Skip to main content
NCBI home page
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2002 Aug;40(8):3053–3056. doi: 10.1128/JCM.40.8.3053-3056.2002

Enterotoxigenic Profiles of Food-Poisoning and Food-Borne Bacillus cereus Strains

Marie-Hélène Guinebretière 1,*, Véronique Broussolle 1, Christophe Nguyen-The 1
PMCID: PMC120679  PMID: 12149378

Abstract

The enterotoxigenic profiles of 51 B. cereus food-related strains were compared to those of 37 B. cereus food-poisoning strains. cytK and association of hbl-nhe-cytK enterotoxin genes were more frequent among diarrheal strains (73 and 63%) than among food-borne strains (37 and 33%). Unlike diarrheal strains, food-borne strains showed frequent nhe and hbl gene polymorphisms and were often low toxin producers.

Bacillus cereus can cause food-borne diarrhea by producing heat-labile enterotoxins during growth of vegetative cells in the small intestine (6). Four different enterotoxins have been characterized: two protein complexes, hemolysin BL (HBL) and nonhemolytic enterotoxin (NHE), and two enterotoxic proteins, enterotoxin T (bc-D-ENT) (1) and cytotoxin K (11). HBL complex is composed of three proteins, B, L1, and L2 (4, 5) transcribed from the genes hblC (encoding L2), hblD (encoding L1), and hblA (encoding B), organized in one operon together with a fourth gene, hblB (encoding the B′ protein) (9, 13). NHE complex is also composed of three different proteins, NheA, NheB, and NheC encoded by the three genes nheA, nheB, and nheC, and it is also organized in one operon (7).

B. cereus is widespread in foods, whereas diarrheal poisoning caused by B. cereus is fairly infrequent. The ability to cause diarrhea thus presumably varies among strains. Only few data are available concerning the genetic and toxigenic potential of B. cereus strains from vegetable products, although vegetables are frequently contaminated by B. cereus. The objective of the present work was to analyze the distribution of enterotoxin genes and enterotoxin production in food strains of various origins (isolated from cooked chilled foods and vegetables) and to compare enterotoxigenic profiles to those in diarrheal food-poisoning strains.

Eighty-eight bacterial strains (51 food-related strains and 37 food-poisoning strains, listed below in Tables 2 and 3) were tested for enterotoxin production, using the B. cereus Enterotoxin Reverse Passive Latex Agglutination test kit (Oxoid, Basingstoke, England) and the Bacillus Diarrheal Enterotoxin visual immunoassay (Tecra Diagnostics, Roseville, Australia), according to the manufacturers' instructions. Amounts of produced enterotoxin were evaluated with index values derived from the Oxoid and Tecra reading scale (Table 2). All strains were also tested for the presence of the genes hbl (C, D, A, and B), nhe (A, B, and C), bceT (encoding the bc-D-ENT enterotoxin), and cytK (encoding cytotoxin K). DNA was extracted as previously described (2). The primers used for the detection of the various genes are presented in Table 1. Amplified products from strains ATCC 14579T, 1230/88, and 391/98 were sequenced to check the specificity of the designed primers. Except for amplifications with hblB primers, the PCR mixture (50 μl) consisted of 100 ng of DNA template, 200 μM deoxynucleoside triphosphate mix (Eurogentec S. A., Seraing, Belgium), 2.5 mM MgCl2, a 500 nM concentration of each primer, 0.75 U of AmpliTaq polymerase (Perkin-Elmer, Courtaboeuf, France), and AmpliTaq buffer (Eurogentec). Thermal cycling was carried out in a PCR 9700 thermocycler (Perkin-Elmer) with the following run: a starting cycle of 2 min at 94°C, followed by 35 cycles of 1 min at 94°C, 1 min at the annealing temperature (Table 1), and 2 min at 72°C, and a final extension of 5 min at 72°C. For the hblB amplification reaction (50 μl), 500 μM deoxynucleoside triphosphate mix, 5 mM MgCl2, and a 300 nM concentration of each primer were used instead of the concentrations stated above. Parameters determined with the PCR 9700 thermocycler were 2 min at 94°C followed by 10 cycles of 10 s at 94°C, 30 s at 58°C, and 2 min at 68°C; 20 cycles of 10 s at 94°C, 30 s at 58°C, 2 min (plus 20 s per cycle) at 68°C; and a final extension at 68°C for 7 min. Strains that were negative in PCR experiments were submitted to Southern blotting to check for the absence of hbl, nhe, and cytK. Positive controls were included for each tested probe. Five micrograms of genomic DNA was digested to completion with EcoRI and electrophoresed overnight on a 1% agarose gel at 15 V. Southern blotting was carried out according to standard protocols (14). Probes were generated by PCR amplifications of hblC, hblD, hblA, nheA, nheB, nheC, and cytK gene fragments, and 32P-labeling was performed with Ready-to-Go DNA labeling beads (Amersham Pharmacia Biotech, Orsay, France) according to the manufacturer's recommendations. Membranes were hybridized at 60°C for 2 h in Rapid hybridization buffer (Amersham Pharmacia Biotech), washed according to supplied protocols, and exposed to phosphorimager screens (Storm; Molecular Dynamics, Bondoufle, France) before revelation. The Kolmogorov-Smirnov two-sample test was used to determine whether the frequency and association of genes and the production of enterotoxins were significantly different between food-poisoning strains and food-borne strain groups. The test was performed using SYSTAT (version 9.0; SPSS Inc., Chicago, Ill.).

