, canonical PD-L1 [94]. Similarly, the use of an intronic Alu element creates an isoform of IFNAR2, encoding a truncated version of the type I IFN receptor subunit 2, acting as a decoy receptor [95].
Collectively, these findings underscore the mutagenic potential of RTE insertions, which may be higher than previously appreciated and further enhanced in cancer by their release from epigenetic control. Dysregulation of RTEs in cancer is considered to serve as a warning signal for the emergence of transformed cells. Transcriptional activation of RTEs creates immunogenic ligands that are recognised by innate immune sensors and adaptive antigen receptors, thereby contributing to tumour immunogenicity and immune control [96, 97]. A potential effect of transcriptionally activated RTEs on the function of tumour-promoting or essential genes may represent an additional barrier to transformation. Similar to the immunogenic functions of transcriptionally activated RTEs, disruption of the cancer transcriptional programme would be subject to counterselection during evolution of individual tumours, but it may be positively selected during the evolution of the host species. Whereas the evolution of new function from RTE exaptation, particularly their utilisation in functional proteins, is thought to be a slow evolutionary process [98], the regulation of adjacent gene function by co-option of transcriptionally metastable RTE integrations may evolve faster.
Several of the genes affected by transcriptional activation of RTEs are known to exert strong cell-intrinsic pro-tumour effects. Considered in isolation, this finding would support a potential anti-tumour role for RTE dysregulation through the disruption of the function of those genes. However, there are a number of confounding factors that increase the complexity of these effects.
Some of the affected genes are pleiotropic, with both tumour cell-intrinsic effects and effects on the immune or stroma microenvironment that can indirectly influence tumour grown. Direct and indirect effects of an affected gene can synergise to promote tumour growth. For example, HECTD2 drives tumour cell-intrinsic proliferation of melanoma cells, as well as the production of immunosuppressive mediators [91], whereas ectopic expression of CALB1 prevents senescence of squamous lung carcinoma cells, but also prevents pro-tumour recruitment of neutrophils by chemokines that would otherwise be secreted as part of the senescence-associated secretory phenotype [13]. Similarly, ENPP3 promotes cell-intrinsic growth and migration of renal cell carcinoma cells [67, 71], but also regulates the availability of STING ligands for immune cells [70], and given its central role in RNA capping, RNGTT has the potential to affect many other genes with indirect effects on tumour growth.
Moreover, while the function of a gene may be clearly pro-tumour in the context of an established tumour or cell line, it may play a different role at a different stage during cancer initiation and progression. It may also be the case that the relative fitness cost incurred by RTE-mediated disruption of pro-tumour gene function is a late event in tumour progression, by which time clonal competition between tumour cells has taken place. It may also be that such fitness costs are an unavoidable consequence of global RTE activation during tumour evolution, but offset by gains in tumour-promoting functions resulting from the same underlying epigenetic changes, so that the net effect on tumour growth is positive, and the effect on each gene has to be considered in the context of all other changes. Lastly, an overall negative effect on tumour cell-intrinsic growth caused of RTE-mediated disruption of the cancer transcriptional programme may still benefit tumours by restraining the exponential growth of late-stage tumours that would otherwise outrun or outpace available resources.
Conclusions
In summary, we have characterised specific cases of tumour-promoting genes, the function of which is disrupted by RTE integrations that are activated during cellular transformation. Such RTEs can therefore sense the epigenetic and transcriptional alterations in transformed cells and potentially act to protect against cancer. Regardless of the ultimate effect on tumour growth, the identification of metastable RTE integrations able to disrupt gene function in cancer deepens our understanding of tumour evolution and offers opportunities for intervention.
Supplementary Information
Supplementary Material 1. Additional file 1: Fig. S1. HERVE 6q15 responsiveness to hypoxia. Fig. S2. Essential function of RNGTT in cancer cell lines. Fig. S3. CRISPR/Cas9-mediated deletion of the HERVE 6q15 provirus. Fig. S4. Correlation of RNGTT and HERVE 6q15 expression with survival in KIRC. Fig. S5. HERVH Xp22.2 expression across cancers and correlation with TLR7, TLR8 and PRPS2 expression in LUAD. Fig. S6. APOBEC3B-AS1 expression across cancers and normal tissues. Fig. S7. Cancer specificity of ENNP3, and overlapping gene and RTE expression in KIRC. Fig. S8. Instability of the ENPP3[L2a/AluSx] protein product. Fig. S9. PCR validation of the CHRNA5[AluSz] isoform. Fig. S10. Balance of CHRNA5 isoform expression in cancer cell lines. Fig. S11. CHRNA5 and CHRNA5[AluSz] expression across cancers and normal tissues. Fig. S12. Sequence and expression of the CHRNA5[AluSz] protein. Fig. S13. Establishment of A549 cells expressing CHRNA5 and CHRNA5[AluSz]. Fig. S14. Effect of CHRNA5 and CHRNA5[AluSz] expression on A549 in vitro growth.
