Abstract
The nutria was introduced to Europe from South America and kept for the fur industry. This semiaquatic rodent became a well-established species in the Czech Republic; however, it still poses a significant threat to the native fauna, not only as a natural competitor but also as a vector of non-indigenous parasites. Our research aimed to investigate the diversity of endoparasitic helminths in nutria, with a particular focus on assessing the risk posed by helminth species with zoonotic potential. A total of 46 nutria cadavers were collected at 8 locations in the Morava River basin and examined using standard parasitological post-mortem procedures. Additionally, coprological and molecular methods were used to identify the parasites. The presence of 6 helminth species was revealed. The highest prevalence was observed for Strongyloides myopotami (78.3%) and Trichuris myocastoris (37.0%), both of which are host-specific nematodes of nutria. Only 2 trematode taxa were recorded (Echinostoma sp. and a representative of the family Psilostomidae). The presence of alveolar hydatid cysts of Echinococcus multilocularis in the livers of 5 nutria specimens was also recorded. Herein, we provide novel molecular data for each parasite species collected, which is valuable for future phylogenetic analyses. Our findings also demonstrate that nutria in the Czech Republic serve as a carrier of helminths with zoonotic potential, particularly E. multilocularis and S. myopotami. Although the nutria is a relatively new species in local fauna, its synanthropic behaviour raises concerns about potential threats to human health, underscoring the importance of exercising caution when handling these animals.
Keywords: biological invasions, coypu, Echinococcus multilocularis, parasites, Strongyloides, Trichostrongylidae

Introduction
Invasive species represent a pervasive and formidable consequence of globalization, resulting in significant economic damage and posing substantial threats to indigenous biodiversity (Gethöffer and Siebert, 2020). Through their disruptive effects on ecosystems, these species cause declines in biodiversity and may precipitate species extinctions via direct predatory activities (Atkinson, 1996). Additionally, they frequently act as vectors for zoonotic diseases or serve as reservoir hosts for such pathogens.
Myocastor coypus, commonly known as the nutria or coypu, is prominently featured among the 100 most detrimental invasive species worldwide (Lowe et al., 2000) and is formally recognized within the Catalogue of Invasive Alien Species of the European Union (European Commission, 2022). This semi-aquatic rodent, native to South America, is currently distributed across all continents except Australia (and New Zealand) and Antarctica (Woods et al., 1992).
The introduction of nutria to the Czech Republic during the early 20th century, primarily driven by fur trading (Anděra, 2011), typifies its successful establishment beyond its native range. Currently, nutrias occupy more than two-thirds of the country's territory (AOPK ČR, 2023). Although there is no general overpopulation, in urban areas where residents feed nutria during winter months, their population size is gradually growing. This trend is further evidenced by a significant increase in official hunting records in recent years: around 1000 individuals in 2010, more than 5000 in 2015, and a staggering 12 580 in 2021 (CZSO, 2024). However, the actual numbers could be several times higher as a large proportion of hunters do not report their catches.
In the Czech Republic, the nutria was initially considered a non-native species with no apparent impact on nature. However, when overpopulated, it damages aquatic and wetland ecosystems to a significant degree, primarily changing the species composition of plants and reducing green biomass (Grace and Ford, 1996; Evers et al., 1998; Shaffer et al., 2015). With its invasion, nutria can push native species out of the landscape. It also brings the risk of introducing diseases such as tularaemia, brucellosis, leptospirosis or toxoplasmosis to domestic species (Scheuring, 1990; Howerth et al., 1994; Bounds et al., 2003; Martino et al., 2014).
Parasites introduced alongside their hosts into novel territories can profoundly alter natural host–parasite dynamics, thus posing health hazards to native biota and gradually influencing the demography of sympatrically coexisting native fauna (Prenter et al., 2004; Dunn, 2009; Britton, 2012). The nutria is host to a relatively high number of parasitic species, with some of them having a zoonotic potential. In its native range, the nutria can harbour more than 30 different helminth species (see Martino et al., 2012; Fugassa, 2020). Although the helminth communities in introduced areas are slightly altered, the majority of the parasitic taxa overlap with those from native range populations. However, some parasitic species were recorded only in the non-native range [e.g. Trichostrongylus duretteae (Zanzani et al., 2016) and Taenia taeniaeformis (Umhang et al., 2013)].
One representative of zoonotic species, which was previously recorded only within non-native nutria populations, is Echinococcus multilocularis [i.e. in France, Germany and Slovenia (Oksanen et al., 2016; Romig and Wassermann, 2024)]. Although information on echinococcosis (a disease caused by Echinococcus tapeworms) in nutria is limited, a study in western Germany found that feral nutrias are susceptible to E. multilocularis infection, but less so than muskrats from the same habitat (Hartel et al., 2004). In a French zoo, a captive-born nutria was found to have echinococcosis, presumably introduced through the feces of free-roaming foxes (Umhang et al., 2013). Even though this species was not previously recorded from nutria in the Czech Republic, it is a common parasite of foxes in the region, which serve as definitive hosts, and in some counties the prevalence among free roaming foxes reaches more than 50% (i.e. Kolářová et al., 1996; Pavlásek 1998; Martínek et al., 2001, and data provided by the State Veterinary Administration of the Czech Republic from their previous screenings in 2011). The other species with zoonotic potential is Strongyloides myopotami, a specialist of the nutria that causes cutaneous infections in humans known as ‘nutria itch’. Although they do not cause true strongyloidiasis, repeated exposure to larvae of this species may cause an outbreak of severe dermatitis (Little, 1965). This species was previously documented in nutria in the Czech Republic only among farm-bred animals (Nechybová et al., 2018).
Information on the parasites of nutria in the non-native range (i.e. Europe) is still rather scarce. Previous studies suggest that the species diversity in this range is lower in comparison with the native range (e.g. Lewis and Ball, 1984; Nardoni et al., 2011; Umhang et al., 2013; Zanzani et al., 2016; Kellnerová et al., 2017; Nechybová et al., 2018; Ježková et al., 2021). While the nutria has retained some of the specialist species from its native range [e.g. Trichuris myocastoris (Rylková et al., 2015) or S. myopotami (Zanzani et al., 2016)], it has also acquired some new, often generalist, parasite taxa in non-native areas [e.g. Trichostrongylus durettae (Zanzani et al., 2016) or E. multilocularis (Romig and Wassermann, 2024)]. Nonetheless, there is little comprehensive information on the parasites of free-ranging nutria in the Czech Republic (i.e. Nechybová et al., 2018; Ježková et al., 2021). In order to compare the diversity of helminth species harboured by Czech nutrias with populations in other countries, the aims of the present study were: (1) to collect data on helminth parasites from different nutria populations in the Czech Republic, (2) to compare the compositions of parasite communities between these populations, and lastly (3) to acquire molecular data for each of the collected helminth species to elucidate genetic structure and intraspecific variability among populations of parasites.
Material and methods
Study area and specimen collection
From January to March 2022, a total of 46 nutria were collected at 8 locations within the Morava catchment in the Czech Republic (Fig. 1, Table 1). The retrieved individuals were placed in plastic bags, and their location, sex and weight were recorded. After transportation to the necropsy room, the viscera were excised and stored frozen.