TABLE 2.

Characteristics of food-poisoning strains

Strain HBL complexa
Oxoid kit test indexb NHE complexa
Tecra kit test indexc cytKa,d bceTa
hblC hblD hblA hblB nheA nheB nheC
0861/00 − − − − 0 + + +s 4 − −
DSM 2301 − − − − 0 +s +s + 3.5 − +
LMG 17604 − − − − 0 +s + + 3 − +
391/98 − − − − 0 − − − 2 + +
0500/00 − − − − 0 + + + 4.5 − −
F2404B/79 − − − − 0 + + +s 4 − +
F0285/78 − − − − 0 + + + 3 + −
F2085/98 − − − − 0 +s + + 4.5 + −
DSM 8438 − − − − 0 + + + 4 + −
F4346/75 − − − − 0 + + + 4 − −
F528/94 + + + − 16 + + + 4 − +
IH41064 + + + + 128 + + + 4 + −
F3465/73 + + + + 64 + + + 3.5 + −
F3371/93 + + + + >128 + + + 5 + −
F0210/76 + + + + 128 + + + 4 + +
F4096/73 + + + + 64 + + + 3.5 + +
F4094/73 + + + + 64 +s + + 3 + +
F3453/94 + + + + 32 + + + 4 + +
F4370/75 + + + + >128 + + + 4 − −
DSM 4222 + + + − >128 + + + 4 − −
F2769/77 + + + − >128 + + + 4.5 − +
F4433/73 + + + + >128 + + + 5 + −
1230/98 + + + + 128 + + + 4 + −
F4815/94 + + + + 32 + + + 3 + −
LMG 17605 + + + + 16 + + +s 4.5 + −
LMG 17615 + + + + 128 + +s +s 5 + −
F4430/73 + + + + >128 + + + 4.5 + +
F1942/85 + + + + 128 + + + 4 + +
F4432/73 + + + + >128 + + + 4 + +
DSM 4282 + + + + 128 + + + 3.5 + +
0230/00 + + + + >128 + + + 4 + +
1651/00 + + + + 128 + + + 4 + +
98HMPL63 + + + + >128 + + + 4 + +
F284/78 + + + + >128 + + + 4 + +
F352/90 + + + − >128 + + + 4 + +
F2081A/98 + + + − >128 + + + 4 + +
F2081B/98 + + + + >128 + + + 4 + +
Open in a new tab
a

+, a PCR product of the expected size was observed; −, no PCR product was observed; +s, no PCR product was observed but the gene was detected by Southern blotting.

b

For the Oxoid test, the indices from 0 to 128 corresponded to the last supernatant dilution rate (among 1/2 serial dilutions) for which enterotoxin remained detectable. According to the manufacturer's instructions, strains with an index of 0 were considered negative.

c

For the Tecra test, indices from 1 to 5 corresponded to the coloration intensity. According to the manufacturer's instructions, strains with an index of <3 were considered negative.

d

cytK not detected by PCR was always confirmed to be absent by Southern blotting.

TABLE 3.