Acknowledgements
We are grateful for assistance from the Advanced Sequencing, Cell Services, Flow cytometry, High Throughput Screening, Advanced Light Microscopy and Scientific Computing facilities at the Francis Crick Institute. The results shown here are in whole or part based upon data generated by the TCGA Research Network.
Abbreviations
- APOBEC3
Apolipoprotein B editing complex 3
- CCLE
Cancer Cell Line Encyclopedia
- CDH4
Cadherin 4
- cGAMP
2′3′-Cyclic guanosine monophosphate
- CHRNA5
Cholinergic receptor nicotinic alpha 5 subunit
- COAD
Colon adenocarcinoma
- EAC
Oesophageal adenocarcinoma
- ENPP3
Ectonucleotide pyrophosphatase/phosphodiesterase 3
- ESCC
Oesophageal squamous cell carcinoma
- GFP
Green fluorescent protein
- GTEx
The Genotype-Tissue Expression
- HA
Hemagglutinin
- HERV
Human endogenous retrovirus
- IFN
Interferon
- KIRC
Kidney renal clear cell carcinoma
- LTR
Long terminal repeat
- LUAD
Lung adenocarcinoma
- LUSC
Lung squamous cell carcinoma
- MESO
Mesothelioma
- nAChR
Nicotinic acetylcholine receptor
- NSCLC
Non-small cell lung carcinomas
- OV
Ovarian serous cystadenocarcinoma
- PCR
Polymerase chain reaction
- PRPS2
Phosphoribosyl pyrophosphate synthetase 2
- RNA-seq
RNA-sequencing
- RNGTT
RNA guanylyltransferase and 5′-phosphatase
- RTEs
Retrotransposable elements
- RT-qPCR
Reverse transcriptase-based quantitative PCR
- SKCM
Skin cutaneous melanoma
- STING
Stimulator of interferon genes
- TCGA
The Cancer Genome Atlas Program
- TGCT
Testicular germ cell tumours
- TLR
Toll-like receptor
- TPM
Transcripts per million
- VHL
Von Hippel-Lindau
Authors’ contributions
G.K. conceived and designed the study. J.L., R.T., C.H., L.D., J.P., and T.P. performed the experiments and acquired the data. J.L., R.T., C.H., L.D., J.P., T.P. and G.K. analysed and interpreted the data. J.L., R.T., C.H. and G.K. drafted and revised the manuscript. All authors read and approved the final manuscript.
Funding
Open Access funding provided by The Francis Crick Institute This work was supported by the Francis Crick Institute (CC2088), which receives its core funding from Cancer Research UK, the UK Medical Research Council and the Wellcome Trust. This project has received funding from the European Research Council (ERC) under the European Union’s Horizon 2020 research and innovation program (grant agreement No. 101018670). The Genotype-Tissue Expression (GTEx) Project was supported by the Common Fund of the Office of the Director of the National Institutes of Health and by NCI, NHGRI, NHLBI, NIDA, NIMH and NINDS. For the purpose of Open Access, the author has applied a CC BY public copyright licence to any Author Accepted Manuscript version arising from this submission.
Data availability
The RNA-seq data generated in this study have been deposited at the EMBL-EBI repository (E-MTAB-14514).
Declarations
Ethics approval and consent to participate
Not applicable. This manuscript has only analysed published publicly available data.
Consent for publication
Not applicable. This manuscript has only analysed published publicly available data.
Competing interests
G.K. is a scientific co-founder of EnaraBio and a member of its scientific advisory board. G.K. has consulted for EnaraBio, Repertoire Immune Medicines, ErVimmune and AdBio Partners. The other authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Jane Loong and Rachael Thompson contributed equally to this work.