Figure 1.
Locations of the sites within the Czech Republic where the investigated nutria individuals were collected. (1) Šumperk; (2) Ústí nad Orlicí; (3) Olomouc; (4) Brno-city; (5, 6) Brno-vicinity; (7) Hodonín; (8) Břeclav.
Table 1.
List of collection sites and number of processed nutria individuals
| Site ID | Site coordinates | Locality | District | N of nutria | M/F ratio |
|---|---|---|---|---|---|
| 1 | 49.9832700N, 16.7664256E | Šumperk | Olomouc | 5 | 1/4 |
| 2 | 49.8593331N, 16.7031469E | Ústí nad Orlicí | Pardubice | 3 | 1/2 |
| 3 | 49.5484928N, 17.2717108E | Olomouc | Olomouc | 5 | 5/0 |
| 4 | 49.1656986N, 16.6231097E | Brno-city | South Moravian | 2 | */1 |
| 5 | 49.1298936N, 16.6161361E | Brno-vicinity | South Moravian | 15 | 13/2 |
| 6 | 48.9228814N, 16.5600242E | Brno-vicinity | South Moravian | 5 | 2/3 |
| 7 | 48.9735006N, 17.3723258E | Hodonín | South Moravian | 5 | 4/1 |
| 8 | 48.7349381N, 16.9997347E | Břeclav | South Moravian | 6 | 4/2 |
An asterisk at the sex ratio represents the unidentifiable sex of the specimen.
Parasite sampling, fixation and identification
Before parasitological examination, the viscera were gradually thawed. The lungs and liver were examined as squash preparations under an SZX7 stereomicroscope (Olympus, Japan). The heart was cut open using scissors and examined macroscopically. The stomach, small intestine, caecum and colon were longitudinally incised, and the contents of the individual organs were separately diluted with water, homogenized and cleaned using a sieve system with the smallest mesh size of 150 μm. Subsequently, the material retained on the sieve, as well as the walls of the individual organs, was examined under the stereomicroscope.
The collected helminths were counted and stored in 70% ethanol for further morphological analyses. When possible, at least 5 individuals of each helminth species per host specimen were preserved in 96% pure-grade ethanol for DNA extraction. Before fixation in Canada balsam, digeneans were stained in iron acetocarmine, following the protocol of Georgiev et al. (1986). The species identification of digeneans and selection of measurements for morphometric comparison followed the procedures outlined by Gibson et al. (2002), Jones et al. (2005) and Bray et al. (2008). Nematodes were mounted on slides, covered in a mixture of glycerine and water (in a ratio of 3:7), and cleared by gradually increasing the volume of glycerol, according to Moravec (2013).
To support the findings from the parasitological necropsy, fresh fecal samples available from 20 out of all examined individuals were subjected to coproscopical examination using the modified Sheather's sugar flotation method (Sheather, 1923; Jirků-Pomajbíková and Hůzová, 2018). Briefly, walnut-sized fecal samples were homogenised with water using a mortar and pestle, sieved into a tube and centrifuged at 2000 rpm for 3 min. The supernatant was removed, and the sediment was mixed with a sugar solution with a density of 1.3 g/cm3. The sample was centrifuged again at 2000 rpm for 3 min. A surface film containing parasite stages was transferred to a slide with an inoculating loop, covered with a coverslip and examined under a light microscope (Foreyt, 2002).
Primary epidemiological data, including prevalence, mean abundance and minimum and maximum intensities of infection, were calculated for each parasite species according to Bush et al. (1997). Prevalence was defined as the percentage of host individuals infected by a given parasite species, and mean abundance was calculated as the mean number of parasite specimens per individual host considering both infected and uninfected hosts. Following the suggestion of Rózsa et al. (2000) for interpreting epidemiological data, a confidence interval at the level of 95% was calculated for mean abundance.
PCR amplification, sequence analysis and phylogenetic analyses
Total DNA from fresh or frozen fecal samples (N = 40) was isolated using PowerSoil DNA isolation kit (Qiagen Company, USA). The extracted fecal DNA was screened by qPCR for the detection of Strongyloides (18S rDNA) using a Real-Time PCR LightCycler® 480 (Roche, Switzerland). The primers and reaction conditions used followed Verweij et al. (2009).
Parasite genomic DNA was extracted using NucleoSpin® Tissue kit (Macherey-Nagel, Düren, Germany) following the manufacturer's protocol. Prior to extraction, the specimens (or their parts) were removed from the ethanol and dried in a thermal block. The PCR reactions were performed in a 20 μL reaction mixture containing 14 μL nuclease-free water, 4 μL FIREPol Master Mix Ready to Load (Solis BioDyne, Tartu, Estonia), 0.5 μm of each primer and 1 μL of DNA template. PCR products were detected by electrophoresis in 1% agarose gels stained with GoodView (SBS Genetech, Bratislava, Slovakia). A total of 8 different primer combinations were used for the amplification of specific genomic regions in nematodes, trematodes and cestodes. A list of primer sequences and cycling conditions is provided in Table 2. The resulting amplicons were subsequently subjected to Sanger sequencing, after which the obtained sequences were compared in silico with data available in publicly accessible databases and were also used for phylogenetic analyses.
Table 2.
List of primers used for PCR amplification of mitochondrial and nuclear markers in the present study
| Target taxa | Region | Primer name | Direction | Sequence (5′-3′) | PCR thermal profile | Reference |
|---|---|---|---|---|---|---|
| Strongyloides spp. | 18S rDNA | Nem_18S_F | Forward | CGCGAATRGCTCATTACAACAGC | 94°C, 5 min; 35 × (94°C, 30 s; 54°C, 30 s; 72°C, 60 s); 72°C, 10 min | Floyd et al. (2005) |
| Nem_18S_R | Reverse | GGGCGGTATCTGATCGCC | ||||
| Strongyloides spp., Trichostrongylus spp. | COI mtDNA | SPP_COX_F | Forward | TTTGATCCTAGTTCTGGTGGTAATCC | 94°C, 10 min; 45 × (94°C, 10 s; 60°C, 10 s; 72°C, 10 s); 72°C, 2 min | Barratt et al. (2019) |
| SPP_COX_R | Reverse | GTAGCAGCAGTAAAATAAGCACGAGA | ||||
| Trichostrongylus spp. | ITS1-5.8S-ITS2 rDNA | NC5 | Forward | GTAGGTGAACCTGCGGAAGGATCATT | 94°C, 10 min; 30 × (94°C, 30 s; 55°C, 30 s; 72°C, 30 s); 72°C, 10 min | Newton et al. (1998) |
| NC2 | Reverse | TTAGTTTCTTTTCCTCCGCT | ||||
| Trichuris spp. | ITS1-5.8S-ITS2 rDNA | NC5 | Forward | GTAGGTGAACCTGCGGAAGGATCATT | 94°C, 10 min; 35 × (94°C, 60 s; 55°C, 60 s; 72°C, 60 s); 72°C, 10 min | Rylková et al. (2015) |
| NC2 | Reverse | TTAGTTTCTTTTCCTCCGCT | ||||
| Digenea | COI mtDNA | JB3 | Forward | TTTTTTGGGCATCCTGAGGTTTAT | 95˚C, 2 min; 40 × (95°C, 30 s; 50°C, 30 s; 72°C, 60 s); 72°C, 2 min | Bowles & McManus (1993); Miura et al. (2005); Benovics et al. (2022) |
| COI-R_trema | Reverse | CAACAAATCATGATGCAAAAGG | ||||
| Digenea | 28S rDNA | LSU5 | Forward | TAGGTCGACCCGCTGAAYTTAAGCA | 94˚C, 3 min; 40 × (94°C, 30 s; 56°C, 30 s; 72°C, 2 min); 72°C, 7 min | Olson et al. (2003) |
| 1500R | Reverse | GCTATCCTGAGGGAAACTTCG | ||||
| Echinococcus spp. | 16S mtDNA | rrnS-F | Forward | AGCCAGGTCGGTTCTTATCTATTG | 94°C, 10 min; 35 × (94°C, 60 s; 61°C, 30 s; 72°C, 60 s); 72°C, 10 min | Šoba et al. (2020) |
| rrnS-R | Reverse | CGAGGGTGACGGGCGGTGTGTAC | ||||
| Echinococcus spp. | NAD5 mtDNA | NAD5f | Forward | GCCCCIACICCAGTIAGTTCT | 94°C, 10 min; 35 × (94°C, 60 s; 50°C, 30 s; 72°C, 60 s); 72°C, 10 min | Šoba et al. (2020) |
| NAD5r | Reverse | AAIACACTTAGAIACICCATGACT |
In order to assess the phylogenetic position of selected parasite taxa (i.e. in the case of strongylids) and/or selected haplotypes (i.e. in the case of COI variants of various Strongyloides spp.), additional orthologous sequences from congeners or different phylogenetically close species were obtained from GenBank (accession numbers are included within phylogenetic trees). The sequences were aligned by means of the fast Fourier transform algorithm implemented in MAFFT (Katoh et al., 2002), using the G-INS-i refinement method. A general time-reversible model (GTR; Lanave et al., 1984) was applied for each partition of the alignment, each representing an individual genomic region. For the Strongyloides spp. dataset, the GTR model was applied for the entire length of the alignment. Phylogenetic trees were constructed using Bayesian inference (BI) and maximum likelihood (ML) approaches in MrBayes 3.2. (Ronquist et al., 2012) and RAxML 8.1.12 (Stamatakis, 2006, 2014), respectively. The BI analysis used the Metropolis-coupled Markov chain Monte Carlo algorithm with 2 parallel runs of 1 cold and 3 hot chains, and was run for 106 generations, sampling trees every 100 generations. The initial 30% of all saved trees were discarded as ‘burn-in’ after checking that the standard deviation split frequency fell below 0.01. The convergence of the runs and the parameters of individual runs were checked using Tracer v. 1.7.1 (Rambaut et al., 2018). Posterior probabilities for each tree node were calculated as the frequency of samples recovering a given clade. The clade bootstrap support for ML trees was assessed by simulating 103 pseudoreplicates.
Results
Nutria's helminth diversity and epidemiology
A total of 6 helminth species were collected from 46 nutria specimens during microscopical examination (Table 3). The highest prevalence (67.4%) was recorded for S. myopotami, which parasitized nutrias from all collection sites (Fig. 2). This species also exhibited the highest mean abundance and maximum intensity of infection among the examined individuals. The flotation method revealed this species (as infectious eggs) in each fresh fecal sample (Fig. 3), even when the examination of the viscera did not yield any adult specimens. After combining the data from necropsy and flotation, the overall prevalence increased to 78.3%. In addition, qPCR analysis confirmed the presence of Strongyloides DNA in 100.0% of the tested fecal samples, further corroborating its high prevalence. Combining all 3 methods, the total prevalence of S. myopotami reached 93.5% among all processed nutria individuals. The second most prevalent species was T. myocastoris, which was, during dissection, recorded in nutria from all sites except Olomouc (site 3) and Břeclav (site 8). Molecular analysis revealed that this species was genetically identical in the ITS1-5.8S-ITS2 region to T. myocastoris specimens previously documented in the Czech Republic (MF077367). Echinococcus multilocularis hydatids (Fig. 4) were found in the livers of 5 individuals, altogether from 3 sites (Table 3). A further unidentified trematode species was also found in 5 nutria individuals (collected from 2 nutrias from site 6, 2 nutrias from site 8 and 1 nutria from site 3). Due to the poor quality of the material, especially as a result of deep freezing the cadavers, morphological identification of these trematodes was not possible. However, the molecular sequences (partial 28S rDNA and partial COI mtDNA regions) suggest that these specimens belonged to the family Psilostomidae, as they had 99.8% similarity to a sequence of Psilostomidae gen. sp. in GenBank (MN726950; see Table 3 with accession numbers for the newly obtained DNA sequences). Trichostrongylus nematodes were also recorded in nutria from 3 collection sites, but could not be identified to species level due to the insufficient number and quality of specimens for morphological evaluation (Fig. 5). Additionally, a single nutria individual, collected in the vicinity of Brno city (site 6), was parasitized by Echinostoma trematodes. Only 2 specimens of this helminth species were collected and all visible morphological features resembled Echinostoma revolutum.
Table 3.
List of collected parasite species identified during microscopical examination, with localization, basic epidemiological data, sites with positive records, GenBank accession numbers to newly generated sequences and information about previous records from nutria in the Czech Republic
| Species | Localization | P | A | I | Sites | GB no. | Previous records in Czech Republic (prevalence) | Reference |
|---|---|---|---|---|---|---|---|---|
| Strongyloides myopotami | Small intestine, large intestine | 67.4% (93.5%) | 21.89 ± 16.29 | 1–206 | All | PQ568308–PQ568310 (COI); PQ568420 (18S) | Farm-bred nutria (11.5%), feral nutria (25.0–30.0%) | Nechybová et al. (2018) |
| Trichuris myocastoris | Caecum, large intestine, small intestine | 37.0% (39.1%) | 3.26 ± 3.37 | 1–37 | 1, 2, 4, 5, 6, 7 (3) | PQ571257, PQ571258 (ITS) | Farm-bred nutria (57.0%), feral nutria (5.0–40.0%) | Nechybová et al. (2018) |
| Trichostrongylus sp. | Small intestine | 8.7% (10.8%) | 0.43 ± 0.80 | 3–9 | 3, 5 (6) | PQ567056–PQ567059 (COI); PQ570797 (ITS) | Farm-bred nutria (4.0%) | Nechybová et al. (2018) |
| Echinostoma sp. | Small intestine | 2.2% | 0.04 ± 0.00 | 2 | 6 | – | N/A | N/A |
| Psilostomidae gen. sp. | Small intestine | 10.8% | 0.21 ± 0.30 | 1–3 | 3, 6, 8 | PQ569938 (28S) | N/A | N/A |
| Echinococcus multilocularis | Liver | 10.8% | – | – | 1, 2, 5 | PQ786491 (NAD5) | N/A | N/A |
P = prevalence; A = mean abundance with confidence interval at the level of 0.95; I = intensity of infection (min–max); GB no. = GenBank accession numbers to the representative sequences. Prevalence values and site numbers in brackets are for records including flotation and quantitative PCR results. Dashes (–) indicate the species was recorded in an uncountable number of cysts. N/A indicates that this parasite taxon was not previously recorded in nutria from the Czech Republic.
Figure 2.
Microscopic details of Strongyloides myopotami parasitic females. Scale bar = 20 μm. (A) anterior end; (B) egg in the uterus; (C) detail of vulva; (D) posterior end with tail and anus.
Figure 3.
Egg stages of Nematoda detected in nutria fecal samples using Sheather's sugar flotation. Scale bar = 50 μm. (A) Oval egg with so-called U-larva of Strongyloides myopotami; (B) egg of Trichuris myocastoris; (C) egg of strongylid nematode, probably Trichostrongylus sp.
Figure 4.
Alveolar hydatid cysts of Echinococcus multilocularis in the liver of nutria collected near the city of Šumperk. Examples of cysts are pinpointed by white arrows.
Figure 5.
Microscopic details of Trichostrongylus sp. specimen. Scale bar = 100 μm. (A) The anterior end of the male; (B) the posterior end of the male with spicules and copulatory bursa.
Genetic diversity and variability in obtained nematode species
All obtained helminth species were sequenced to analyse genetic diversity and intraspecific variability. For trematodes, no intraspecific variability was observed in either the 28S or COI region. For T. myocastoris and Trichostrongylus sp. only a minor intraspecific variability was observed in COI and no variability in ITS regions. A total of 49 S. myopotami specimens were sequenced, all of which were identical in the 18S region to the S. myopotami sequence deposited in GenBank (AB453313). The amplified COI region spanned 240 nucleotide positions, and 3 distinct genetic variants were identified among these individuals. Haplotype I was observed in individuals at all sites where S. myopotami was present. Haplotype II was absent in individuals from Šumperk (site 1). All 3 haplotypes were found only in individuals from the Brno-vicinity (site 6), with only 1 sequenced individual carrying haplotype III. Haplotypes II and III were the most similar, differentiating in only 1 substitution. Only a single S. myopotami specimen was collected from Ústí nad Orlicí; however, PCR amplification did not yield products of sufficient quality, and therefore, it was not possible to assess the haplotype present at this site.
The resulting Strongyloides phylogenetic tree revealed 12 separate clades corresponding to different Strongyloides species. For the partial COI mtDNA region of Strongyloides, the alignment consisted of 26 sequences, including Necator americanus as the outgroup. Both BI and ML analyses generated trees with identical topologies. The BI tree with posterior probabilities and bootstrap values (corresponding to the ML tree) along respective nodes is presented in Fig. 6. All the haplotypes of S. myopotami from nutrias clustered within a highly supported subclade. However, its position was not fully resolved due to the basal polytomy of the tree.
Figure 6.
Phylogenetic tree of 25 sequences of Strongyloides species reconstructed by Bayesian inference. The tree is rooted using Necator americanus as an outgroup. Values at the nodes indicate posterior probabilities from BI and bootstrap values from ML analyses. Dashes indicate nodal support values below 0.70 and 50, respectively. The hosts of respective Strongyloides specimens are noted in brackets.
The final sequence alignment, encompassing selected trichostrongylid species and the outgroup Ancylostoma braziliense, was constructed using the ITS1-5.8S-ITS2 region. The alignment included 44 taxa and spanned 775 unambiguously aligned nucleotide positions. The BI tree, with posterior probabilities and bootstrap values (corresponding to the ML tree) along respective nodes, is presented in Fig. 7. Trichostrongylus spp. formed a well-supported monophyletic group, with the sister position to the Libyostrongylus spp. The Trichostrongylus sp. collected from nutria in the Czech Republic clustered within the ‘Trichostrongylus’ clade; however, its position was not fully resolved, resulting in polytomy. This Trichostrongylus sp. shared 98.3% sequence similarity with T. vitrinus which was collected from Roe deer (Capreolus capreolus) in Russia. The species collected from nutrias in the Czech Republic exhibited greater genetic dissimilarity (>2%) to T. axei or T. colubriformis, suggesting it represents a distinct species.
Figure 7.
Phylogenetic tree of 43 sequences of 15 trichostrongylid species reconstructed by Bayesian inference. The tree is rooted using Ancylostoma braziliense as an outgroup. Values at the nodes indicate posterior probabilities from BI, and bootstrap values from ML analyses. Dashes indicate nodal support values below 0.70 and 50, respectively. The hosts of respective trichostrongylid specimens are noted in brackets. N/A indicates that the host information is not available.
The sequencing of 2 mitochondrial genomes supported the identification of the hydatid cysts as E. multilocularis. The individuals collected from nutrias in the Czech Republic were genetically identical in the NADH region to those from nutrias in Slovenia (MW560732). In contrast, in the 16S rRNA region, they were identical to specimens from France (e.g. the sequence retrieved from the complete mitochondrial genome; OQ599967) and differed by a single nucleotide substitution from those collected in Slovenia (MW558108).
Discussion
Since the introduction of nutria to the Czech Republic, its population size has been steadily increasing. Despite its established status as an invasive species in the region, the parasite fauna associated with nutria remains critically understudied. In its native range, 64 parasite taxa have been recorded, which were assigned either to species level or at least to a higher taxonomic level (e.g. El-Kouba et al., 2009; Issia et al., 2009; Rossin et al., 2009; Martino et al., 2012; Benati et al., 2017; Fugassa, 2020). In contrast, European studies have documented only 11 of these parasites in nutria, with an additional 13 taxa identified exclusively in European nutria populations (Lewis and Ball, 1984; Ménard et al., 2001; Nardoni et al., 2011; Umhang et al., 2013; Zanzani et al., 2016; Nechybová et al., 2018; Ježková et al., 2021). Thus far, 24 species have been identified in Europe, indicating that the diversity of nutria parasites is markedly higher in their native range compared to the regions where they have been introduced.
Information on nutria parasites in the Czech Republic is scarce and only a few studies have provided any comprehensive insight, based on a combination of diagnostic methods. Regarding helminths, only 2 genera were previously recorded; S. myopotami was recorded among fur-farmed animals in the Czech Republic with 25% prevalence (out of 20 examined animals, Nechybová et al., 2018). In the same study, also a further unidentified Strongyloides species was detected by coprological methods in free roaming nutrias at various sites in the Czech Republic, although it is highly possible it will also be S. myopotami, in accordance with our study. The other taxon was T. myocastoris, which was recorded among farmed animals (Rylková et al., 2015; Nechybová et al., 2018) and feral animals, as well (Nechybová et al., 2018).
On the basis of the necropsy of 46 nutrias, the coproscopy of feces from 20 individuals, the amplification of 40 extracted fecal DNA samples using qPCR (18S rDNA) and sequencing of the 18S ribosomal subunit DNA and partial COI mtDNA, the highest recorded prevalence was of S. myopotami (93.5%). When coproscopy and molecular analyses were not considered, the prevalence of this parasite appeared lower. Specifically, the flotation method revealed the presence of this parasite in 5 nutrias, although no adult parasites were found during the necropsy of those individuals. This discrepancy suggests that the infection intensity in these cases may have been too low to be detected during necropsy. In contrast, qPCR analysis, the most sensitive method employed, detected Strongyloides in 100% of the analysed fecal samples. Previous studies have also reported high prevalence rates of S. myopotami. Choe et al. (2014) documented a 100.0% prevalence in a survey of 10 nutrias in Korea. Babero and Lee (1961) recorded a prevalence of 62.5% in 56 nutrias from Louisiana (USA). In the native range of nutria, a prevalence of 26.7% was observed (Martino et al., 2012). The highest prevalence in Europe to date was found in Italy, at 63.4% (Zanzani et al., 2016). Our current study also ranks among those in which S. myopotami was the most commonly represented parasite, and its prevalence among Czech nutria populations appears to be comparatively higher, as previously reported by Nechybová et al. (2018) (25–30%).
The second most common parasite was T. myocastoris (prevalence 37.0%). Its significance as a common parasite of nutrias is corroborated by Babero and Lee (1961), who recorded prevalences of 28 and 50% at 2 study sites in Louisiana (USA). Similarly, Martino et al. (2012) observed T. myocastoris among the most numerous parasite species in South America, with a prevalence of 13.8%. In the Czech Republic, Nechybová et al. (2018) recorded a prevalence of 40% for T. myocastoris in a study of wild nutrias and a prevalence of 5% for Trichuris sp. in fecal samples from farmed nutrias.
The genus Trichostrongylus could not be definitively identified at the species level. Identification is primarily based on the shape and size of male spicules and copulatory bursa, while females are consistently difficult to identify. According to Dikmans’ (1937) key, the Trichostrongylus specimens in our study most closely resembled T. ransomi in spicule shape and length. Another distinguishing characteristic was the distance of the anus from the tail tip in females. When compared to the work of Ghasemikhah et al. (2011), the spicule shape (resembling a high-heeled shoe) was similar to that in T. colubriformis species. Previous studies have reported the presence of Trichostrongylus duretteae, T. sigmodontis, T. colubriformis and T. retortaeformis in nutrias (Babero and Lee, 1961; Zanzani et al., 2016; Fugassa, 2020). Based on newly generated DNA sequences, our species was genetically most similar to T. axei. However, sequences for T. sigmodontis or T. duretteae are not available in GenBank, so genetic similarity to these species could not be assessed. Our mitochondrial DNA sequences, representing a more variable region, make comparisons with GenBank data less meaningful unless sequences from the same or closely related organisms are available.
The trematode species with a prevalence of 11% was classified within the family Psilostomidae based on the DNA sequence similarity of the large ribosomal subunit (28S). Mitochondrial DNA (COI) did not assist in identifying the parasite, as no closely related sequence was available in the GenBank database. The family Psilostomidae comprises 13 genera, which are gastrointestinal parasites of birds and mammals. Morphologically, the members of this family resemble those of the family Echinostomatidae, but Psilostomidae lack the characteristic spined collar (Kostadinova, 2005; Atopkin, 2011). Given the presence of the genus Psilotrema in Europe (Atopkin, 2011) and the closest genetic similarity observed, it is plausible to hypothesize that our specimens belong to this genus. Additionally, Psilostomum sp. has also been previously reported in nutrias, although only in the metacercarial stage; however, it was not identified in our study (Babero and Lee, 1961).
The presence of E. multilocularis in the native range of nutria remains undocumented. In Europe, the occurrence and increasing incidence of infections with the zoonotic tapeworm E. multilocularis are closely linked with the rising populations of foxes, raccoon dogs and nutrias (Janovsky et al., 2002; Romig, 2009; Križman et al., 2022). Similarly, the spread of this parasite correlates with growing urban fox populations and the movements of infected dogs (Goodfellow et al., 2006). Within the Morava basin, the presence of echinococcosis was detected in nutria at the Šumperk (site 1), Ústí nad Orlicí (site 2) and Brno-vicinity (5) locations, with the former 2 being only about 20 km apart. Although E. multilocularis was previously recorded among foxes in all 3 respective Czech districts [ranging from 10.0 to 40.0% prevalence, see Kolářová et al. (2017) and references therein], this finding substantiates the Eurasian and somewhat disjunct distribution of the parasite (McManus et al., 2003; Oksanen et al., 2016). Our samples showed a high genetic similarity with E. multilocularis from various European countries, particularly Slovenia and France. This genetic congruence classifies the Moravian nutria specimens within the widely distributed genotype observed across western, central and eastern Europe (Santoro et al., 2024).
Studies on E. multilocularis tend to focus on the occurrence of the parasite in definitive hosts, particularly foxes. The increase in fox populations in western European countries, attributed to rabies vaccination programmes (Eckert et al., 2000), probably prompted the migration of young foxes from areas with high population density to those with lower density, moving eastward (Sréter et al., 2003). In the 1990s, changes in land use occurred in the former communist countries. Additionally, a decline in fox hunting, driven by a fall in the value of fox fur and the implementation of rabies vaccination programmes in central and eastern European countries, contributed to a rise in the fox population (Szemethy et al., 2000). This increase in fox numbers likely led to a higher prevalence and spread of E. multilocularis (Sréter et al., 2003).
Currently, E. multilocularis is widely distributed in Europe (ESFA, 2021). The emergence of a new potential definitive host, the invasive raccoon dog (Sutor, 2008), has also facilitated this spread. This species is now well established in Europe and continues to expand its range westward and southward across the continent (Genovesi, 2009). However, the prevalence of E. multilocularis in raccoon dogs is lower compared to foxes, which are still considered the primary definitive host for this parasite.
A study conducted by Oksanen et al. (2016) demonstrated that nutrias generally play a minimal or no role in the life cycle of E. multilocularis within European Union countries. Studies investigating the presence of E. multilocularis in European nutrias found a prevalence of 0.4% from 12 locations in western France (Umhang et al., 2013) and 5.9% in 2 distinct areas southwest of North Rhine-Westphalia in Germany (Hartel et al., 2004). Nonetheless, in areas with moderate to high infection prevalence in red foxes, nutrias may contribute to the life cycle of this parasite (Oksanen et al., 2016). Studies conducted in France and Slovenia have identified nutrias as bioindicators of E. multilocularis presence in the environment (Umhang et al., 2013; Križman et al., 2022). Consequently, it is plausible that foxes near the Šumperk, Ústí nad Orlicí and Brno-vicinity locations could also be infected with E. multilocularis.
Acknowledgements
We are grateful to Lucie Seidlová and Viktória Vanerková for their help during dissections and parasites collection. We also thank Matthew Nicholls for English corrections and proof-reading.
Data availability statement
The data supporting the conclusions of this study are included in this article. The newly generated sequences were submitted to the GenBank database under accession numbers PQ567056–PQ567059; PQ568308–PQ568310; PQ568420; PQ569938; PQ570797; PQ571257–PQ571258; PQ786491.
Author contributions
M. B. and O. M. conceived and designed the study. O. M., J. D. and J. S. obtained nutrias examined within this study. M. B., E. N., A. K., L. Š., E. J. and O. M. collected and identified parasitological material. M. B. and A. K. performed morphological analyses; M. B., E. N., A. K. and E. J. performed molecular laboratory procedures; and M. B. and E. N. performed phylogenetic and statistical analyses. M. B. put together the results and wrote the draft together with E. N., L. Š. and O. M. All the other authors revised the draft and approved the final version.
Financial support
This research was funded by the Internal Grant Agency of Mendel University in Brno under grant No. AF-IGA2022-IP-030, titled ‘Quality of parameters of meat of nutria (Myocastor coypus) and its technological evaluation in meat products’. This project was also partially supported by Masaryk University internal grant No. MUNI/A/1602/2023.
Competing interests
None.
Ethical standards
All applicable institutional, and national guidelines for the care and use of invasive animals were followed.
References
- Anděra M (2011) Current distributional status of rodents in the Czech Republic (Rodentia). Lynx 42, 5–82. [Google Scholar]
- AOPK ČR (2023) Nálezová databáze ochrany přírody. Retrieved from https://portal.nature.cz/ (accessed 2 September 2023).
- Atkinson IAE (1996) Introductions of wildlife as a cause of species extinctions. Wildlife Biology 2, 135–141. [Google Scholar]
- Atopkin DM (2011) Genetic characterization of the Psilotrema (Digenea: Psilostomatidae) genus by partial 28S ribozomal DNA sequences. Parasitology International 60, 541–543. [DOI] [PubMed] [Google Scholar]
- Babero BB and Lee JW (1961) Studies on the helminths of nutria, Myocastor coypus (Molina), in Louisiana with check-list of other worm parasites from this host. The Journal of Parasitology 47, 378–390. [PubMed] [Google Scholar]
- Barratt JlN, Lane M, Talundzic E, Richins T, Robertson G, Formenti F, Pritt B, Verocai G, De Souza JN, Soares NM, Traub R, Buonfrate D and Bradbury RS (2019) A global genotyping survey of Strongyloides stercoralis and Strongyloides fuelleborni using deep amplicon sequencing. PLOS Neglected Tropical Diseases 13, e0009538. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Benati D, Moraes MFD, Hoppe EGL, Tebaldi JH, Júnior IAN and da Costa Freitaz FL (2017) Helminths of the Nutria Myocastor coypus (Rodentia: Myocastoridae) in the Forest of Araucarias, Brazil. Neotropical Helminthology 11, 377–386. [Google Scholar]
- Benovics M, Reslová N, Škorpíková L, Seidlová L and Mikulka O (2022) Helminth fauna of the Eurasian beaver in the Czech Republic with remarks on the genetic diversity of specialist Stichorchis subtriquetrus (Digenea: Cladorchiidae). Parasitology Research 121, 633–644. [DOI] [PubMed] [Google Scholar]
- Bounds DL, Sherfy MH and Mollett TA (2003) Nutria. In Feldhamer GA, Thompson BC and Chapman JA (eds), Wild Mammals of North America: Biology Management and Conservation. Baltimore, MD: The Johns Hopkins University Press, pp. 1119–1147. [Google Scholar]
- Bowles J and Mcmanus DP (1993) Rapid discrimination of Echinococcus species and strains using a polymerase chain reaction-based RFLP method. Molecular and Biochemical Parasitology 57, 231–240. [DOI] [PubMed] [Google Scholar]
- Bray RA, Gibson D and Jones A (2008) Keys to the Trematoda: Volume 3. Wallingford, UK: CABI Publishing; & London, UK: The Natural History Museum. [Google Scholar]
- Britton JR (2012) Introduced parasites in food webs: new species, shifting structures? Trends in Ecology and Evolution 28, 93–99. [DOI] [PubMed] [Google Scholar]
- Bush AO, Lafferty KD, Lotzs JM and Shostakll AW (1997) Parasitology meets ecology on its own terms: Margolis et al. Revisited. Journal of Parasitology 83, 575–583. [PubMed] [Google Scholar]
- Choe S, Lee D, Park H, Oh M, Jeon KH and Eom SK (2014) Strongyloides myopotami (Secernentea: Strongyloididae) from the intestine of feral nutrias (Myocastor coypus) in Korea. Korean Journal of Parasitology 52, 531–535. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Czech Statistical Office (2024) Basic data on hunting grounds, game stock and hunting. Retrieved from Czech Statistical Office website: https://csu.gov.cz (accessed 14 April 2024).
- Dikmans G (1937) A note on the members of the nematode genus Trichostrongylus occurring rodents and lagomorphs, with descriptions of two new species. Journal of the Washington Academy of Sciences 27, 203–209. [Google Scholar]
- Dunn AM (2009) Parasites and biological invasions. Advances in Parasitology 68, 161–184. [DOI] [PubMed] [Google Scholar]
- Eckert J, Conraths FJ and Rackmann K (2000) Echinococcosis: an emerging or reemerging zoonosis? International Journal for Parasitology: Parasites and Wildlife 30, 1283–1294. [DOI] [PubMed] [Google Scholar]
- El-Kouba MMAN, Marques SMT, Pilati C and Hamann W (2009) Presence of Fasciola hepatica in feral nutria (Myocastor coypus) living in a public park in Brasil. Journal of Zoo and Wildlife Medicine 40, 103–106. [DOI] [PubMed] [Google Scholar]
- ESFA (2021) Annual assessment of Echinococcus multilocularis surveillance reports submitted in 2019 in the context of commission delegated regulation (EU) 2018/772. ESFA Journal 19, 6945. [DOI] [PMC free article] [PubMed] [Google Scholar]
- European Commission (2022) Commission implementing regulation (EU) 2016/1141 of 13 July 2016 adopting a list of invasive alien species of Union concern pursuant to regulation (EU) No 1143/2014 of the European Parliament and of the Council. Official Journal of the European Union, L 189, 1–9. [Google Scholar]
- Evers D, Sasser CE, Gosselink JG, Fuller DA and Visser JM (1998) The impact of vertebrate herbivores on wetland vegetation in Atchafalaya Bay, Louisiana. Estuaries 21, 1–13. [Google Scholar]
- Floyd RM, Rogers AD, Lambshead PJD and Smith CR (2005) Nematode-specific PCR primers for the 18S small subunit rRNA gene. Molecular Ecology Notes 5, 611–612. [Google Scholar]
- Foreyt WJ (2002) Veterinary Parasitology Reference Manual, 5th Edn, Hoboken, USA: Wiley-Blackwell. [Google Scholar]
- Fugassa MH (2020) Updated checklist of helminths found in terrestrial mammals of Argentine Patagonia. Journal of Helminthology 94, 1–56. [DOI] [PubMed] [Google Scholar]
- Genovesi P (2009) Species accounts of 100 of the most invasive alien species in Europe, Ondatra zibethicus. In DAISE (ed.), Handbook of Alien Species in Europe. Dordrecht: Springer, pp. 365–366. [Google Scholar]
- Georgiev B, Biserkov V and Genov T (1986) In toto staining method for cestodes with iron acetocarmine. Helminthologia 23, 279–291. [Google Scholar]
- Gethöffer F and Siebert U (2020) Current knowledge of the Neozoa Nutria and Muskrat in Europe and their environmental impacts. Journal of Wildlife and Biodiversity 4, 1–12. [Google Scholar]
- Ghasemikhah R, Mirhendi H, Kia EB, Mowlavi G, Sarmadian H, Meshgi B, Golestan B and Mobedi I (2011) Morphological and morphometrical description of Trichostrongylus species isolated from domestic ruminants in Khuzestan Province, Southwest Iran. Iranian Journal of Parasitology 6, 82–88. [PMC free article] [PubMed] [Google Scholar]
- Gibson DI, Jones A and Bray RA (2002) Keys to the Trematoda: Volume 1. Wallingford, UK: CABI Publishing; & London, UK: The Natural History Museum. [Google Scholar]
- Goodfellow M, Shaw S and Morgan E (2006) Imported disease of dogs and cats exotic to Ireland: Echinococcus multilocularis. Irish Veterinary Journal 59, 214–216. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Grace JB and Ford MA (1996) The potential impact of herbivores on the susceptibility of the marsh plant Sagittaria lancifolia to saltwater intrusion in coastal wetlands. Estuaries 19, 13–20. [Google Scholar]
- Hartel KS, Spittler H, Doering H, Winkelmann J, Hoerauf A and Reiter-Owona I (2004) The function of wild nutria (Myocastor coypus) as intermediate hosts for Echinococcus multilocularis in comparison to wild muskrats (Ondatra zibethicus). International Journal of Medical Microbiology 293, 62–63. [Google Scholar]
- Howerth EW, Reeves AJ, McElveen MR and Austin FW (1994) Survey for selected diseases in nutria (Myocastor coypus) from Louisiana. Journal of Wildlife Diseases 30, 450–453. [DOI] [PubMed] [Google Scholar]
- Issia L, Pietrokovsky S, Sousa-Figueiredo J, Stothard JR and Wisnivesky-Colli C (2009) Fasciola hepatica infections in livestock flock, guanacos and coypus in two wildlife reserves in Argentina. Veterinary Parasitology 165, 341–344. [DOI] [PubMed] [Google Scholar]
- Janovsky M, Bacciarini L, Sager H, Grone A and Gottstein B (2002) Echinococcus multilocularis in a European Beaver from Switzerland. Journal of Wildlife Diseases 38, 618–620. [DOI] [PubMed] [Google Scholar]
- Ježková J, Limpouchová Z, Prediger J, Holubová N, Sak B, Konečný R, Květoňová D, Hlásková L, Rost M, McEvoy J, Rajský D, Feng Y and Kváč M (2021) Cryptosporidium myocastoris n. sp. (Apicomplexa: Cryptosporidiidae), the species adapted to the nutria (Myocastor coypus). Microorganisms 9, 813. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jirků-Pomajbíková K and Hůzová Z (2018) Coproscopic examination techniques. In Modrý D, Pafčo B, Petrželková JK and Hasegawa H (eds), Parasites of Apes. An Atlas of Coproscopic Diagnostics. Frankfurt: Edition Chimaira, pp. 22–28. [Google Scholar]
- Jones A, Bray RA and Gibson DI (2005) Keys to the Trematoda: Volume 2. Wallingford, UK: CABI Publishing; & London, UK: The Natural History Museum. [Google Scholar]
- Katoh K, Misawa K, Kuma K and Miyata T (2002) MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30, 3059–3066. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kellnerová K, Holubová N, Jandová A, Vejčík A, McEvoy J, Sak B and Kváč M (2017) First description of Cryptosporidium ubiquitum XIIa subtype family in farmed fur animals. European Journal of Protistology 59, 108–113. [DOI] [PubMed] [Google Scholar]
- Kolářová L, Pavlásek I and Chalupský J (1996) Echinococcus multilocularis Leuckart, 1863 in the Czech Republic. Helminthologia 33, 59–65. [PubMed] [Google Scholar]
- Kolářová L, Matějů J, Hozáková L, Stejskal F, Hrdý J, Kolářová H, Leissová M, Skála V and Dundr P (2017) Human alveolar echinococcosis and an overview of the occurrence of Echinococcus multilocularis in animals in the Czech Republic. Epidemiologie, Mikrobiologie, Imunologie 66, 163–172. [PubMed] [Google Scholar]
- Kostadinova A (2005) Family Psilostomidae Loos, 1900. In Jones A, Bray RA and Gibson DI (eds). Keys to the Trematoda: Volume 2. Wallingford, UK: CABI Publishing; & London, UK: The Natural History Museum, pp. 99–118. [Google Scholar]
- Križman M, Švara T, Šoba B and Rataj AV (2022) Alveolar echinococcosis in nutria (Myocastor coypus), invasive species in Slovenia. International Journal for Parasitology: Parasites and Wildlife 18, 221–224. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lanave C, Preparata G, Saccone C and Serio G (1984) A new method for calculating evolutionary substitution rates. Journal of Molecular Evolution 20, 86–93. [DOI] [PubMed] [Google Scholar]
- Lewis DC and Ball SJ (1984) Eimeria fluviatilis n. sp. and other species of Eimeria in wild coypus in England. Systematic Parasitology 6, 181–198. [Google Scholar]
- Little MD (1965) Dermatitis in a human volunteer infected with Strongyloides of nutria and raccoon. American Journal of Tropical Medicine and Hygiene 14, 1007–1009. [DOI] [PubMed] [Google Scholar]
- Lowe S, Browne M, Boudjelas S and De Poorter M (2000) 100 of the world's worst invasive alien species. A selection from the global invasive species database. The Invasive Species Specialist Group (ISSG) a specialist group of the Species Survival Commission (SSC) of the World Conservation Union (IUCN).
- Martino PE, Radman N, Parrado E, Bautista E, Cisterna C, Silvestrini MP and Corba S (2012) Note on the occurrence of parasites of the wild nutria (Myocastor coypus, Molina, 1782). Helminthologia 49, 164–168. [Google Scholar]
- Martino PE, Stanchi NO, Silvestrini M, Brihuega B, Samartino L and Parrado E (2014) Seroprevalence for selected pathogens of zoonotic importance in wild nutria (Myocastor coypus). European Journal of Wildlife Research 60, 551–554. [Google Scholar]
- Martínek K, Kolářová L and Červený J (2001) Echinococcus multilocularis in carnivores from the Klatovy district of the Czech Republic. Journal of Helminthology 75, 61–66. [DOI] [PubMed] [Google Scholar]
- McManus PD, Zhang W, Li J and Bartley PB (2003) Echinococcosis. The Lancet 362, 1295–1304. [DOI] [PubMed] [Google Scholar]
- Ménard A, Agoulon A, L'Hostis M, Rondelaud D, Collard S and Chauvin A (2001) Myocastor coypus as a reservoir host of Fasciola hepatica in France. Veterinary Research 32, 499–508. [DOI] [PubMed] [Google Scholar]
- Miura O, Kuris AM, Torchin ME, Hechinger RF, Dunham EJ and Chiba S (2005) Molecular-genetic analyses reveal cryptic species of trematodes in the intertidal gastropod, Batillaria cumingi (Crosse). International Journal for Parasitology 35, 793–801. [DOI] [PubMed] [Google Scholar]
- Moravec F (2013) Parasitic Nematodes of Freshwater Fishes of Europe. Prague, CZ: Academia. [Google Scholar]
- Nardoni S, Angelici MC, Mugnaini L and Mancianti F (2011) Prevalence of Toxoplasma gondii infection in Myocastor coypus in a protected Italian wetland. Parasites & Vectors 4, 240. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nechybová S, Langrová I and Tůmová E (2018) Parasites of Myocastor coypus – a comparison in farm animals and their feral counterparts. Scientia Agriculturae Bohemica 49, 21–25. [Google Scholar]
- Newton LA, Chilton NB, Beveridge I, Hoste H, Nansen P and Gasser RB (1998) Genetic markers for strongylid nematodes of livestock defined by PCR-based restriction analysis of spacer rDNA. Acta Tropica 69, 1–15. [DOI] [PubMed] [Google Scholar]
- Oksanen A, Siles-Lucas M, Karamon J, Possenti A, Conraths JF, Romig T, Wysocko P, Mannocci A, Mipatrini D, La Torre G, Boufana B and Casulli A (2016) The geographical distribution and prevalence of Echinococcus multilocularis in animals in the European Union and adjacent countries: a systematic review and meta-analysis. Parasites & Vectors 9, 519. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Olson PD, Cribb TH, Tkach VV, Bray RA and Littlewood DTJ (2003) Phylogeny and classification of the Digenea (Platyhelminthes: Trematoda). International Journal for Parasitology 33, 733–755. [DOI] [PubMed] [Google Scholar]
- Pavlásek I (1998) Actual situation and occurrence of Echinococcus multilocularis in foxes both in Europe and in Czech Republic. Remedia – Klinicka Mikrobiologie 2, 233–240 (in Czech). [Google Scholar]
- Prenter J, MacNeil C, Dick JTA and Dunn AM (2004) Roles of parasites in animal invasions. Trends in Ecology and Evolution 19, 385–390. [DOI] [PubMed] [Google Scholar]
- Rambaut A, Drummon AJ, Xie D, Baele G and Suchard MA (2018) Posterior summarization in Bayesian phylogenetic using Tracer 1.7. Systematic Biology 67, 901–904. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Romig T (2009) Echinococcus multilocularis in Europe – state of art. Veterinary Research Communications 22, 31–34. [DOI] [PubMed] [Google Scholar]
- Romig T and Wassermann M (2024) Echinococcus species in wildlife. International Journal for Parasitology: Parasites and Wildlife 23, 100913. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA and Huelsenbeck JP (2012) Mrbayes 3.2: efficient Bayesian phylogenetic inference and model choice across large model space. Systematic Biology 61, 539–542. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rossin AM, Varela G and Timi TJ (2009) Strongyloides myopotami in ctenomyid rodents: transition from semi-aquatic to subterranean life cycle. Acta Parasitologica 54, 257–262. [Google Scholar]
- Rózsa L, Reiczigel J and Majoros G (2000) Quantifying parasites in samples of hosts. Journal of Parasitology 86, 228–232. [DOI] [PubMed] [Google Scholar]
- Rylková K, Tůmová E, Brožová A, Jankovská I, Vadlejch J, Čadková Z, Frýdlová J, Peřinková P, Langrová I, Chodová D, Nechybová S and Scháňková Š (2015) Genetic and morphological characterization of Trichuris myocastoris found in Myocastor coypus in the Czech Republic. Parasitology Research 114, 3969–3975. [DOI] [PubMed] [Google Scholar]
- Santoro A, Santolamazza F, Cacciò SM, La Rosa G, Antolová D, Auer H, Bagrade G, Bandelj P, Basso W, Beck R, Citterio CV, Davidson RK, Deksne G, Frey CF, Fuglei E, Glawischnig W, Gottstein B, Harna J, Petersen HH and Karamon J (2024) Mitochondrial genetic diversity and phylogenetic relationships of Echinococcus multilocularis in Europe. International Journal for Parasitology 54, 233–245. [DOI] [PubMed] [Google Scholar]
- Scheuring W (1990) Examination of the intestinal parasite fauna of nutria (Myocastor coypus, Molina 1782) from enclosed breeding units with particular reference to coccidia. Zeszyty Naukowe Akademii Rolniczej we Wrocławiu 81, 41 pp. [Google Scholar]
- Shaffer GP, Day JW, Hunter RG, Lane RR, Lundberg CJ, Wood WB and Kandalepas D (2015) System response, nutria herbivory, and vegetation recovery of a wetland receiving secondarily treated effluent in coastal Louisiana. Ecological Engineering 79, 120–131. [Google Scholar]
- Sheather AL (1923) The detection of intestinal protozoa and mange parasites by a floatation technique. Journal of Comparative Pathology and Therapeutics 36, 266–275. [Google Scholar]
- Šoba B, Gašperšič Š, Keše D and Kotar T (2020) Molecular Characterization of Echinococcus granulosus sensu lato from Humans in Slovenia. Pathogens 12, 562. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sréter T, Széll Z, Egyed Z and Varga I (2003) Echinococcus multilocularis: an emerging pathogen in Hungary and Central Eastern Europe? Emerging Infectious Diseases journal – CDC 9, 384–386. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stamatakis A (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688–2690. [DOI] [PubMed] [Google Scholar]
- Stamatakis A (2014) RAxML version 8: a tool for phylogenetic analyses and post-analysis of large phylogenies. Bioinformatics 30, 1312–1313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sutor A (2008) Dispersal of the alien raccoon dog Nyctereutes procyonoides. European Journal of Wildlife Research 54, 321–326. [Google Scholar]
- Szemethy L, Heltai M and Biró Z (2000) Effects of oral immunisation against rabies on the dynamics of the fox population. Magyar Állatorvosok Lapja 122, 612–617. [Google Scholar]
- Umhang G, Richomme C, Boucher JM, Guedon G and Boué F (2013) Nutrias and muskrats as bioindicators for the presence of Echinococcus multilocularis in new endemic areas. Veterinary Parasitology 196, 283–287. [DOI] [PubMed] [Google Scholar]
- Verweij JJ, Canales M, Polman K, Ziem J, Brienen EAT, Polderman AM and van Lieshout L (2009) Molecular diagnosis of Strongyloides stercoralis in faecal samples using real-time PCR. Transactions of the Royal Society of Tropical Medicine and Hygiene 103, 342–346. [DOI] [PubMed] [Google Scholar]
- Woods CA, Contreras L, Willner-Chapman G and Whidden PH (1992) Myocastor coypus. Mammalian Species 398, 1–8. [Google Scholar]
- Zanzani SA, Di Cerbo A, Gazzonis AL, Epis S, Invernizzi A, Tagliabue S and Manfredi MT (2016) Parasitic and bacterial infections of Myocastor coypus in metropolitan area of northwestern Italy. Journal of Wildlife Diseases 52, 126–130. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data supporting the conclusions of this study are included in this article. The newly generated sequences were submitted to the GenBank database under accession numbers PQ567056–PQ567059; PQ568308–PQ568310; PQ568420; PQ569938; PQ570797; PQ571257–PQ571258; PQ786491.