Characteristics of food-borne strains

Strain HBL complexa
Oxoid kit test indexb NHE complexa
Tecra kit test indexc cytKa,d bceTa
Strain HBL complexa
Oxoid kit test indexb NHE complexa
Tecra kit test indexc cytKa,d bceTa
hblC hblD hblA hblB nheA nheB nheC hblC hblD hblA hblB nheA nheB nheC
PA − − − − 0 + + + 2.5 + +
C74 − − − − 0 +s + + 3.5 − −
C39 − − − − 0 +s + + 4.5 − −
C33 − − − − 0 + + +s 3.5 + +
SL′ +s + + − 16 +s + + 3 − −
SV +s + + − 32 +s + + 2.5 − −
5 +s +s +s − 4 +s + + 2 − −
BC + + + + 16 + + +s 3 − −
PF + + + + 64 +s + + 3.5 − −
C1 +s +s +s − 2 + + +s 3 − −
C35 +s +s + − 64 + + + 2.5 − −
C36 +s +s + + 64 − − − 2 − −
C46 +s +s +s − 1 +s + +s 3 − −
C64 +s + + − 16 + +s +s 2.5 − −
I3 +s + + − 1 − − − 2 − −
1 + + + + 2 + + +s 3 − +
11 + + + + 16 +s + + 3.5 − +
15 + + + + 128 + + + 4.5 − +
25 + + + + 128 + + + 4 − +
BK + + + − 4 +s + + 2 − +
BL +s + + − 8 + + + 3 − +
BN + +s +s − 0 + + + 3.5 − +
BX + + + − 4 + + +s 3 − +
BS + + + + 8 + + + 2.5 − +
SO + + + + 4 + + +s 3 − +
Open in a new tab
a

+, a PCR product of the expected size was observed; −, no PCR product was observed; +s, no PCR product was observed but the gene was detected by Southern blotting.

b

For the Oxoid test, the indices from 0 to 128 corresponded to the last supernatant dilution rate (among 1/2 serial dilutions) for which enterotoxin remained detectable. According to the manufacturer's instructions, strains with an index of 0 were considered negative.

c

For the Tecra test, indices from 1 to 5 corresponded to the coloration intensity. According to the manufacturer's instructions, strains with an index of <3 were considered negative.

d

cytK gene not detected by PCR was always confirmed to be absent by Southern blotting.

TABLE 1.

Characteristics of primers used in this studya

Primerb Gene Annealing temp for the primer couple (°C) Amplified fragment size (bp) Sequence (5′ → 3′) Primer position Sequence from which the primer was deduced
Origin of DNA sequence EMBL/GenBank accession no.
HC F hblC 58 740 GATAC(T, C)AATGTGGCAACTGC 40-59 B. cereus ATCC 14579T AJ007794
HC R TTGAGACTGCTCG(T, C)TAGTTG 761-780
HD F hblD 58 829 ACCGGTAACACTATTCATGC 970-989
HD R GAGTCCATATGCTTAGATGC 1780-1799
HA F hblA 56 1,154 AAGCAATGGAATACAATGGG 1951-1970
HA R AGAATCTAAATCATGCCACTGC 3084-3105
HA F hblB 58 2,684 AAGCAATGGAATACAATGGG 1951-1970
HB R AATATGTCCCAGTACACCCG 4616-4635
NA F nheA 56 755 GTTAGGATCACAATCACCGC 430-449 B. cereus 1230/88 Y19005
NA R ACGAATGTAATTTGAGTCGC 1166-1185
NB F nheB 54 743 TTTAGTAGTGGATCTGTACGC 1682-1702
NB R TTAATGTTCGTTAATCCTGC 2406-2425
NC F nheC 54 683 TGGATTCCAAGATGTAACG 2935-2953
NC R ATTACGACTTCTGCTTGTGC 3599-3618
BCET1 F bceT 55 661 CGTATCGGTCGTTCACTCGG 1191-1210 B. cereus B-4ac D17312
BCET3 R GTTGATTTTCCGTAGCCTGGG 1832-1852
BCET1 F bceT 55 924 CGTATCGGTCGTTCACTCGG 1191-1210
BCET4 R TTTCTTTCCCGCTTGCCTTT 2096-2115
CK F cytK 54 809 ACAGATATCGG(G, T)CAAAATGC 1859-1878 B. cereus 391/98 AJ277962
CK R GAACTG(G, C)(A, T)AACTGGGTTGGA 2649-2668 B. thuringiensis 407c
Open in a new tab
a

Primers used to amplify the bceT gene have been described by Hansen and Hendriksen (8).

b

F, forward primer; R, reverse primer.

c

Sequence from D. Lereclus, Institut Pasteur, Paris, France.

