PLGA microspheres loaded with si-circETS1 as a therapeutic strategy to delay intervertebral disc degeneration

Abstract

Intervertebral disc degeneration (IDD) is one of the leading causes of chronic low back pain and functional impairment, severely affecting the quality of life of patients. In recent years, circular RNA (circRNA), has gained attention for its critical role in cellular function regulation, especially its potential therapeutic effects in IDD. This study aims to elucidate the function of circETS1 in nucleus pulposus cells (NPCs) and develop a novel targeted therapeutic strategy. CircETS1, which was abnormally highly expressed in degenerated nucleus pulposus tissue, was identified through circRNA sequencing (circRNA-seq). The circular nature of circETS1 was confirmed by Sanger sequencing, RNase R digestion, and fluorescence in situ hybridization (FISH). Primary human NPCs were cultured, and the effects of regulating circETS1 on cell proliferation, apoptosis, and extracellular matrix metabolism were studied using reverse transcription quantitative polymerase chain reaction (RT-qPCR), Western blotting, flow cytometry, and immunofluorescence. Polylactic-co-glycolic acid (PLGA) microspheres (MS) loaded with si-circETS1 were prepared, and their therapeutic effects were evaluated. PLGA MS loaded with si-circETS1 effectively delivered si-circETS1 to nucleus pulposus tissue in both in vitro and in vivo experiments, significantly downregulating circETS1 expression, reducing inflammation, promoting extracellular matrix synthesis and repair, and ultimately delaying the progression of IDD. Consequently, PLGA MS loaded with si-circETS1 present an innovative and promising therapeutic strategy for IDD, demonstrating strong potential for clinical application.

Introduction

Intervertebral disc degeneration (IDD) is a common degenerative disease of the spine, characterized by the gradual loss of intervertebral disc structure and function. It is one of the primary causes of chronic low back pain, nerve root compression, spinal instability, and other related symptoms (Mohd Isa et al. 2022). With the aging population and the influence of modern lifestyles, the incidence of IDD has been increasing annually, becoming one of the major health problems affecting human quality of life (Oichi et al. 2020). Currently, treatment strategies for IDD primarily focus on symptom relief, including pharmacological treatment, physical therapy, and surgical interventions. However, these approaches still have many limitations and challenges. For instance, although conservative treatments can effectively alleviate symptoms, they do not provide long-term effective repair for the structural degeneration of the intervertebral disc (Sampara et al. 2018). Furthermore, while surgical treatments can relieve symptoms, they typically fail to restore disc function and morphology, and may be accompanied by a range of complications such as surgical failure and degeneration of adjacent segments (Wu et al. 2020). As a result, the development of innovative therapies capable of effectively treating IDD remains an urgent and critical challenge.

Circular RNA (circRNA) is a unique type of RNA molecule characterized by a circular structure where the 3′ and 5′ ends are covalently linked. Unlike traditional linear RNAs, circRNAs exhibit higher stability in cells and are less prone to degradation by RNA exonucleases, resulting in a longer half-life. CircRNAs are typically composed of introns or exons and form a closed-loop structure after transcription. Studies have shown that circRNAs play an important role in the development and progression of IDD and hold potential therapeutic value (Kristensen et al. 2019). On one hand, circRNAs can interact with miRNAs through a “sponge effect,” binding to miRNAs and influencing their activity, thereby regulating the expression of target genes (Xie et al. 2023). For example, circ_0022382 has been shown to regulate the expression of its target gene TGF-β3 in IDD by binding to miR-4726-5p, which in turn affects the synthesis and degradation of extracellular matrix components in disc cells (Hu et al. 2022). Through this mechanism, circRNAs can effectively regulate the function of nucleus pulposus cells (NPCs). Additionally, circRNAs can regulate the process of IDD by interacting with certain RNA-binding proteins and transcription factors (Chen et al. 2023). Given the crucial role of circRNAs in IDD, they may serve as potential biomarkers and can be targeted using siRNA, antisense oligonucleotides, or CRISPR technology for the treatment of IDD.

Despite the promising application prospects of circRNA as a therapeutic target and biomarker for IDD, there are still several limitations in its clinical application for the prevention and treatment of disc degeneration. The first issue is the stability of circRNA. Although circRNA is more stable than linear RNA due to its circular structure, its stability in vivo is still challenged by various factors such as external environment, cellular state, and RNA enzymes, which may affect its efficacy in therapy (Niu et al. 2023). Secondly, the low delivery efficiency of circRNA is a significant challenge. How to effectively deliver circRNA as a therapeutic molecule to the degenerative disc region is an important issue (Dong et al. 2023). The intervertebral disc is located deep within the spine with relatively poor blood supply, making conventional drug or molecular delivery methods highly inefficient. To address these challenges, this study first identified circETS1, a circRNA closely related to the progression of IDD, through RNA-seq, PCR, and other techniques. polylactic-co-glycolic acid (PLGA) microspheres (MS) were then used as a delivery vehicle to transport si-circETS1. Subsequent in vitro and in vivo experiments confirmed that this delivery method could effectively alleviate IDD. Notably, this study uniquely highlighted the potential advantages of PLGA MS-mediated delivery of small RNA molecules to target and regulate circRNA, offering a new strategy for the treatment of IDD.