References
- 1.Wells JN, Feschotte C. A field guide to eukaryotic transposable elements. Annu Rev Genet. 2020;54:539–61. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Mills RE, Bennett EA, Iskow RC, Devine SE. Which transposable elements are active in the human genome? Trends Genet. 2007;23:183–91. [DOI] [PubMed] [Google Scholar]
- 3.Fueyo R, Judd J, Feschotte C, Wysocka J. Roles of transposable elements in the regulation of mammalian transcription. Nat Rev Mol Cell Biol. 2022;23:481–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Modzelewski AJ, Gan Chong J, Wang T, He L. Mammalian genome innovation through transposon domestication. Nat Cell Biol. 2022;24:1332–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Chuong EB, Elde NC, Feschotte C. Regulatory activities of transposable elements: from conflicts to benefits. Nat Rev Genet. 2017;18:71–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Wang Y, Bernhardy AJ, Nacson J, Krais JJ, Tan YF, Nicolas E, Radke MR, Handorf E, Llop-Guevara A, Balmaña J, et al. BRCA1 intronic Alu elements drive gene rearrangements and PARP inhibitor resistance. Nat Commun. 2019;10:5661. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.van Belzen I, Cai C, van Tuil M, Badloe S, Strengman E, Janse A, Verwiel ETP, van der Leest DFM, Kester L, Molenaar JJ, et al. Systematic discovery of gene fusions in pediatric cancer by integrating RNA-seq and WGS. BMC Cancer. 2023;23:618. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Ishak CA, De Carvalho DD. Reactivation of endogenous retroelements in cancer development and therapy. Annu Rev Cancer Biol. 2020;4:159–76. [Google Scholar]
- 9.Burns KH. Transposable elements in cancer. Nat Rev Cancer. 2017;17:415–24. [DOI] [PubMed] [Google Scholar]
- 10.Attig J, Young GR, Hosie L, Perkins D, Encheva-Yokoya V, Stoye JP, Snijders AP, Ternette N, Kassiotis G. LTR retroelement expansion of the human cancer transcriptome and immunopeptidome revealed by de novo transcript assembly. Genome Res. 2019;29:1578–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Lamprecht B, Walter K, Kreher S, Kumar R, Hummel M, Lenze D, Köchert K, Bouhlel MA, Richter J, Soler E, et al. Derepression of an endogenous long terminal repeat activates the CSF1R proto-oncogene in human lymphoma. Nat Med. 2010;16:571–9 571p following 579. [DOI] [PubMed] [Google Scholar]
- 12.Babaian A, Romanish MT, Gagnier L, Kuo LY, Karimi MM, Steidl C, Mager DL. Onco-exaptation of an endogenous retroviral LTR drives IRF5 expression in Hodgkin lymphoma. Oncogene. 2016;35:2542–6. [DOI] [PubMed] [Google Scholar]
- 13.Attig J, Pape J, Doglio L, Kazachenka A, Ottina E, Young GR, Enfield KS, Aramburu IV, Ng KW, Faulkner N, et al. Human endogenous retrovirus onco-exaptation counters cancer cell senescence through calbindin. J Clin Invest. 2023;133:e164397. [DOI] [PMC free article] [PubMed]
- 14.Wiesner T, Lee W, Obenauf AC, Ran L, Murali R, Zhang QF, Wong EW, Hu W, Scott SN, Shah RH, et al. Alternative transcription initiation leads to expression of a novel ALK isoform in cancer. Nature. 2015;526:453–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Jang HS, Shah NM, Du AY, Dailey ZZ, Pehrsson EC, Godoy PM, Zhang D, Li D, Xing X, Kim S, et al. Transposable elements drive widespread expression of oncogenes in human cancers. Nat Genet. 2019;51:611–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.TCGA: The cancer genome atlas program research network. http://cancergenome.nih.gov.
- 17.GTEx: The Genotype-Tissue Expression (GTEx) project. https://www.gtexportal.org.
- 18.dbGaP: The database of genotypes and phenotypes. https://dbgap.ncbi.nlm.nih.gov. [DOI] [PMC free article] [PubMed]
- 19.CCLE: Cancer cell line encyclopedia. https://portals.broadinstitute.org/ccle/data.
- 20.Smythies JA, Sun M, Masson N, Salama R, Simpson PD, Murray E, Neumann V, Cockman ME, Choudhry H, Ratcliffe PJ, Mole DR. Inherent DNA-binding specificities of the HIF-1α and HIF-2α transcription factors in chromatin. EMBO Rep. 2019;20:e46401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Cheng YW, Chen YM, Zhao QQ, Zhao X, Wu YR, Chen DZ, Liao LD, Chen Y, Yang Q, Xu LY, et al. Long read single-molecule real-time sequencing elucidates transcriptome-wide heterogeneity and complexity in esophageal squamous cells. Front Genet. 2019;10: 915. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Chen Y, Davidson NM, Wan YK, Yao F, Su Y, Gamaarachchi H, Sim A, Patel H, Low HM, Hendra C, et al. A systematic benchmark of Nanopore long read RNA sequencing for transcript level analysis in human cell lines. Nat Methods. 2025;22:801–12. [DOI] [PMC free article] [PubMed]
- 23.Loong JH, Thompson R, Hall C, Doglio L, Pape J, Plowman T, Kassiotis G: RNA-seq of A498 cells with deletion in HERVE 6q15. EMBL-EBI repository. 2025. https://www.ebi.ac.uk/arrayexpress/E-MTAB-14514.
- 24.Tange O. GNU parallel: the command-line power tool. USENIX Magazine. 2011;36:42–7. [Google Scholar]
- 25.Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, Whitwham A, Keane T, McCarthy SA, Davies RM, Li H. Twelve years of SAMtools and BCFtools. Gigascience. 2021;10:giab008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Patro R, Duggal G, Love MI, Irizarry RA, Kingsford C. Salmon provides fast and bias-aware quantification of transcript expression. Nat Methods. 2017;14:417–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Thorvaldsdóttir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief Bioinform. 2013;14:178–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Li H. Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics. 2018;34:3094–100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Tang AD, Soulette CM, van Baren MJ, Hart K, Hrabeta-Robinson E, Wu CJ, Brooks AN. Full-length transcript characterization of SF3B1 mutation in chronic lymphocytic leukemia reveals downregulation of retained introns. Nat Commun. 2020;11:1438. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Lombardi O, Li R, Halim S, Choudhry H, Ratcliffe PJ, Mole DR. Pan-cancer analysis of tissue and single-cell HIF-pathway activation using a conserved gene signature. Cell Rep. 2022;41: 111652. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Attig J, Young GR, Stoye JP, Kassiotis G. Physiological and pathological transcriptional activation of endogenous retroelements assessed by RNA-sequencing of B lymphocytes. Front Microbiol. 2017;8: 2489. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Nurk S, Koren S, Rhie A, Rautiainen M, Bzikadze AV, Mikheenko A, Vollger MR, Altemose N, Uralsky L, Gershman A, et al. The complete sequence of a human genome. Science. 2022;376:44–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Kolberg L, Raudvere U, Kuzmin I, Adler P, Vilo J, Peterson H. g:Profiler-interoperable web service for functional enrichment analysis and gene identifier mapping (2023 update). Nucleic Acids Res. 2023;51:W207–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Ensembl: Comparative genomics tool. https://www.ensembl.org/info/genome/compara/multiple_genome_alignments.html.
- 35.Tsherniak A, Vazquez F, Montgomery PG, Weir BA, Kryukov G, Cowley GS, Gill S, Harrington WF, Pantel S, Krill-Burger JM, et al. Defining a cancer dependency map. Cell. 2017;170:564–576.e516. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Takahashi Y, Harashima N, Kajigaya S, Yokoyama H, Cherkasova E, McCoy JP, Hanada K, Mena O, Kurlander R, Tawab A, et al. Regression of human kidney cancer following allogeneic stem cell transplantation is associated with recognition of an HERV-E antigen by T cells. J Clin Invest. 2008;118:1099–109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Cherkasova E, Malinzak E, Rao S, Takahashi Y, Senchenko VN, Kudryavtseva AV, Nickerson ML, Merino M, Hong JA, Schrump DS, et al. Inactivation of the von Hippel-Lindau tumor suppressor leads to selective expression of a human endogenous retrovirus in kidney cancer. Oncogene. 2011;30:4697–706. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Smith CC, Beckermann KE, Bortone DS, De Cubas AA, Bixby LM, Lee SJ, Panda A, Ganesan S, Bhanot G, Wallen EM, et al. Endogenous retroviral signatures predict immunotherapy response in clear cell renal cell carcinoma. J Clin Invest. 2018;128:4804–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Au L, Hatipoglu E, Robert de Massy M, Litchfield K, Beattie G, Rowan A, Schnidrig D, Thompson R, Byrne F, Horswell S, et al. Determinants of anti-PD-1 response and resistance in clear cell renal cell carcinoma. Cancer Cell. 2021;39:1497–1518.e1411. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Borden K, Culjkovic-Kraljacic B, Cowling VH. To cap it all off, again: dynamic capping and recapping of coding and non-coding RNAs to control transcript fate and biological activity. Cell Cycle. 2021;20:1347–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Borden KLB. Cancer cells hijack RNA processing to rewrite the message. Biochem Soc Trans. 2022;50:1447–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Faraji F, Hu Y, Wu G, Goldberger NE, Walker RC, Zhang J, Hunter KW. An integrated systems genetics screen reveals the transcriptional structure of inherited predisposition to metastatic disease. Genome Res. 2014;24:227–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Inuzuka H, Miyatani S, Takeichi M. R-cadherin: a novel Ca(2+)-dependent cell-cell adhesion molecule expressed in the retina. Neuron. 1991;7:69–79. [DOI] [PubMed] [Google Scholar]
- 44.Leckband DE, de Rooij J. Cadherin adhesion and mechanotransduction. Annu Rev Cell Dev Biol. 2014;30:291–315. [DOI] [PubMed] [Google Scholar]
- 45.Kaszak I, Witkowska-Piłaszewicz O, Niewiadomska Z, Dworecka-Kaszak B, Ngosa Toka F, Jurka P. Role of cadherins in cancer-a review. Int J Mol Sci. 2020;21:7624. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Wheelock MJ, Shintani Y, Maeda M, Fukumoto Y, Johnson KR. Cadherin switching. J Cell Sci. 2008;121:727–35. [DOI] [PubMed] [Google Scholar]
- 47.Haass NK, Smalley KS, Li L, Herlyn M. Adhesion, migration and communication in melanocytes and melanoma. Pigment Cell Res. 2005;18:150–9. [DOI] [PubMed] [Google Scholar]
- 48.Kreizenbeck GM, Berger AJ, Subtil A, Rimm DL, Gould Rothberg BE. Prognostic significance of cadherin-based adhesion molecules in cutaneous malignant melanoma. Cancer Epidemiol Biomarkers Prev. 2008;17:949–58. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Maeda M, Johnson E, Mandal SH, Lawson KR, Keim SA, Svoboda RA, Caplan S, Wahl JK 3rd, Wheelock MJ, Johnson KR. Expression of inappropriate cadherins by epithelial tumor cells promotes endocytosis and degradation of E-cadherin via competition for p120(ctn). Oncogene. 2006;25:4595–604. [DOI] [PubMed] [Google Scholar]
- 50.Axberg I, Ramstedt U, Patarroyo M, Beatty P, Wigzell H. Inhibition of natural killer cell cytotoxicity by a monoclonal antibody directed against adhesion-mediating protein gp 90 (CD18). Scand J Immunol. 1987;26:547–54. [DOI] [PubMed] [Google Scholar]
- 51.Appolloni I, Barilari M, Caviglia S, Gambini E, Reisoli E, Malatesta P. A cadherin switch underlies malignancy in high-grade gliomas. Oncogene. 2015;34:1991–2002. [DOI] [PubMed] [Google Scholar]
- 52.Miotto E, Sabbioni S, Veronese A, Calin GA, Gullini S, Liboni A, Gramantieri L, Bolondi L, Ferrazzi E, Gafà R, et al. Frequent aberrant methylation of the CDH4 gene promoter in human colorectal and gastric cancer. Cancer Res. 2004;64:8156–9. [DOI] [PubMed] [Google Scholar]
- 53.Lind NA, Rael VE, Pestal K, Liu B, Barton GM. Regulation of the nucleic acid-sensing Toll-like receptors. Nat Rev Immunol. 2022;22:224–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Vinuesa CG, Grenov A, Kassiotis G. Innate virus-sensing pathways in B cell systemic autoimmunity. Science. 2023;380:478–84. [DOI] [PubMed] [Google Scholar]
- 55.Kaczanowska S, Joseph AM, Davila E. TLR agonists: our best frenemy in cancer immunotherapy. J Leukoc Biol. 2013;93:847–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Dajon M, Iribarren K, Cremer I. Dual roles of TLR7 in the lung cancer microenvironment. Oncoimmunology. 2015;4: e991615. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Cherfils-Vicini J, Platonova S, Gillard M, Laurans L, Validire P, Caliandro R, Magdeleinat P, Mami-Chouaib F, Dieu-Nosjean MC, Fridman WH, et al. Triggering of TLR7 and TLR8 expressed by human lung cancer cells induces cell survival and chemoresistance. J Clin Invest. 2010;120:1285–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Grimmig T, Matthes N, Hoeland K, Tripathi S, Chandraker A, Grimm M, Moench R, Moll EM, Friess H, Tsaur I, et al. TLR7 and TLR8 expression increases tumor cell proliferation and promotes chemoresistance in human pancreatic cancer. Int J Oncol. 2015;47:857–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Chatterjee S, Crozet L, Damotte D, Iribarren K, Schramm C, Alifano M, Lupo A, Cherfils-Vicini J, Goc J, Katsahian S, et al. TLR7 promotes tumor progression, chemotherapy resistance, and poor clinical outcomes in non-small cell lung cancer. Cancer Res. 2014;74:5008–18. [DOI] [PubMed] [Google Scholar]
- 60.Dajon M, Iribarren K, Petitprez F, Marmier S, Lupo A, Gillard M, Ouakrim H, Victor N, Vincenzo DB, Joubert PE, et al. Toll like receptor 7 expressed by malignant cells promotes tumor progression and metastasis through the recruitment of myeloid derived suppressor cells. Oncoimmunology. 2019;8: e1505174. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Baglivo S, Bianconi F, Metro G, Gili A, Tofanetti FR, Bellezza G, Ricciuti B, Mandarano M, Teti V, Siggillino A, et al. Higher TLR7 gene expression predicts poor clinical outcome in advanced NSCLC patients treated with immunotherapy. Genes (Basel). 2021;12:992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Stavrou S, Ross SR. APOBEC3 proteins in viral immunity. J Immunol. 2015;195:4565–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Swanton C, McGranahan N, Starrett GJ, Harris RS. APOBEC enzymes: mutagenic fuel for cancer evolution and heterogeneity. Cancer Discov. 2015;5:704–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Petljak M, Dananberg A, Chu K, Bergstrom EN, Striepen J, von Morgen P, Chen Y, Shah H, Sale JE, Alexandrov LB, et al. Mechanisms of APOBEC3 mutagenesis in human cancer cells. Nature. 2022;607:799–807. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Durfee C, Temiz NA, Levin-Klein R, Argyris PP, Alsøe L, Carracedo S, Alonso de la Vega A, Proehl J, Holzhauer AM, Seeman ZJ, et al. Human APOBEC3B promotes tumor development in vivo including signature mutations and metastases. Cell Rep Med. 2023;4:101211. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Doñate F, Raitano A, Morrison K, An Z, Capo L, Aviña H, Karki S, Morrison K, Yang P, Ou J, et al. AGS16F is a novel antibody drug conjugate directed against ENPP3 for the treatment of renal cell carcinoma. Clin Cancer Res. 2016;22:1989–99. [DOI] [PubMed] [Google Scholar]
- 67.Von Roemeling CA, Marlow LA, Radisky DC, Rohl A, Larsen HE, Wei J, Sasinowska H, Zhu H, Drake R, Sasinowski M, et al. Functional genomics identifies novel genes essential for clear cell renal cell carcinoma tumor cell proliferation and migration. Oncotarget. 2014;5:5320–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Borza R, Salgado-Polo F, Moolenaar WH, Perrakis A. Structure and function of the ecto-nucleotide pyrophosphatase/phosphodiesterase (ENPP) family: tidying up diversity. J Biol Chem. 2022;298: 101526. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Tsai SH, Kinoshita M, Kusu T, Kayama H, Okumura R, Ikeda K, Shimada Y, Takeda A, Yoshikawa S, Obata-Ninomiya K, et al. The ectoenzyme E-NPP3 negatively regulates ATP-dependent chronic allergic responses by basophils and mast cells. Immunity. 2015;42:279–93. [DOI] [PubMed] [Google Scholar]
- 70.Mardjuki R, Wang S, Carozza J, Zirak B, Subramanyam V, Abhiraman G, Lyu X, Goodarzi H, Li L. Identification of the extracellular membrane protein ENPP3 as a major cGAMP hydrolase and innate immune checkpoint. Cell Rep. 2024;43: 114209. [DOI] [PubMed] [Google Scholar]
- 71.Yano Y, Hayashi Y, Sano K, Nagano H, Nakaji M, Seo Y, Ninomiya T, Yoon S, Yokozaki H, Kasuga M. Expression and localization of ecto-nucleotide pyrophosphatase/phosphodiesterase I-1 (E-NPP1/PC-1) and -3 (E-NPP3/CD203c/PD-Ibeta/B10/gp130(RB13-6)) in inflammatory and neoplastic bile duct diseases. Cancer Lett. 2004;207:139–47. [DOI] [PubMed] [Google Scholar]
- 72.Improgo MR, Scofield MD, Tapper AR, Gardner PD. The nicotinic acetylcholine receptor CHRNA5/A3/B4 gene cluster: dual role in nicotine addiction and lung cancer. Prog Neurobiol. 2010;92:212–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Amos CI, Wu X, Broderick P, Gorlov IP, Gu J, Eisen T, Dong Q, Zhang Q, Gu X, Vijayakrishnan J, et al. Genome-wide association scan of tag SNPs identifies a susceptibility locus for lung cancer at 15q25.1. Nat Genet. 2008;40:616–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Hung RJ, McKay JD, Gaborieau V, Boffetta P, Hashibe M, Zaridze D, Mukeria A, Szeszenia-Dabrowska N, Lissowska J, Rudnai P, et al. A susceptibility locus for lung cancer maps to nicotinic acetylcholine receptor subunit genes on 15q25. Nature. 2008;452:633–7. [DOI] [PubMed] [Google Scholar]
- 75.Spitz MR, Amos CI, Dong Q, Lin J, Wu X. The CHRNA5-A3 region on chromosome 15q24–25.1 is a risk factor both for nicotine dependence and for lung cancer. J Natl Cancer Inst. 2008;100:1552–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Thorgeirsson TE, Geller F, Sulem P, Rafnar T, Wiste A, Magnusson KP, Manolescu A, Thorleifsson G, Stefansson H, Ingason A, et al. A variant associated with nicotine dependence, lung cancer and peripheral arterial disease. Nature. 2008;452:638–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Krais AM, Hautefeuille AH, Cros MP, Krutovskikh V, Tournier JM, Birembaut P, Thépot A, Paliwal A, Herceg Z, Boffetta P, et al. CHRNA5 as negative regulator of nicotine signaling in normal and cancer bronchial cells: effects on motility, migration and p63 expression. Carcinogenesis. 2011;32:1388–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Improgo MR, Soll LG, Tapper AR, Gardner PD. Nicotinic acetylcholine receptors mediate lung cancer growth. Front Physiol. 2013;4:251. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Chen X, Jia Y, Zhang Y, Zhou D, Sun H, Ma X. α5-nAChR contributes to epithelial-mesenchymal transition and metastasis by regulating Jab1/Csn5 signalling in lung cancer. J Cell Mol Med. 2020;24:2497–506. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Wang ML, Hsu YF, Liu CH, Kuo YL, Chen YC, Yeh YC, Ho HL, Wu YC, Chou TY, Wu CW. Low-dose nicotine activates EGFR signaling via α5-nAChR and promotes lung adenocarcinoma progression. Int J Mol Sci. 2020;21:6829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Warzecha CC, Shen S, Xing Y, Carstens RP. The epithelial splicing factors ESRP1 and ESRP2 positively and negatively regulate diverse types of alternative splicing events. RNA Biol. 2009;6:546–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Falvella FS, Alberio T, Noci S, Santambrogio L, Nosotti M, Incarbone M, Pastorino U, Fasano M, Dragani TA. Multiple isoforms and differential allelic expression of CHRNA5 in lung tissue and lung adenocarcinoma. Carcinogenesis. 2013;34:1281–5. [DOI] [PubMed] [Google Scholar]
- 83.Baxter SW, Chen M, Dawson A, Zhao JZ, Vogel H, Shelton AM, Heckel DG, Jiggins CD. Mis-spliced transcripts of nicotinic acetylcholine receptor alpha6 are associated with field evolved spinosad resistance in Plutella xylostella (L.). PLoS Genet. 2010;6:e1000802. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Wildman DE, Uddin M, Liu G, Grossman LI, Goodman M. Implications of natural selection in shaping 99.4% nonsynonymous DNA identity between humans and chimpanzees: enlarging genus Homo. Proc Natl Acad Sci U S A. 2003;100:7181–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Sultana T, Zamborlini A, Cristofari G, Lesage P. Integration site selection by retroviruses and transposable elements in eukaryotes. Nat Rev Genet. 2017;18:292–308. [DOI] [PubMed] [Google Scholar]
- 86.Hoyt SJ, Storer JM, Hartley GA, Grady PGS, Gershman A, de Lima LG, Limouse C, Halabian R, Wojenski L, Rodriguez M, et al. From telomere to telomere: the transcriptional and epigenetic state of human repeat elements. Science. 2022;376: eabk3112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Pelechano V, Steinmetz LM. Gene regulation by antisense transcription. Nat Rev Genet. 2013;14:880–93. [DOI] [PubMed] [Google Scholar]
- 88.Conley AB, Miller WJ, Jordan IK. Human cis natural antisense transcripts initiated by transposable elements. Trends Genet. 2008;24:53–6. [DOI] [PubMed] [Google Scholar]
- 89.Zhang B, Wang J, Wang X, Zhu J, Liu Q, Shi Z, Chambers MC, Zimmerman LJ, Shaddox KF, Kim S, et al. Proteogenomic characterization of human colon and rectal cancer. Nature. 2014;513:382–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Siebenthall KT, Miller CP, Vierstra JD, Mathieu J, Tretiakova M, Reynolds A, Sandstrom R, Rynes E, Haugen E, Johnson A, et al. Integrated epigenomic profiling reveals endogenous retrovirus reactivation in renal cell carcinoma. EBioMedicine. 2019;41:427–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 91.Ottina E, Panova V, Doglio L, Kazachenka A, Cornish G, Kirkpatrick J, Attig J, Young GR, Litchfield K, Lesluyes T, et al. E3 ubiquitin ligase HECTD2 mediates melanoma progression and immune evasion. Oncogene. 2021;40:5567–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 92.Kazachenka A, Loong JH, Attig J, Young GR, Ganguli P, Devonshire G, Grehan N, Ciccarelli FD, Fitzgerald RC, Kassiotis G. The transcriptional landscape of endogenous retroelements delineates esophageal adenocarcinoma subtypes. NAR Cancer. 2023;5:zcad040. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Ng KW, Attig J, Bolland W, Young GR, Major J, Wrobel AG, Gamblin S, Wack A, Kassiotis G. Tissue-specific and interferon-inducible expression of nonfunctional ACE2 through endogenous retroelement co-option. Nat Genet. 2020;52:1294–302. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 94.Ng KW, Attig J, Young GR, Ottina E, Papamichos SI, Kotsianidis I, Kassiotis G. Soluble PD-L1 generated by endogenous retroelement exaptation is a receptor antagonist. Elife. 2019;8:e50256. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 95.Pasquesi GIM, Allen H, Ivancevic A, Barbachano-Guerrero A, Joyner O, Guo K, Simpson DM, Gapin K, Horton I, Nguyen LL, et al. Regulation of human interferon signaling by transposon exonization. Cell. 2024;187:7621–7636.e7619. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 96.Lindholm HT, Chen R, De Carvalho DD. Endogenous retroelements as alarms for disruptions to cellular homeostasis. Trends Cancer. 2023;9:55–68. [DOI] [PubMed] [Google Scholar]
- 97.Kassiotis G. The immunological conundrum of endogenous retroelements. Annu Rev Immunol. 2023;41:99–125. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98.Gotea V, Makałowski W. Do transposable elements really contribute to proteomes? Trends Genet. 2006;22:260–7. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary Material 1. Additional file 1: Fig. S1. HERVE 6q15 responsiveness to hypoxia. Fig. S2. Essential function of RNGTT in cancer cell lines. Fig. S3. CRISPR/Cas9-mediated deletion of the HERVE 6q15 provirus. Fig. S4. Correlation of RNGTT and HERVE 6q15 expression with survival in KIRC. Fig. S5. HERVH Xp22.2 expression across cancers and correlation with TLR7, TLR8 and PRPS2 expression in LUAD. Fig. S6. APOBEC3B-AS1 expression across cancers and normal tissues. Fig. S7. Cancer specificity of ENNP3, and overlapping gene and RTE expression in KIRC. Fig. S8. Instability of the ENPP3[L2a/AluSx] protein product. Fig. S9. PCR validation of the CHRNA5[AluSz] isoform. Fig. S10. Balance of CHRNA5 isoform expression in cancer cell lines. Fig. S11. CHRNA5 and CHRNA5[AluSz] expression across cancers and normal tissues. Fig. S12. Sequence and expression of the CHRNA5[AluSz] protein. Fig. S13. Establishment of A549 cells expressing CHRNA5 and CHRNA5[AluSz]. Fig. S14. Effect of CHRNA5 and CHRNA5[AluSz] expression on A549 in vitro growth.
Data Availability Statement
The RNA-seq data generated in this study have been deposited at the EMBL-EBI repository (E-MTAB-14514).