Detection of enterotoxin genes.

For the 88 B. cereus strains, hbl and nhe gene detection by both PCR and Southern blotting methods correlated well with the results of the Oxoid and Tecra tests, respectively (Tables 2 and 3). Among the 37 food-poisoning strains, none needed confirmation by Southern analysis for hbl genes (C, D, and A), which were easily detected by PCR, and only eight strains (22%) negative in PCR for one or two of the nhe genes were found to be positive by Southern blotting (Table 2). This contrasted with results obtained for the 47 and 49 food-borne strains that were positive for the HBL and NHE enterotoxins, respectively: 17 strains (36%) and 31 strains (63%) negative in PCR for one or two of the respective hbl and nhe genes were found to be positive by Southern blotting (Table 3). This indicates a high polymorphism in the hbl and nhe sequences among food-associated strains, which differed markedly from food-poisoning strains in that respect. Southern analysis showed that genetic heterogeneity among B. cereus strains, and particularly among environmental strains, is more truly associated with sequence polymorphism than with the lack of one of the genes composing the hbl or nhe operon.

Distribution of enterotoxin genes.

Almost all the strains from the food-poisoning and food-borne ecosystems carried nhe genes, as observed in previous works (8, 12). The bceT gene was widely distributed (57 and 71% among food-poisoning and food-borne strains, respectively). The hbl (C, D, and A) genes were also highly frequent in the two groups of strains (73 to 92%). The cytK gene was frequently detected among diarrheal strains, 73% of which carried it. It was present at a significantly (P = 0.007) lower frequency among food-borne strains; only 37% of the food strains were concerned. Stenfors and Granum (15) found three strains (13%) carrying this gene among 23 strains from dairy products. Profiles associating the nhe, hbl, and cytK genes were significantly (P = 0.049) more frequent among food-poisoning strains (63% of the strains concerned) than among food-borne strains (33% of the strains).

Enterotoxin levels produced among strain samples.

Among strains carrying hbl genes, the percentage of those producing high levels of enterotoxin HBL (with an index of ≥128) was significantly (P = 0.002) higher for food-poisoning strains (74%) than for food-borne strains (32%). Similarly, among strains carrying nhe genes, the frequency of high enterotoxin NHE producers (production at an index of ≥4) was 78% for food-poisoning strains and only 20% for food-related strains. Furthermore, 11 strains (22%) among the 49 food-borne strains carrying nhe genes did not produce or only weakly produced enterotoxin NHE (index < 3). This emphasizes a difference in gene expression between food-borne and food-poisoning strains. Psychrotrophic strains isolated from pasteurized milk by in't Veld et al. (10) were also low producers of enterotoxin BL, with only 26 strains out of 86 (30%) exhibiting an index of ≥128 in the Oxoid test. Beattie and Williams (3) also observed wide variations in the amount of enterotoxin produced from dairy-associated strains.

Some significant differences were found in the genetic and toxigenic potential of food-poisoning strains and food-borne strains, supporting the hypothesis that many food-borne strains are less prone to cause diarrhea.

StrainhblChblDhblAhblBkit testnheAnheBnheCtest indexcytK,bceTSZ++++4+s++s3−+ SB′++++>128+s++4−+ SD+++−16+s++3.5−+ SM++++64+s++s2.5−+ C41+s++−2+s++1.5−+ I6+s+s+s−2+s++s4−+ I11+++−128+++3.5−+ I20+s++−16++s+3−+ I21+s+s+−16+s++3−+ C43+++−128+++s5+− I22+++−128+++4+− 32++++>128+s++4++ BC′++++64++s+3++ A3++++16+s++3.5++ C3++++128+++3.5++ C15++++128+++3.5++ C38+++−>128+++4++ C57+++−32+++3.5++ I2+++−64+++3.5++ I7+s++−64+++3.5++ I10+++−128+++3.5++ I12+++−>128+s++3.5++ I13+s++−128+++5++ I16+++−>128++s+3.5++ I17+++−128+++2.5++ I23++++32+s++2.5++

Acknowledgments

This work was supported by specific funds from the Département Transformation des Produits Végétaux (INRA, France) and by a research project, AQS R0013 (Ministère de l'Agriculture et de la Pêche, Ministère de la Recherche, France).