Materials and methods

Human nucleus pulposus tissue

Nucleus pulposus tissue specimens were collected from 55 patients who underwent spinal decompression or fusion surgery at our hospital. The specimens were classified according to the Pfirrmann grading system (Gao et al. 2022a). Nucleus pulposus specimens graded as Pfirrmann II and III were defined as the mild IDD group (21 cases), while specimens graded as Pfirrmann IV and V were defined as the severe IDD group (34 cases) (Gao et al. 2024). The experimental protocol was reviewed and approved by the Medical Ethics Committee of our hospital. All patients were informed about the study and provided written informed consent. Table 1 show the demographic characteristics of the included patients.

Table 1.

Patient demographic characteristics

Parameter	Value
Inclusion time	March 2024–June 2024
Number of patients, N	55
Sex ratio, M:F	31:24
Age, mean (range), Years	58.91 ± 7.79 (47–74)
Intervertebral disc level, L3/4:L4/5:L5/S1	5:33:17
Pfirrmann grade, II:III:IV:V	5:16:26:8
Total nucleus pulposus tissue, N	55
Nucleus pulposus tissue for circRNA-seq, N	8

	Mild IDD group (N = 4)	Severe IDD group (N = 4)
Sex ratio, M:F	2:2	2:2	X2 = 0.000, P = 1
Age, years	62.00 ± 6.48	62.50 ± 7.94	T = 0.098, P = 0.925
Intervertebral disc level, L4/5:L5/S1	2:2	2:2	X2 = 0.000, P = 1
Pfirrmann grade, II:III/IV:V	1:3	2:2
Nucleus pulposus tissue for cytological tests, N	55

	Mild IDD group (N = 21)	Severe IDD group (N = 34)
Sex ratio, M:F	12:9	19:15	X2 = 0.008, P = 0.927
Age, years	57.86 ± 7.70	59.56 ± 7.89	T = 0.784, P = 0.437
Intervertebral disc level, L3/4:L4/5:L5/S1	3:11:7	2:22:10	X2 = 1.402, P = 0.496
Pfirrmann grade, II:III/IV:V	5:16	26:8

Human NPCs isolation and culture

The collected nucleus pulposus tissue was washed with PBS to remove blood and impurities, then cut into small pieces of approximately 1–2 mm³. The tissue pieces were digested with trypsin and type II collagenase for 30 min and 3 h, respectively, with gentle shaking to aid digestion. After digestion, the undigested tissue fragments were filtered through a 70 μm cell strainer, and the supernatant was removed after centrifugation. The cells at the bottom of the centrifuge tube were collected. The isolated NPCs were resuspended in DMEM/F-12 medium containing 15% fetal bovine serum (FBS). The cells were seeded at a density of 1 × 10⁴ cells/cm² in culture flasks and incubated at 37 °C in a 5% CO₂ incubator. The primary culture was allowed to grow for 1–2 weeks until the adherent cells reached 80% confluence before passaging. For passaging, the cells were digested with trypsin, separated, and reseeded.

CircRNA sequencing (CircRNA seq)

Four mild IDD group and four severe IDD group human nucleus pulposus samples were randomly selected for total RNA extraction using Trizol (Invitrogen, USA). After enriching the circRNAs with circRNA-specific probes, the enriched circRNAs were reverse transcribed into cDNA, and a cDNA library was constructed. The cDNA library was then sequenced using the Illumina platform (NovaSeq), and subsequent data analysis was performed. Briefly, total RNA was used for removing the rRNAs with GenSeq® rRNA Removal Kit (GenSeq, Inc.). Then, the rRNA-depleted samples were subjected to library construction with GenSeq® Low Input RNA Library Prep Kit (GenSeq, Inc.) according to the manufacturer’s instructions. Libraries were controlled for quality and quantified using the BioAnalyzer 2100 system (Agilent Technologies, Inc., USA). Library sequencing was performed on an Illumina NovaSeq instrument with 150 bp paired end reads. Paired-end reads were harvested from Illumina NovaSeq 6000 sequencer, and were quality controlled by Q30. After 3′ adaptor-trimming and low quality reads removing by cutadapt software (v1.9.3). The high quality reads were aligned to the reference genome/transcriptome with STAR software (v2.5.1b) and circRNAs were detected and identified with DCC software (v0.4.4). edgeR software (v3.16.5) was used to normalized the data and perform differentially expressed circRNA analysis. Differentially expressed circRNAs were selected based on fold change (fold change > 1.5) and P-value (P < 0.05). The most significantly different, highly expressed, and stable circRNA, circETS1, was chosen as the target for further validation, including Sanger sequencing and RNase R treatment.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Total RNA from NP tissues and cells was extracted using Trizol (Invitrogen, USA). cDNA was synthesized by reverse transcription using GoScript RT System (Promega, USA) and All-in-One miRNA Reverse Transcription Kit (GeneCopoeia, USA). qRT-PCR analysis was performed using GoTaq qPCR Master Mix (Promega, USA) and SYBR Green Human miRNA Assay Kit (GeneCopoeia, USA). GAPDH was used as internal controls, and results were analyzed via the 2^−△Ct or 2^−△△Ct methods. Experiments were performed in triplicate. Primer sequences are listed in Table 2.

Table 2.

Primers and sequences used in this study

GenBank/CircBase	Gene	Gene ID	Primer	Primer sequence (5′ → 3′)	Tm (°)
hsa_circ_0002083	CircETS1	ENSG00000134954.10	F	AAGGGCACCTTCAAGGACTA	60
	CircETS1		R	GCACATTCCATATCTGTGTA
NM_013227	ACAN	176	F	CATTCACCAGTGAGGACCTCGT	60
	ACAN		R	TCACACTGCTCATAGCCTGCTTC
NM_001844	COL2A1	1280	F	TGAGGGCGCGGTAGAGACCC	62
	COL2A1		R	TGCACACAGCTGCCAGCCTC
NM_001256799	GAPDH	2597	F	GCTGAGAACGGGAAGCTTGT	61
	GAPDH		R	GACTCCACGACGTACTCAGC

Fluorescence in situ hybridization (FISH)

Fluorescently labeled circETS1 probes, designed and synthesized by Guangzhou Jisai Biological Co., Ltd. (China), were used for FISH experiments. NPCs or nucleus pulposus tissue were fixed with 4% paraformaldehyde, and cell membranes were permeabilized using 0.2% Triton X-100. The labeled circETS1-specific probes were then hybridized with the cells. After washing and mounting, the localization of circETS1 within the cells was observed under a laser confocal microscope.

Cell transfection

An overexpression vector, pCD25-ciR, containing the expression frame for circETS1, was constructed to allow for RNA splicing into a circular form within the cells. siRNA sequences targeting the junction region of circETS1 were designed and incorporated into an siRNA vector. The siRNA for circETS1 and the overexpression plasmid were designed and constructed by Guangzhou Jisai Biological Co., Ltd. (China). The target sequence of si-circETS1-1 is GCACAUUCCACUGUGU, and the target sequence of si-circETS1-2 is CCACUCUGUAGCCAGC. The design principle includes: the target sequence requires 19–21 bases. The range of GC content is between 30 and 50%. Avoid having more than 4 consecutive A or T. Try to design in the CDS area. The number of bases continuously matched with non-target genes cannot exceed 15 bp, etc. NPCs in the logarithmic growth phase were collected and seeded at a density of 4 × 10⁴ cells per well in a 6-well plate, and cultured at 37 °C with 5% CO₂. When the cells reached 90% confluence, transfection was performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA).

Cell proliferation assay

At specific time points during NPCs culture, 10% Alamar blue reagent and DMEM/F12 medium containing 10% FBS were added to each well. The cells were then incubated at 37 °C with 5% CO₂ for 3 h. After incubation, absorbance was measured at 570 nm using a spectrophotometer, and background correction was performed at 600 nm. The relative cell proliferation rate was calculated based on the absorbance values.

Cell apoptosis assay

NPCs in the logarithmic growth phase were collected, centrifuged, and resuspended at a concentration of 1 × 10⁶ cells/ml. To the cell suspension, 5 μl of Annexin V-FITC reagent and 10 μl of PI dye were added, followed by incubation at 4 °C in the dark for 15 min. Data were collected using a flow cytometer, and fluorescence signals from Annexin V-FITC and PI were analyzed. FlowJo software (FlowJo, LLC, Ashland, Oregon) was then used to quantify cell apoptosis and necrosis.

Immunofluorescence

NPCs were fixed with 4% paraformaldehyde at room temperature for 20 min, followed by incubation with 0.5% Triton X-100 for 5 min. The cells were then blocked with PBS containing 5% BSA for 30 min. Afterwards, the primary antibody was added, and the cells were incubated overnight at 4 °C. Fluorescent secondary antibody was added and incubated in the dark for 30 min, followed by DAPI incubation in the dark for 5 min. After washing with PBS, the cells were observed under a laser confocal microscope (Leica, Germany) to detect the fluorescence signal of the target protein.

The information of antibodies used were listed in Table 3.

Table 3.

The information of antibodies used in this study

Antibodies	Manufacturer	Identifier	Host	Dilution ratio
Anti-ACAN	Abcam	ab186414	Rabbit	1:500
Anti-COL2A1	Abcam	ab34712	Rabbit	1:100
Anti-Rabbit IgG	Abcam	ab150077	Goat	1:300

Preparation and characterization of si-circETS1-loaded MS

PLGA was dissolved in 5% dichloromethane, and gently stirred until fully dissolved, forming a transparent PLGA solution. Purified si-circETS1 was dissolved in PBS (pH 7.4) to achieve a concentration of 200 µg/ml. To aid in the even dispersion of si-circETS1, 2% PVA was added. The PLGA solution was then mixed with the si-circETS1 solution, forming an oil–water emulsion. High-shear stirring was used to emulsify the mixture. The emulsion was transferred to a rotary evaporator to remove the solvent at 40 °C. The PLGA MS were collected by centrifugation at 10,000 rpm for 10 min, washed, and dried to obtain si-circETS1-loaded PLGA MS. The particle size distribution of the MS was measured using a laser diffraction particle size analyzer. RNA was extracted and qPCR was used to assess the encapsulation efficiency of si-circETS1 in the PLGA MS. Scanning electron microscopy (SEM) was used to observe the morphology and uniformity of the MS. In vitro release experiments were conducted to evaluate the release rate of si-circETS1 from the PLGA MS.

Observation of the effect of si-circETS1-loaded MS on NPCs in vitro

The prepared no-loaded MS, si-circETS1 MUT MS, si-circETS1 WT MS, and serum-free medium were mixed and incubated at 37 °C with 5% CO₂. On the 4th day of incubation, the culture medium was collected. The extracted medium was centrifuged at 1000 rpm for 10 min, and the supernatant was filtered through a sterile filter. Then, 10% FBS was added to the filtered supernatant and used to culture NPCs. Changes in circETS1 expression in NPCs were assessed using circRNA FISH after adding the medium containing MS release solution. Cell proliferation was measured by the Alamar blue assay. RT-qPCR was performed to evaluate changes in the expression of chondrocyte phenotype genes in NPCs.

Animal experiment

A total of 36 male 12-week-old SD rats were randomly assigned to four groups: NC group, operation group, si-circETS1 MUT MS group, and si-circETS1 WT MS group, with 8 rats in each group. Rats in the operation group, si-circETS1 MUT MS group, and si-circETS1 WT MS group were anesthetized with pentobarbital (40–50 mg/kg), and fixed on the surgical table. The tail of the rat was disinfected with iodine tincture, and sterile drapes were placed. Under X-ray fluoroscopy, a 30G needle was used to puncture 1–2 cm from the tail base into the central nucleus pulposus of the rat tail intervertebral disc. After rotating the needle 360° to ensure proper placement, the needle was quickly withdrawn. The puncture site was disinfected with iodine tincture, and pressure was applied to reduce the risk of hematoma or bleeding. Post-operatively, the rats were given intramuscular injections of penicillin to prevent infection. Two weeks after the surgery, rats in the si-circETS1 MUT MS group and si-circETS1 WT MS group were injected with si-circETS1-loaded MS (si-circETS1 MUT and si-circETS1 WT, respectively) at the original surgical site. Both si-circETS1 WT and MUT were designed to target the back-splice site of circETS1, without impacting the expression of linear ETS1 mRNA. The distinction lies in the fact that si-circETS1 WT can hinder the circularization of circETS1, thereby suppressing its expression, whereas si-circETS1 MUT lacks this ability. The procedure was as follows: after anesthetizing the rats and fixing them on the surgical table, the surgical area was disinfected, and a sterile drape was placed. Under X-ray fluoroscopy, a 32G needle was used to slowly inject 10 μl of MS suspension into the nucleus pulposus of the original surgical site. The injection was repeated once a week to ensure the suppression efficiency of si-circETS1 in the rat tail nucleus pulposus tissue. The NC group underwent no surgical procedure.

Histological analysis

Two months after the surgery, all rats were euthanized, and intervertebral disc tissue samples from the puncture sites were collected. HE staining was performed to observe histopathological changes in the intervertebral discs. A quantitative assessment of the intervertebral disc histology in each group was conducted using blinded scoring based on the scoring criteria established by Masuda et al. (1976) immunohistochemical staining was used to detect COL2A1 protein expression in the intervertebral disc tissues. The expression levels were semi-quantified using ImageJ.

Statistical analysis

All experimental data are presented as mean ± standard deviation (SD). The normality of the data was assessed using the Shapiro–Wilk test. Comparisons between two groups were performed using the independent samples t-test. Comparisons among three groups were analyzed by one-way analysis of variance (ANOVA). If the ANOVA results were significant, post hoc comparisons were performed using Tukey’s test. All statistical analyses were conducted using SPSS Statistics 23.0 (IBM Corp., Armonk, NY, USA). A significance level of P < 0.05 was considered statistically significant.

Results

Upregulation of circETS1 expression was closely associated with IDD

Through circRNA-seq of human nucleus pulposus tissues with mild and severe degeneration, we observed significant differential changes in the circRNA expression profile (Fig. 1A, B). We further identified hsa_circ_0002083 as the most highly differentially expressed circRNA with the greatest fold change (Fig. 1C). Hsa_circ_0002083 originates from chromosome 11 and is generated from exons 3 to 7 of the ETS1 gene, thus named circETS1. Sanger sequencing confirmed that circETS1 forms a circular structure with a head-to-tail splice junction (Fig. 1D). To assess the stability of circETS1, we treated human NPCs with RNase R and measured the expression levels of both circETS1 and linear ETS1. The results showed that, after 24 h of RNase R treatment, the expression level of circETS1 remained unchanged (0 h, 1.006 ± 0.100; 24 h, 1.025 ± 0.079), while the expression of linear ETS1 significantly decreased (0 h, 0.981 ± 0.130; 24 h, 0.373 ± 0.057), indicating that circETS1 is resistant to RNase R digestion (Fig. 1E). Furthermore, after inhibiting RNA transcription with Actinomycin D, PCR analysis revealed a gradual decrease in linear ETS1 expression (0 h, 0.997 ± 0.061; 8 h, 0.480 ± 0.060; 16 h, 0.373 ± 0.050; 24 h, 0.287 ± 0.066), while the decrease in circETS1 expression was minimal (0 h, 1.033 ± 0.057; 8 h, 0.927 ± 0.040; 16 h, 0.860 ± 0.056; 24 h, 0.833 ± 0.058), further supporting the excellent stability of circETS1 (Fig. 1F). FISH showed that circETS1 was predominantly located in the cytoplasm of NPCs (Fig. 1G). Upon TNF-α induction to promote degeneration of NPCs, the expression of circETS1 was significantly upregulated (Ctrl, 1.002 ± 0.106; TNF-α, 6.073 ± 0.633) (Fig. 1H). Additionally, PCR and FISH analyses of human nucleus pulposus tissues indicated that the expression of circETS1 was significantly higher in more severely degenerated tissues (Normal, 0.028 ± 0.008; Degenerative, 0.049 ± 0.014) (Fig. 1I, J).

Fig. 1.

CircETS1 was upregulated in degenerated NPCs and nucleus pulposus tissues. A Differential expression heatmap of circRNAs between mild and severe human IDD tissues. B Scatter plot of circRNAs expression. C Volcano plot of circRNAs expression. D The circETS1 was back-spliced by exon 3, 4, 5, 6 and 7 of ETS1 and verified by Sanger sequencing. E RT-qPCR was used to detect the expression of circETS1 and linETS1 in NPCs with RNase R treatment. F RT-qPCR was used to detect the expression of circETS1 and ETS1 in NPCs with Actinomycin D treatment. G FISH results showing the localization of circETS1 in NPCs. H RT-qPCR was used to detect circETS1 expression after TNF-α treatment. I RT-qPCR was used to detect the differential expression of circETS1 in human NP tissues. J FISH was used to detect the differential expression of circETS1 in human NP tissues. The data followed normal distribution and was presented as mean ± standard deviation. T-tests was used for statistical analysis

Inhibition of circETS1 enhanced NPCs activity and promoted extracellular matrix secretion

To further explore the biological function of circETS1 in NPCs, we performed both overexpression and knockdown experiments (Vector, 1.001 ± 0.098; OE-circETS1, 4.731 ± 0.491; siCtrl, 1.003 ± 0.073; si-circETS1-1, 0.328 ± 0.062; si-circETS1-2, 0.362 ± 0.052) (Fig. 2A, B). Cell proliferation assays showed that inhibition of circETS1 (si-circETS1-1, 0 h, 1.01 ± 0.015; 24 h, 1.24 ± 0.103; 48 h, 1.53 ± 0.116; 72 h, 2.08 ± 0.110. si-circETS1-2, 0 h, 1.02 ± 0.015; 24 h, 1.23 ± 0.080; 48 h, 1.64 ± 0.130; 72 h, 2.22 ± 0.140) significantly alleviated TNF-α-induced suppression (Ctrl, 0 h, 1.01 ± 0.010; 24 h, 1.29 ± 0.129; 48 h, 1.81 ± 0.174; 72 h, 2.61 ± 0.148. TNF-α, 0 h, 1.01 ± 0.012; 24 h, 1.14 ± 0.075; 48 h, 1.37 ± 0.120; 72 h, 1.77 ± 0.148) of NPCs proliferation, whereas overexpression of circETS1 (0 h, 1.01 ± 0.010; 24 h, 1.07 ± 0.035; 48 h, 1.19 ± 0.092; 72 h, 1.47 ± 0.090) exacerbated this effect (Fig. 2C). Flow cytometry analysis revealed that inhibiting circETS1 could partially mitigate TNF-α-induced apoptosis in NPCs (Ctrl, 7.79 ± 0.661; siCtrl, 20.89 ± 1.841; si-circETS1-1, 16.56 ± 1.207; si-circETS1-2, 15.74 ± 1.526), while overexpression of circETS1 exacerbated cell apoptosis (Ctrl, 8.49 ± 1.220; Vector, 21.71 ± 1.835; OE-circETS1, 25.81 ± 1.835, Fig. 2D–G). Additionally, immunofluorescence analysis clearly showed that TNF-α treatment led to a significant reduction in the expression of ACAN and COL2A1 proteins secreted by NPCs, but inhibition of circETS1 resulted in a significant increase in the levels of these two proteins, indicating a restoration of extracellular matrix metabolism (Fig. 2H).

Fig. 2.

Knockdown of circETS1 enhanced the viability of NPCs and promoted the secretion of ECM. A, B RT-qPCR was performed to determine the expression of circETS1 in NPCs transfected with OE-circETS1, si-circETS1-1, si-circETS1-2. C:Alamar blue assay was performed to assess proliferation of NPCs after knockdown and overexpressing circETS1. D, E The apoptosis of NPCs transfected with OE-circETS1 under TNF-α was detected by flow cytometry. F, G The apoptosis of NPCs transfected with si-circETS1-1, si-circETS1-2 under TNF-α was detected by flow cytometry. H The expression of cartilage phenotype proteins in NPCs transfected with OE-circETS1, si-circETS1-1, si-circETS1-2 under TNF-α was detected by immunofluorescence. The data followed normal distribution and was presented as mean ± standard deviation. One-way ANOVA or T-tests was used for statistical analysis

si-circETS1-loaded MS effectively protected NPCs in vitro

Given that inhibition of circETS1 effectively enhanced NPCs activity and promoted extracellular matrix secretion, circETS1 represents an ideal target for treating IDD. In this study, we prepared PLGA MS loaded with si-circETS1 using the emulsification-solvent evaporation method. Electron microscopy revealed that the MS were spherical in shape (Fig. 3A). Laser particle size analysis showed that the MS had a diameter of approximately 54.85 ± 24.92 μm (Fig. 3B). The encapsulation efficiency of si-circETS1 in the MS was approximately 88.52%. Additionally, continuous monitoring showed that the MS could release si-circETS1 over a period of about 7–8 days, with a stable release profile (Fig. 3C). To further observe the uptake of si-circETS1 released from the MS by NPCs, FISH was performed. Compared to the control group, no-loaded MS group, and si-circETS1 MUT MS group, the si-circETS1 WT MS group exhibited a significant reduction in circETS1 expression levels in NPCs (Fig. 3D). Moreover, proliferation assays showed that NPCs treated with si-circETS1 WT MS exhibited the highest proliferative ability (NC, 0 days, 1.03 ± 0.015; 1 days, 1.37 ± 0.225; 3 days, 3.32 ± 0.212; 5 days, 4.71 ± 0.200; 7 days, 4.85 ± 0.220. No-loaded MS, 0 days, 1.04 ± 0.021; 1 day, 1.29 ± 0.142; 3 days, 3.21 ± 0.350; 5 days, 4.41 ± 0.372; 7 days, 4.62 ± 0.269. si-circETS1 MUT MS, 0 days, 1.04 ± 0.025; 1 day, 1.49 ± 0.251; 3 days, 3.54 ± 0.241; 5 days, 4.87 ± 0.390; 7 days, 5.19 ± 0.212. si-circETS1 WT MS, 0 days, 1.04 ± 0.021; 1 day, 1.96 ± 0.261; 3 days, 4.04 ± 0.249; 5 days, 5.49 ± 0.236; 7 days, 6.09 ± 0.308 Fig. 3E). RT-qPCR revealed that NPCs treated with si-circETS1 WT MS had the highest expression levels of ACAN (NC, 1.001 ± 0.075. No-loaded MS, 0.287 ± 0.061. si-circETS1 MUT MS, 0.289 ± 0.038. si-circETS1 WT MS, 0.678 ± 0.085) and COL2A1 (NC, 1.002 ± 0.098. No-loaded MS, 0.362 ± 0.084. si-circETS1 MUT MS, 0.338 ± 0.081. si-circETS1 WT MS, 0.666 ± 0.052) genes (Fig. 3F).

Fig. 3.

Characterization and functional evaluation of circETS1-loaded MS in vitro. A SEM was used to observe the morphology of PLGA-MS. B Diameter distribution of PLGA MS. C si-circETS1 release detection of PLGA MS in vitro. D FISH was used to detect the expression of circETS1 in NPCs after adding differential MS. E Alamar blue assay was performed to assess proliferation of NPCs after adding differential MS. F The expression of ACAN and COL2A1 gene in NPCs after adding differential MS was detected by RT-qPCR. The data followed normal distribution and was presented as mean ± standard deviation. One-way ANOVA or T-tests was used for statistical analysis

si-circETS1-loaded MS alleviated IDD

Safranin O-fast green staining showed that rats in the operation group and si-circETS1 MUT MS group exhibited significant IDD, whereas rats in the si-circETS1 WT MS group showed markedly reduced degeneration (NC, 4.0 ± 0.000. No-loaded MS, 11.0 ± 1.069. si-circETS1 MUT MS, 11.0 ± 1.195. si-circETS1 WT MS, 8.6 ± 1.408, Fig. 4A, B). Finally, immunohistochemical analysis revealed that the COL2A1 content in the nucleus pulposus tissue of rats in the si-circETS1 WT MS group was significantly higher than in the operation group and si-circETS1 MUT MS group (NC, 39.149 ± 8.143. No-loaded MS, 10.675 ± 6.727. si-circETS1 MUT MS, 11.151 ± 6.239. si-circETS1 WT MS, 28.240 ± 10.074, Fig. 4C, D).

Fig. 4.

The repair effect of circETS1-loaded MS in vivo. A, B Safranin-fast green staining was used to observe and quantify the pathological changes in rat tail intervertebral disc. C, D Immunohistochemistry was used to observe and quantitatively analyze the expression of COL2A1 of rat tail intervertebral disc. The data followed normal distribution and was presented as mean ± standard deviation. One-way ANOVA or T-tests was used for statistical analysis

Discussion

The intervertebral disc consists of the nucleus pulposus at its center, surrounded by the annulus fibrosus, and capped by the endplates above and below. NPCs play a crucial role in maintaining the balance between extracellular matrix synthesis and degradation by producing type II collagen, proteoglycans, and other components, thus contributing to the stability of the intervertebral disc (Kepler et al. 2013). When the number of NPCs decreases and their activity are suppressed, resulting in a reduction in proteoglycan secretion, the extracellular matrix homeostasis is disrupted, leading to structural damage in the nucleus pulposus tissue (Yurube et al. 2023). As the disease progresses, the water content in the nucleus pulposus decreases, fibrosis occurs, and in the later stages, issues such as nerve compression and vertebral slippage may arise. Since the nucleus pulposus tissue is avascular, the exchange of substances between the internal and external environment relies solely on diffusion via concentration gradients. This makes self-repair of IDD difficult and results in irreversible damage (Gao et al. 2022b). Therefore, studying the dysfunction of NPCs and targeting interventions could provide promising strategies for the repair of IDD (Sun et al. 2022).

CircRNAs are a special class of non-coding RNAs characterized by a closed circular structure, making them more stable post-transcription and less prone to degradation by RNA exonucleases (Shi et al. 2020). In recent years, studies have revealed that circRNAs are closely associated with the pathological process of IDD, particularly in regulating the proliferation, apoptosis, inflammation, and extracellular matrix degradation in intervertebral disc cells. Wang et al. (2024) reported that circEYA3 mediates NPCs proliferation, apoptosis, and extracellular matrix degradation, exacerbating IDD by activating the IKKβ promoter region to regulate the NF-κB signaling pathway. Yu et al. (2024) identified a novel circRNA, circATXN1, which accelerates NPCs senescence, disrupts extracellular matrix organization, and inhibits mitochondrial function. Mechanistically, circATXN1 is regulated by splicing via A2B1, which promotes progerin translocation from the nucleus to the cytoplasm and inhibits the expression of IGF-1R. Huang et al. (2021) detected a significant reduction in circSPG21 expression in degenerative NPCs, and further research confirmed that low expression of circSPG21 is directly linked to NPCs senescence and metabolic imbalance, suggesting its potential as a therapeutic target for IDD. In this study, we identified circETS1, which is highly associated with IDD progression. Functional experiments demonstrated that inhibiting circETS1 could alleviate the reduction in NPCs viability and extracellular matrix metabolism suppression induced by TNF-α, suggesting that circETS1 could serve as a novel target to reverse IDD.

Gene therapy, which involves silencing pathological genes or editing genes to treat diseases without drugs, radiation, or surgery, is considered a promising method to repair IDD at its source (Takeoka et al. 2020). circRNAs, as stable expression vectors, can continuously regulate specific gene expressions and thus hold potential for IDD treatment. For example, therapeutic circRNAs could be introduced into intervertebral disc cells via genetic engineering, achieving long-term therapeutic effects and slowing down degeneration. However, the success of gene therapy depends on the effective transfer of genes to target cells for sustained expression (Samanta et al. 2023). Direct injection of gene delivery agents into target organs often leads to rapid degradation, making it difficult to precisely target local lesions. Therefore, carriers are essential for packaging genes and delivering them into cells for genetic information expression (Kamali et al. 2021). Most studies have employed viruses for gene delivery, but viral safety concerns remain unresolved. Non-viral carriers, on the other hand, have several advantages, including lower carcinogenicity, immunogenicity, and ease of synthesis (Sousa et al. 2019). Chen et al. (2022) constructed a composite hydrogel loaded with si-STING to intervene in the abnormal expression of the STING gene in degenerative NPCs, demonstrating that the composite hydrogel could effectively deliver si-STING and slow down IDD. In summary, there is a critical need to develop more new non-viral carrier systems to overcome the obstacles of gene therapy.

PLGA is a commonly used biodegradable polymer composed of lactic acid and glycolic acid through copolymerization. It is widely used in drug delivery, tissue repair, and regenerative medicine due to its excellent biodegradability, biocompatibility, and controllable drug release properties (Zhou et al. 2023). In the treatment of IDD, PLGA MS also show great potential as drug delivery carriers. On one hand, PLGA MS can serve as carriers for drugs or cytokines, directly acting on degenerated intervertebral disc regions to achieve sustained and controlled release (Ma et al. 2024). Cheng et al. (2022) mixed IL-4 and kartogenin-loaded PLGA MS with injectable composite hydrogel scaffolds and injected them into rat intervertebral discs, effectively regulating the local inflammatory microenvironment and continuously repairing the nucleus pulposus tissue. On the other hand, PLGA MS can also serve as gene carriers to deliver gene drugs, siRNA, or mRNA into intervertebral disc cells to regulate the expression of specific genes. PLGA enables protection of the siRNA from nuclease-mediated degradation and facilitates a sustained release profile through its controlled hydrolytic degradation into lactic and glycolic acids-both of which are naturally metabolized by the body. Xiao et al. (2023) found that PLGA MS loaded with TGF-β1 and miR-141 inhibitors could reverse IDD by inhibiting NPCs degeneration. In this study, we used circETS1, identified as a therapeutic target for IDD, and constructed si-circETS1-loaded PLGA MS for local injection. These microspheres exhibit controlled release of si-circETS1, and FISH experiments showed that the release solution significantly reduced the expression of circETS1 in NPCs. The release kinetics of si-circETS1 can be finely adjusted by modifying the copolymer composition, molecular weight, and microsphere characteristics such as size and porosity. Moreover, histopathological analysis demonstrated a significant delay in IDD in animal models. These results strongly indicated that si-circETS1-loaded MS have good delivery efficiency and biocompatibility, effectively suppressing circETS1 expression in both in vitro and in vivo models, thereby providing therapeutic benefits for IDD.

Nonetheless, it was found through testing that the microspheres can fully release si-circETS1 in vitro within 7–8 days in this study. Therefore, in animal experiments, we chose to inject once a week. However, if we want to promote the application of this therapeutic technology in clinical practice, we need to further improve the sustained release rate and encapsulation efficiency of microspheres to maintain long-term inhibition of targeted circRNA. In addition, we can further combine imaging or guidance techniques to enhance the targeting of si-circRNA in vivo. For example, magnetic targeting technology can load si-circRNA into PLGA microspheres or nanoparticles containing superparamagnetic iron oxide nanoparticles (SPIONs), and guide their enrichment to the target area in vitro using an external magnetic field. In addition, fluorescence/near-infrared imaging guidance couples si-circRNA with specific fluorescent dyes (such as Cy5, Cy7, ICG) or quantum dots, and its distribution pathway can be monitored in real-time in vivo through near-infrared imaging (NIRF). All of the above content needs to be further explored and improved in our subsequent research.

Conclusion

In summary, our study demonstrated that circETS1 is an effective therapeutic target for IDD. PLGA MS loaded with si-circETS1 provided a promising approach for treating IDD, showing satisfying therapeutic effects (Fig. 5). These findings offered new insights into the treatment of IDD.

Fig. 5.

Graphical abstract. PLGA MS loaded with si-circETS1 provided a promising approach for treating IDD

Author contributions

Jiaming Wu designed the research. Wenlei Nie and Rong Zhang performed the data analysis. Wenlei Nie, Pingfeng Xie and Min Yang performed the experiments. Wenlei Nie wrote the manuscript. Jiaming Wu edited the manuscript.

Funding

Not applicable.

Data availability

According to the requirements, data can be obtained from the corresponding author to support the results of this study.

Declarations

Conflict of interest

The authors declare that they have no competing interests.

Ethical approval

The Ethics Committee of The First People’s Hospital of Wuhu City approved the research protocol.

Consent for publication

All authors have approved the manuscript for publication. All the authors listed have approved the manuscript that is enclosed.