We thank P. E. Granum (The Norwegian School of Veterinary Science, Oslo, Norway), M. A. Andersson and M. S. Salkinoja-Salonen (University of Helsinki, Helsinki, Finland), J. Mc Lauchlin (PHLS, London, England), C. Denis (ADRIA Normandie, Villers Bocage, France), and M. L. De Buyser (AFSSA, Maisons-Alfort, France) for providing strains. We also thank D. Lereclus (Institut Pasteur, Paris, France) for providing the sequence of the cytK gene obtained from Bacillus thuringiensis. We are very grateful to S. Courtillier for help in the realization of immunoassays.

REFERENCES

  • 1.Agata, N., M. Ohta, Y. Arakawa, and M. Mori. 1995. The bceT gene of Bacillus cereus encodes an enterotoxic protein. Microbiology 141:983-988. [DOI] [PubMed] [Google Scholar]
  • 2.Aranda, E., M. M. Rodriguez, M. A. Asensio, and J. J. Cordoba. 1997. Detection of Clostridium botulinum types A, B, E, and F in foods by PCR and DNA probe. Lett. Appl. Microbiol. 25:186-190. [DOI] [PubMed] [Google Scholar]
  • 3.Beattie, S. H., and A. G. Williams. 1999. Detection of toxigenic strains of Bacillus cereus and other Bacillus spp. with an improved cytotoxicity assay. Lett. Appl. Microbiol. 28:221-225. [DOI] [PubMed] [Google Scholar]
  • 4.Beecher, D. J., and A. C. Wong. 1994. Improved purification and characterization of hemolysin BL, a hemolytic dermonecrotic vascular permeability factor from Bacillus cereus. Infect. Immun. 62:980-986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Beecher, D. J., and A. C. Wong. 1997. Tripartite hemolysin BL from Bacillus cereus. Hemolytic analysis of component interactions and a model for its characteristic paradoxical zone phenomenon. J. Biol. Chem. 272:233-239. [DOI] [PubMed] [Google Scholar]
  • 6.Granum, P. E. 1994. Bacillus cereus and its toxins. J. Appl. Bacteriol. Suppl. 23:61S-66S. [PubMed] [Google Scholar]
  • 7.Granum, P. E., K. O'Sullivan, and T. Lund. 1999. The sequence of the non-haemolytic enterotoxin operon from Bacillus cereus. FEMS Microbiol. Lett. 177:225-229. [DOI] [PubMed] [Google Scholar]
  • 8.Hansen, B. M., and N. B. Hendriksen. 2001. Detection of enterotoxic Bacillus cereus and Bacillus thuringiensis strains by PCR analysis. Appl. Environ. Microbiol. 67:185-189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Heinrichs, J. H., D. J. Beecher, J. D. MacMillan, and B. A. Zilinskas. 1993. Molecular cloning and characterization of the hblA gene encoding the B component of hemolysin BL from Bacillus cereus. J. Bacteriol. 175:6760-6766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.in't Veld, P. H., W. S. Ritmeester, E. H. M. DelfgouvanAsch, J. B. Dufrenne, K. Wernars, E. Smit, and F. M. vanLeusden. 2001. Detection of genes encoding for enterotoxins and determination of the production of enterotoxins by HBL blood plates and immunoassays of psychrotrophic strains of Bacillus cereus isolated from pasteurised milk. Int. J. Food Microbiol. 64:63-70. [DOI] [PubMed] [Google Scholar]
  • 11.Lund, T., M. L. DeBuyser, and P. E. Granum. 2000. A new cytotoxin from Bacillus cereus that may cause necrotic enteritis. Mol. Microbiol. 38:254-261. [DOI] [PubMed] [Google Scholar]
  • 12.Rivera, A. M. G., P. E. Granum, and F. G. Priest. 2000. Common occurrence of enterotoxin genes and enterotoxicity in Bacillus thuringiensis. FEMS Microbiol. Lett. 190:151-155. [DOI] [PubMed] [Google Scholar]
  • 13.Ryan, P. A., J. D. Macmillan, and B. A. Zilinskas. 1997. Molecular cloning and characterization of the genes encoding the L1 and L2 components of hemolysin BL from Bacillus cereus. J. Bacteriol. 179:2551-2556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • 15.Stenfors, L. P., and P. E. Granum. 2001. Psychrotolerant species from the Bacillus cereus group are not necessarily Bacillus weihenstephanensis. FEMS Microbiol. Lett. 197:223-228. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES