Downregulation of OIP5-AS1 inhibits apoptosis in myocardial ischemia/reperfusion injury via modulating the MiR-145-5p/ROCK1 axis

Jingyan Yang; Jing Liu; Xiaobo Liu; Dongling Xu; Juan Zhang

doi:10.1371/journal.pone.0324909

. 2025 May 20;20(5):e0324909. doi: 10.1371/journal.pone.0324909

Downregulation of OIP5-AS1 inhibits apoptosis in myocardial ischemia/reperfusion injury via modulating the MiR-145-5p/ROCK1 axis

Jingyan Yang ^1,^#, Jing Liu ^2,^#, Xiaobo Liu ³, Dongling Xu ², Juan Zhang ^2,^*

Editor: Alexis G Murillo Carrasco⁴

PMCID: PMC12091815 PMID: 40392837

Abstract

Purpose

The role of Long noncoding RNA OIP5-AS1 in myocardial ischemia/reperfusion (I/R) injury-induced apoptosis remains to be fully elucidated. The present study was conducted with the objective of investigating the function of OIP5-AS1 in myocardial I/R injury and exploring its potential mechanisms.

Methods

In order to simulate the conditions of I/R, H9c2 cells were cultured in hypoxic/reoxygenated environments. Induction of I/R in Sprague-Dawley rats was achieved by ligating the left anterior descending coronary artery for 30 minutes followed by 180 minutes of reperfusion. OIP5-AS1 expression levels were assessed, and the degree of apoptosis was evaluated by TUNEL staining. Bioinformatic analysis was conducted to predict the interaction between microRNA-145-5p (miR-145-5p) and OIP5-AS1, and the expression levels of miR-145-5p and ROCK1 were determined.

Results

Elevated levels of OIP5-AS1 were observed in H/R-treated H9c2 cells and in rat I/R models. Elevated OIP5-AS1 expression was associated with an increased incidence of apoptosis. The silencing of OIP5-AS1 in I/R conditions resulted in a significant suppression of cell apoptosis, reduced cleavage of caspase-3, decreased Bax levels, and increased Bcl-2 levels. Bioinformatic analysis predicted binding sites between miR-145-5p and OIP5-AS1. Furthermore, depletion of OIP5-AS1 in I/R conditions resulted in a substantial increase in miR-145-5p expression and a decrease in ROCK1 expression. The suppression of miR-145-5p reversed the effects of OIP5-AS1 depletion in I/R conditions.

Conclusions

Downregulation of OIP5-AS1 may prevent apoptosis in myocardial I/R injury by modulating the miR-145-5p/ROCK1 axis.

Introduction

Worldwide, acute myocardial infarction (AMI) is a prevalent condition and is associated with significant mortality [1]. Primary percutaneous coronary intervention (PPCI), which involves the rapid restoration of blood flow to the ischemic myocardium, is the most effective treatment for AMI. However, the restoration of blood flow can paradoxically result in additional myocardial damage, known as myocardial ischemia-reperfusion (I/R) injury [2]. Myocardial I/R injury can lead to a range of complications, including arrhythmias, myocardial stunning, microvascular dysfunction, no-reflow phenomenon, and lethal reperfusion injury [3]. The pathophysiology of myocardial I/R injury involves rapid changes in pH, oxidative stress, mitochondrial dysfunction, inflammatory responses, calcium overload, metabolic alterations, and cardiomyocyte apoptosis [4–9]. Despite these insights, the molecular mechanisms underlying myocardial I/R injury remain complex and are not yet fully understood. Consequently, the development of therapies that target the molecular mechanisms of I/R is imperative to prevent I/R injury. A comprehensive elucidation of molecular networks and the development of multi-target therapeutic strategies may represent a critical strategy for overcoming the persistent challenges associated with I/R injury treatment.

Long non-coding RNAs (lncRNAs), which are longer than 200 nucleotides and lack protein-coding capabilities, have emerged as novel regulators and coordinators of gene expression in the past decade. This domain had previously been considered to be transcriptional noise [10–12]. It is becoming increasingly evident that lncRNAs may participate in an array of additional biological and pathological processes, including cardiovascular diseases [13]. The Opa-interacting protein-5 antisense transcript (OIP5-AS1) is evolutionarily conserved and is predominantly expressed in the cytoplasm. It has been proposed to regulate various physiological processes, such as mitosis, proliferation, and apoptosis [14].

Recent research indicates that a significant number of lncRNAs have been identified as important factors in several cardiac diseases, including myocardial I/R injury, primarily through the sequestration of microRNAs (miRNAs) [15,16]. Preliminary evidence suggests that OIP5-AS1 may be a candidate in the regulation of cardiomyocyte apoptosis in myocardial I/R injury [17,18]. As demonstrated in our previous study, overexpression of miR-145-5p, which targets Rho-associated coiled-coil-containing kinase 1 (ROCK1), has been shown to attenuate myocardial I/R-induced apoptosis [19]. Based on bioinformatics software (Starbase), OIP5-AS1 contains a putative binding site for miR-145-5p, suggesting that OIP5-AS1 may be involved in myocardial I/R injury via miR-145-5p. The objective of the present study was to investigate the role of OIP5-AS1 in myocardial I/R-induced apoptosis. The findings revealed that OIP5-AS1 sponged miR-145-5p to upregulate ROCK1 expression and accelerate apoptosis in myocardial I/R injury.

Materials and methods

Myocardial I/R injury cell model

The H9c2 myocardial cell line, obtained from the American Type Culture Collection (cat. no. CRL-1446), was cultured in Dulbecco’s Modified Eagle Medium (DMEM; Hyclone; Cytiva) within a humidified incubator maintained at 37°C with an atmospheric composition of 95% oxygen (O₂) and 5% carbon dioxide (CO₂). In order to simulate myocardial I/R injury in vitro, hypoxia was induced by incubating the H9c2 cells in DMEM devoid of glucose and supplemented with 95% nitrogen (N₂) and 5% CO₂. Following a 6-hour hypoxic treatment, the cells were subjected to reoxygenation under normoxic conditions (with glucose; 5% CO₂) for an a further 6 hours. The control groups comprised of H9c2 cells that were cultured under standard conditions.

Cell transfection

In order to achieve gene silencing of OIP5-AS1, small interfering RNAs (siRNAs) were deployed. SiRNAs targeting OIP5-AS1 (si-OIP5-AS1) and negative control siRNAs (si-NC) were designed and synthesized by RiboBio Company (China). MiR-145-5p mimics (miR10000851) and inhibitors (miR20000851) were also synthesized by RiboBio Company (China), with scrambled RNAs serving as negative controls for miR-145-5p mimics (mimic-NC, miR1N0000001-1-5) and miR-145-5p inhibitors (inhibitor-NC, miR2N0000001-1-5). The H9c2 cardiomyocytes were seeded in 6-well plates (5x10⁵ cells/well) and transfected with si-OIP5-AS1(50 nM), miR-145-5p mimic (25 nM), miR-145-5p inhibitor (50 nM) or the respective controls at 37°C for 24 h. Following this, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed to select the most efficient mimic and inhibitor sequences. Optimization studies were performed using a cytotoxic-inducing siRNA (a non-targeting siRNA with a known cytotoxic effect) to establish the optimal transfection conditions while minimizing cell toxicity. The final transfection conditions were selected based on achieving a knockdown efficiency exceeding 80% while maintaining cell viability above 90%. Lipofectamine 2000 (Invitrogen, USA) was the reagent of choice for cell transfection. The ROCK1 sequence was sub-cloned into a pcDNA3.1 vector (ThermoFisher, USA) to generate a ROCK1-expression vector (1 µg/µl) and transfected into the H9c2 cardiomyocytes using Lipofectamine® 2000 at 37°C for 48 h. Cells transfection with the empty pcDNA3.1 vector were used as the negative control. Sequences of transfection oligonucleotides are presented in Table 1.

Table 1. Transfection sequences.

Oligo name	Sequence (5′ → 3′)	Final transfection concentration
si-OIP5-AS1	GGTTAGTCAGATTGGACAA	50 nM
si-NC	TACCGACTGGCAATTCATG	50 nM
miR-145-5p mimic	GUCCAGUUUUCCCAGGAAUCCCU	25 nM
miR-145-5p inhibitor	AGGGAUUCCUGGGAAAACUGGAC	50 nM
miR mimic‑NC	UUCUCCGAACGUGUCACGUTT	25 nM
miR inhibitor‑NC	CAGUACUUUUGUGUAGUACAA	50 nM

Open in a new tab

Extraction of total RNA and RT-qPCR

Total RNA was extracted from cultured cells using TRIzol reagent (TianGen, China). RNA concentration and purity were quantified using a NanoDrop 2000 spectrophotometer (ThermoFisher, USA). The reverse transcription process was performed with a FastKing cDNA Synthesis Kit (TianGen, China). Subsequent qPCR was carried out utilizing the Fast Start Universal SYBR Green I Kit (Roche, Switzerland). The fold changes were calculated employing the 2-ΔΔCq method, with Actin and U6 serving as internal reference controls. Bio-repeats were conducted in six replicates. The thermocycling conditions were as follows: initial denaturation at 95°C for 15 minutes followed by 40 cycles at 95°C for 5 seconds and 60°C for 30 seconds. The primer sequences used for RT-qPCR are detailed in Table 2.

Table 2. Primers used in reverse transcription-polymerase chain reaction.

Primer name	Forward primer	Reverse primer
OIP5-AS1	AGGTGCAAGCATACCGTCTC	TCAACACAGCCCTCTGCATT
miR-145-5p	GGGGTCCAGTTTTCCCAG	AACTGGTGTCGTGGAGTCGGC
ROCK1	GGAAACGCTCCGAGACACTG	CTGTTCTCACTGGGATTTGCTG
Actin	TGCTATGTTGCCCTAGACTTCG	GTTGGCATAGAGGTCTTTACGG
U6	CTCGCTTCGGCAGCACAT	AAATATGGAACGCTTCACG

Open in a new tab

Luciferase reporter assay

TargetScan and Starbase were instrumental in predicting potential targets of OIP5-AS1 and miRNA-145-5p. In order to confirm the direct binding interactions between OIP5-AS1/miRNA-145-5p and miRNA-145-5p/ROCK1, a dual-luciferase reporter gene analysis was conducted. Wild-type (WT) and mutant (MUT) OIP5-AS1-WT/MUT or ROCK1-WT/MUT luciferase plasmids were introduced into the pmirGLO dual luciferase miRNA-targeting vector (Promega, USA). These plasmids were cotransfected with miR-145-5p mimic or mimic NC. Luciferase activity was measured using the Dual-Luciferase System (Promega, USA).

TUNEL staining

The One-step TUNEL FITC Apoptosis Detection Kit (APExBio, USA) was utilised in accordance with the manufacturer’s protocol to detect cellular apoptosis. Fluorescence was observed under a microscope (Olympus, Japan) after counterstaining with 4,6-diamino-2-phenylindole (DAPI).

Western blot

Protein samples were resolved by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE). Subsequently, the samples were transferred to polyvinylidene fluoride (PVDF) membranes and blocked. The PVDF membranes were then subjected to an incubation with primary antibodies, including mouse anti-β-Actin (66009–1, Proteintech, 1:20000), rabbit anti-cleaved-Caspase3 (25128–1, Proteintech, 1:1000), rabbit anti-Bcl-2 (12789–1, Proteintech, 1:1000), rabbit anti-Bax (50599–2, Proteintech, 1:1000), and rabbit anti-ROCK1 (21850–1, Proteintech, 1:5000) at 4°C overnight. Membranes were then incubated with horseradish peroxidase-conjugated secondary antibodies (goat anti-rabbit, ZB-2301, ZSGB-BIO, 1:2000; goat anti-mouse, ZB-2305, ZSGB-BIO, 1:2000) at 25°C for 1 hour. The relative expression levels were determined using a Gel-Pro analyser (Media Cybernetics).

Myocardial I/R injury rat model

Male Sprague-Dawley rats (250-300g) were procured from Shandong University. Rats were anaesthetized with pentobarbital (50 mg/kg, intraperitoneal) and mechanically ventilated. A thoracotomy and pericardiotomy were performed, and the left anterior descending coronary artery (LAD) was occluded for 30 minutes to induce ischemia, followed by a 180-minute reperfusion period. Sham control animals underwent the same surgical procedure without LAD ligation. Following the conclusion of the experiments, the animals were euthanized with an overdose of isoflurane administered for approximately 10 minutes, followed by euthanasia through exsanguination. Efforts were made to minimize animal suffering and to use the minimum number of animals required to achieve statistical significance. All experiments involving animals were conducted in accordance with the Ethics Committee of Second Hospital of Shandong University for the care and use of laboratory animals, and all procedures were conducted in accordance with the Institutional Animal Care and Use Committee and National Institutes of Health guidelines. The present study was approved by the Institutional Animal Care and Use Committee of the Second Hospital of Shandong University (approval no. KYLL-2021(KJ)A-0503).

Animal gene therapy

Adeno-associated virus 9 (AAV9) vectors containing short hairpin RNA (shRNA) targeting OIP5-AS1 (HBAAV9-CTNT-shOIP5-AS1) and the corresponding negative control (HBAAV9-CTNT-sh-NC) were constructed by Hanbio. Rats were subjected to gene transfer via the intravenous tail vein injection of 5 × 10^10 AAV9 particles. The knockdown efficiency of myocardial OIP5-AS1 was verified by RT-qPCR.

Histological analysis

Tissues from the left ventricle (LV) were embedded in paraffin and sectioned at a thickness of 5 µm. TUNEL staining was used to assess the presence of apoptosis in cardiac tissue, with TUNEL-positive cells quantified as a percentage of total myocytes in ten randomly selected high-power fields per section.

Statistical analysis

All descriptive variables are expressed as mean ± SD. Normality was assessed using the Shapiro-Wilk test. Comparisons between two groups were conducted using the unpaired Student’s t-test for normally distributed variables and the Mann-Whitney U test for non-normally distributed variables. One-way ANOVA followed by Tukey’s post hoc test was used to analyze differences among multiple groups. Statistical analyses were performed using SPSS 20.0 (IBM Corp). A statistically significant difference was defined as P < 0.05.

Results

I/R induced apoptosis and OIP5-AS1 over-expression in cardiomyocytes

It is widely recognized that increased apoptosis in cardiomyocytes follows ischemia/reperfusion (I/R) injury. As illustrated in Fig 1A, the growth state of cardiomyocytes was observed under both normal conditions and I/R conditions. In the present experiment, the proportion of apoptotic cells was determined using TUNEL staining (Fig 1B), with untreated H9c2 cardiomyocytes serving as the control group. A significant increase in apoptosis was observed in the I/R group in comparison to the control group (Fig 1C). The expression level of OIP5-AS1 was examined by RT-qPCR, revealing that OIP5-AS1 was overexpressed in the I/R group compared to the control group (Fig 1D). Furthermore, the expression levels of miR-145-5p and ROCK1 were also assessed by RT-qPCR. MiR-145-5p expression was found to be significantly downregulated (Fig 1E), whereas ROCK1 expression was significantly upregulated in I/R compared with the control group (Fig 1F).

Downregulation of OIP5-AS1 decreased I/R-induced cardiomyocytes apoptosis

In order to investigate the potential role of OIP5-AS1 in myocardial I/R, OIP5-AS1 was silenced in H9c2 cardiomyocytes using siRNAs (Fig 2A). The silencing OIP5-AS1 was found to result in the suppression of apoptosis, as identified by the monitoring of TUNEL staining (Fig 2B, C). Furthermore, the assessment of cell apoptosis was conducted by measuring the activity of Caspase-3, Bcl-2, and Bax. Caspase-3 promotes apoptosis, whereas Bcl-2 suppresses apoptosis [20]. Western blot assays showed that I/R upregulated the expression of cleaved-Caspase3 and Bax and downregulated Bcl-2 expression (Fig 2D). Following the silencing OIP5-AS1 in I/R, Caspase-3 cleavage and Bax were reduced, and Bcl-2 was upregulated. Collectively, the data showed that OIP5-AS1 was upregulated in I/R and silencing OIP5-AS1 resulted in a reduction in apoptosis.

OIP5-AS1 bonded to miR-145-5p

LncRNA target gene predictions were conducted using StarBase (http://starbase.sysu.edu.cn/index.). The analysis predicted that OIP5-AS1 binds with miR-145-5p (Fig 3A). Luciferase reporter vectors containing either the wild-type OIP5-AS1 (OIP5-AS1-WT) or its mutant version with disrupted miR-145-5p binding sites (OIP5-AS1-MUT) were constructed to experimentally validate their interaction (Fig 3B). The luciferase activity of OIP5-AS1-WT was significantly reduced upon overexpression of miR-145-5p. Conversely, there were no changes in the luciferase activity of OIP5-AS1-MUT in response to the elevation of miR-145-5p (Fig 3C). These findings demonstrated the specific binding of OIP5-AS1 with miR-145-5p.

Fig 3 — (A) StarBase prediction of binding sites between OIP5-AS1 and miR-145-5p. (B) WT and MUT binding sites between OIP5-AS1 and miR-145-5p. (C) Luciferase reporter assay verifying the interaction between OIP5-AS1 and miR-145-5p. **P < 0.01.

MiR-145-5p directly targeted ROCK1

Bioinformatic analysis using TargetScan (http://www.targetscan.org) predicted ROCK1 as a high-confidence target of miR-145-5p (Fig 4A). In order to functionally validate ROCK1 as a direct target of miR-145-5p, dual-luciferase reporter assays were performed using the wild-type ROCK1 (ROCK1-WT) and the mutant constructs (ROCK1-MUT) (Fig 4B). MiR-145-5p mimic significantly reduced luciferase activity in ROCK1-WT-transfected cells but showed no effect on ROCK1-MUT activity (Fig 4C). These findings indicated that miR-145-5p specifically targeted ROCK1.

OIP5-AS1 regulated cell apoptosis in myocardial I/R cell models via miR-145-5p

Compared with the control group, expression of miR-145-5p in H9c2 cardiomyocytes was significantly downregulated in I/R. Silencing of OIP5-AS1 in I/R significantly upregulated miR-145-5p expression (Fig 5A, B). As demonstrated collectively in Figs 3C and 5B, I/R-mediated miR-145-5p downregulation and its capacity to bind OIP5-AS1 were revealed. Furthermore, the present study investigated whether OIP5-AS1 regulated apoptosis induced by I/R via miR-145-5p. TUNEL staining revealed that repression of OIP5-AS1 significantly reduced cell apoptosis, and treatment with an inhibitor of miR-145-5p completely abolished the rescue of apoptotic cells (Fig 6A, B). Caspase-3 cleavage and Bax protein levels were decreased, and Bcl-2 expression was increased in I/R under OIP5-AS1 suppression. This effect was reversed by co-treatment of si-OIP5-AS1 and miR-145-5p inhibitor (Fig 6C). Collectively, the inhibition of apoptosis in I/R resulting from OIP5-AS1 reduction was reversed by silencing miR-145-5p. The results suggested that OIP5-AS1 modulated I/R-mediated apoptosis via miR-145-5p.

Fig 5 — (A) RT-qPCR analysis of OIP5-AS1 expression in H9c2 cells. (B) RT-qPCR analysis of miR-145-5p expression in H9c2 cells. (C) RT-qPCR analysis of ROCK1 expression in H9c2 cells. **P < 0.01.

Fig 6 — (A) Representative TUNEL staining showing apoptosis of H9c2 I/R cells. (B) Statistical representation of apoptosis rates. (C) Western blot analysis showing protein expressions of ROCK1, cleaved-Caspase3, Bcl-2, and Bax. **P < 0.01.

ROCK1 overexpression reversed anti-apoptotic effects of OIP5-AS1 downregulation

In I/R injury, ROCK1 expression was significantly upregulated (Fig 1F). Conversely, suppression of OIP5-AS1 induced a marked reduction in ROCK1 protein and mRNA expression levels (Figs 2D and 5C). To further elucidate the molecular mechanism by which OIP5-AS1 modulates cardiomyocyte apoptosis in myocardial I/R injury, we performed gain-of-function experiments using ROCK1 overexpression in OIP5-AS1-deficient cells. Quantitative analysis revealed that ROCK1 overexpression significantly attenuated the anti-apoptotic effect of OIP5-AS1 downregulation (Fig 7A, B). The results suggested that ROCK1 played a significant role in mediating OIP5-AS1’s effects on cardiomyocyte apoptosis in I/R.

Fig 7 — (A) Representative TUNEL staining showing apoptosis. (B) Statistical representation of apoptosis rates. **P < 0.01.

OIP5-AS1 regulated apoptosis in myocardial I/R cell models by targeting miR-145-5p/ROCK1 axis

It has been demonstrated that miR-145-5p overexpression attenuated H9c2 cardiomyocyte apoptosis induced by I/R through the targeting of ROCK1 [19]. In the present study, we initially corroborated the efficacy of OIP5-AS1 knockdown in our experimental models (Figs 5A and 8A). Importantly, OIP5-AS1 deficiency led to a substantial decrease in ROCK1 expression, accompanied by an increase in miR-145-5p levels under I/R conditions (Figs 5B, C and 8B, C). Furthermore, the reduced expression of ROCK1, consequent to the suppression of OIP5-AS1, was ound to be reversible following the inhibition of miR-145-5p (Fig 8C). Competing endogenous RNAs (ceRNAs) are a class of regulatory transcripts that modulate gene expression through microRNA competition, whereby they sequester shared microRNAs and prevent their binding to target mRNAs [21]. Collectively, these data indicated that OIP5-AS1 may function as a ceRNA against miR-145-5p, thereby promoting ROCK1 upregulation. OIP5-AS1 was found to modulate cell apoptosis in I/R cell models by acting on the miR-145-5p/ROCK1 axis.

Fig 8 — (A) RT-qPCR analysis of OIP5-AS1 expression in H9c2 cells. (B) RT-qPCR analysis of miR-145-5p expression in H9c2 cells. (C) RT-qPCR analysis of ROCK1 expression in H9c2 cells. **P < 0.01.

Downregulation of OIP5-AS1 alleviated cardiomyocyte apoptosis in myocardial I/R rats

In order to investigate the role of OIP5-AS1 in I/R-induced cardiomyocyte apoptosis in vivo, myocardial I/R rat models were subjected to histopathological and molecular analyses. TUNEL staining revealed a pronounced increase in apoptotic nuclei (brown-stained) compared to healthy nuclei (blue-stained) in I/R-injured myocardium, with quantification demonstrating a significant elevation in the apoptotic index (Fig 9A, B). Notably, OIP5-AS1 knockdown significantly attenuated I/R-induced apoptosis confirming its pro-apoptotic function in this context. Molecular profiling of I/R myocardium revealed dysregulation of a putative OIP5-AS1-miR-145-5p-ROCK1 axis: OIP5-AS1 was significantly overexpressed, miR-145-5p expression was markedly downregulated, and ROCK1 expression was substantially upregulated (Fig 9C–E). OIP5-AS1 silencing in I/R rats resulted in a significant increase in miR-145-5p expression and a significant decrease in ROCK1 expression. These findings indicated that OIP5-AS1 may regulate apoptosis in I/R rat models via the miR-145-5p/ROCK1 axis.

Fig 9 — (A) Representative TUNEL staining showing apoptosis. (B) Statistical representation of apoptosis rates. (C) RT-qPCR analysis of OIP5-AS1 expression in I/R rat models. (D) RT-qPCR analysis of miR-145-5p expression in I/R rat models. (E) RT-qPCR analysis of ROCK1 expression. **P < 0.01.

Discussion

Recent studies have highlighted the significant role of lncRNAs and miRNAs in myocardial I/R injury [22]. A number of studies have confirmed that various lncRNAs play a critical role in I/R-induced cardiomyocyte apoptosis [23–25]. However, the function of OIP5-AS1 in myocardial I/R injury remain to be elucidated. The present study therefore sought to investigate the impact of OIP5-AS1 on apoptosis during myocardial I/R injury. Niu et al. hypothesised that OIP5-AS1 could potentially mitigate myocardial I/R injury through the sponge effect on miR-29a [18]. In contrast to their findings, our research has confirmed that OIP5-AS1 is upregulated following myocardial I/R injury and exacerbates I/R injury. Furthermore, OIP5-AS1 was found to be upregulated in both H9c2 cells and rat models of myocardial I/R injury. The present study demonstrates that the knockdown of OIP5-AS1 significantly attenuates apoptosis during I/R injury in both in vivo and in vitro models. The results obtained in this study lend support to the hypothesis that OIP5-AS1 may play a critical role in the apoptosis of cells induced by I/R injury in the myocardium.

Numerous studies have investigated the regulation of cardiomyocyte apoptosis in I/R injury by lncRNAs through the sequestration of specific miRNAs [26–29]. Consequently, the present study hypothesized whether OIP5-AS1 could modulate miRNAs in myocardial I/R injury. By bioinformatics analysis and experimental validation, we have identified a binding site for miR-145-5p within the OIP5-AS1 sequence. Our findings indicate that OIP5-AS1 negatively regulates the cardioprotective effects of miR-145-5p through direct interaction, as demonstrated by our mechanistic studies. In our previous study, we reported that miR-145-5p was downregulated following myocardial I/R injury, and that overexpression of miR-145-5p protected H9c2 cells from apoptosis induced by I/R [19]. The expression of miR-145-5p was upregulated when OIP5-AS1 was silenced in cardiomyocytes using siRNA. Silencing of OIP5-AS1 could suppress cell apoptosis and modulate the expressions of apoptosis-associated factors, including caspase-3, Bax, and Bcl-2. Downregulating OIP5-AS1 may protect cardiomyocytes from apoptosis during I/R injury by upregulating miR-145-5p. It is noteworthy that the inhibitor of miR-145-5p significantly reduced the inhibition of cell apoptosis induced by the downregulation of OIP5-AS1 after I/R injury. This finding provides further evidence to support the competitive binding relationship between OIP5-AS1 and miR-145-5p, in which OIP5-AS1 acts as a molecular sponge for miR-145-5p.

ROCK, an essential effector of the RhoA GTPase, is comprised of two closely related isoforms: ROCK1 and ROCK2 [30]. ROCK has been implicated in the aberrant pathological mechanisms of cardiac diseases, including myocardial ischemia/reperfusion I/R injury [31,32]. ROCK1 and ROCK2 have been shown to exert distinct roles in various tissues and cell types [31,33]. In view of the finding that ROCK1 is targeted by miR-145-5p [19,34], it was concluded that OIP5-AS1 functions as a ceRNA for miR-145-5p to regulate ROCK1. The present study revealed that the knockdown of OIP5-AS1 reduced ROCK1 expression and apoptosis induced by I/R. However, this reduction was counteracted by decreased levels of miR-145-5p. The findings of this study indicate that miR-145-5p exhibits a protective effect against myocardial I/R injury, while OIP5-AS1 has a deleterious effect on I/R injury. Downregulation of OIP5-AS1 may impede apoptosis in myocardial I/R injury by modulating the miR-145-5p/ROCK1 axis.

Despite the findings of this study, which elucidate the role of the OIP5-AS1/miR-145-5p/ROCK1 axis, several limitations remain. Initially, the experimental phase was conducted in H9c2 cells, with preliminary validation occurring in a rat model. Nevertheless, further validation in more clinically relevant models is necessary. Secondly, the knockdown of OIP5-AS1 relied on siRNA or shRNA transfection, which may have off-target effects. Consequently, further validation employing multi-target approaches, such as CRISPR-Cas9 gene knockout, is imperative to substantiate specificity [35]. Furthermore, the interaction network of OIP5-AS1 with other miRNAs or proteins has not been comprehensively analyzed, potentially overlooking key regulatory pathways. In future studies, the objective is to validate the role of OIP5-AS1 in animal models and analyze its expression and prognostic relevance in clinical samples, such as plasma or myocardial biopsies from acute myocardial infarction patients, with a view to enhancing clinical translational potential.

Conclusions

In summary, we have unveiled a novel mechanism by which OIP5-AS1, acting as a molecular sponge for miR-145-5p, modulates I/R-induced apoptosis via ROCK1, thereby providing a potential therapeutic target for cardioprotection. Future research endeavors should focus on further substantiating its translational potential and addressing the associated technological challenges.

Supporting information

S1 File. Experimental data.

(XLSX)

pone.0324909.s001.xlsx^{(108.1KB, xlsx)}

S2 File. Melting curves.

(TIF)

pone.0324909.s002.tif^{(15.9MB, tif)}

S3 File. Original blot and gel image data.

(TIF)

pone.0324909.s003.tif^{(6.7MB, tif)}

Data Availability

All data underlying the findings described in this manuscript are fully available without restriction in the Supporting information files accompanying this article.

Funding Statement

Natural Science Foundation of Shandong Province (grant no. ZR2022MH285). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Kaski J-C, Crea F, Gersh BJ, Camici PG. Reappraisal of ischemic heart disease. Circulation. 2018;138(14):1463–80. doi: 10.1161/CIRCULATIONAHA.118.031373 [DOI] [PubMed] [Google Scholar]
2.Yellon DM, Hausenloy DJ. Myocardial reperfusion injury. N Engl J Med. 2007;357(11):1121–35. doi: 10.1056/NEJMra071667 [DOI] [PubMed] [Google Scholar]
3.Hausenloy DJ, Yellon DM. Myocardial ischemia-reperfusion injury: a neglected therapeutic target. J Clin Invest. 2013;123(1):92–100. doi: 10.1172/JCI62874 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Liu Y, Li L, Wang Z, Zhang J, Zhou Z. Myocardial ischemia-reperfusion injury; molecular mechanisms and prevention. Microvasc Res. 2023;149:104565. doi: 10.1016/j.mvr.2023.104565 [DOI] [PubMed] [Google Scholar]
5.Heusch G, Gersh BJ. The pathophysiology of acute myocardial infarction and strategies of protection beyond reperfusion: a continual challenge. Eur Heart J. 2017;38(11):774–84. doi: 10.1093/eurheartj/ehw224 [DOI] [PubMed] [Google Scholar]
6.Wang J, Zhou H. Mitochondrial quality control mechanisms as molecular targets in cardiac ischemia-reperfusion injury. Acta Pharm Sin B. 2020;10(10):1866–79. doi: 10.1016/j.apsb.2020.03.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Hausenloy DJ, Chilian W, Crea F, Davidson SM, Ferdinandy P, Garcia-Dorado D, et al. The coronary circulation in acute myocardial ischaemia/reperfusion injury: a target for cardioprotection. Cardiovasc Res. 2019;115(7):1143–55. doi: 10.1093/cvr/cvy286 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Silvis MJM, Kaffka Genaamd Dengler SE, Odille CA, Mishra M, van der Kaaij NP, Doevendans PA, et al. Damage-associated molecular patterns in myocardial infarction and heart transplantation: the road to translational success. Front Immunol. 2020;11:599511. doi: 10.3389/fimmu.2020.599511 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Schirone L, Forte M, D’Ambrosio L, Valenti V, Vecchio D, Schiavon S, et al. An overview of the molecular mechanisms associated with myocardial ischemic injury: state of the art and translational perspectives. Cells. 2022;11(7):1165. doi: 10.3390/cells11071165 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Yao R-W, Wang Y, Chen L-L. Cellular functions of long noncoding RNAs. Nat Cell Biol. 2019;21(5):542–51. doi: 10.1038/s41556-019-0311-8 [DOI] [PubMed] [Google Scholar]
11.Kopp F, Mendell JT. Functional classification and experimental dissection of long noncoding RNAs. Cell. 2018;172(3):393–407. doi: 10.1016/j.cell.2018.01.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Mowel WK, Kotzin JJ, McCright SJ, Neal VD, Henao-Mejia J. Control of immune cell homeostasis and function by lncRNAs. Trends Immunol. 2018;39(1):55–69. doi: 10.1016/j.it.2017.08.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Sallam T, Sandhu J, Tontonoz P. Long noncoding RNA discovery in cardiovascular disease: decoding form to function. Circ Res. 2018;122(1):155–66. doi: 10.1161/CIRCRESAHA.117.311802 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Quinn JJ, Chang HY. Unique features of long non-coding RNA biogenesis and function. Nat Rev Genet. 2016;17(1):47–62. doi: 10.1038/nrg.2015.10 [DOI] [PubMed] [Google Scholar]
15.Huang S, Xue L, Mou Q. Emodin regulates lncRNA XIST/miR-217 axis to protect myocardial ischemia-reperfusion injury. Oxid Med Cell Longev. 2023;2023:3612814. doi: 10.1155/2023/3612814 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Zhao Z, Sun W, Guo Z, Liu B, Yu H, Zhang J. Long noncoding RNAs in myocardial ischemia-reperfusion injury. Oxid Med Cell Longev. 2021;2021:8889123. doi: 10.1155/2021/8889123 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Hu F, Yang J, Chen X, Shen Y, Chen K, Fu X, et al. LncRNA 1700020I14Rik/miR-297a/CGRP axis suppresses myocardial cell apoptosis in myocardial ischemia-reperfusion injury. Mol Immunol. 2020;122:54–61. doi: 10.1016/j.molimm.2020.03.015 [DOI] [PubMed] [Google Scholar]
18.Niu X, Pu S, Ling C, Xu J, Wang J, Sun S, et al. lncRNA Oip5-as1 attenuates myocardial ischaemia/reperfusion injury by sponging miR-29a to activate the SIRT1/AMPK/PGC1α pathway. Cell Prolif. 2020;53(6):e12818. doi: 10.1111/cpr.12818 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Cheng C, Xu D-L, Liu X-B, Bi S-J, Zhang J. MicroRNA-145-5p inhibits hypoxia/reoxygenation-induced apoptosis in H9c2 cardiomyocytes by targeting ROCK1. Exp Ther Med. 2021;22(2):796. doi: 10.3892/etm.2021.10228 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Degterev A, Yuan J. Expansion and evolution of cell death programmes. Nat Rev Mol Cell Biol. 2008;9(5):378–90. doi: 10.1038/nrm2393 [DOI] [PubMed] [Google Scholar]
21.Salmena L, Poliseno L, Tay Y, Kats L, Pandolfi PP. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 2011;146(3):353–8. doi: 10.1016/j.cell.2011.07.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Maslov LN, Popov SV, Naryzhnaya NV, Mukhomedzyanov AV, Kurbatov BK, Derkachev IA, et al. The regulation of necroptosis and perspectives for the development of new drugs preventing ischemic/reperfusion of cardiac injury. Apoptosis. 2022;27(9–10):697–719. doi: 10.1007/s10495-022-01760-x [DOI] [PubMed] [Google Scholar]
23.Xu Z, Mo Y, Li X, Hong W, Shao S, Liu Y, et al. The novel LncRNA AK035396 drives cardiomyocyte apoptosis through Mterf1 in myocardial ischemia/reperfusion injury. Front Cell Dev Biol. 2021;9:773381. doi: 10.3389/fcell.2021.773381 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Xiao H, Zhang M, Wu H, Wu J, Hu X, Pei X, et al. CIRKIL exacerbates cardiac ischemia/reperfusion injury by interacting with Ku70. Circ Res. 2022;130(5):e3–17. doi: 10.1161/CIRCRESAHA.121.318992 [DOI] [PubMed] [Google Scholar]
25.Yu S-Y, Tang L, Zhou S-H. Long noncoding RNAs: new players in ischaemia-reperfusion injury. Heart Lung Circ. 2018;27(3):322–32. doi: 10.1016/j.hlc.2017.09.011 [DOI] [PubMed] [Google Scholar]
26.Yu S-Y, Dong B, Zhou S-H, Tang L. LncRNA UCA1 modulates cardiomyocyte apoptosis by targeting miR-143 in myocardial ischemia-reperfusion injury. Int J Cardiol. 2017;247:31. doi: 10.1016/j.ijcard.2017.05.055 [DOI] [PubMed] [Google Scholar]
27.Wang K, Long B, Zhou L-Y, Liu F, Zhou Q-Y, Liu C-Y, et al. CARL lncRNA inhibits anoxia-induced mitochondrial fission and apoptosis in cardiomyocytes by impairing miR-539-dependent PHB2 downregulation. Nat Commun. 2014;5:3596. doi: 10.1038/ncomms4596 [DOI] [PubMed] [Google Scholar]
28.Wang K, Sun T, Li N, Wang Y, Wang J-X, Zhou L-Y, et al. MDRL lncRNA regulates the processing of miR-484 primary transcript by targeting miR-361. PLoS Genet. 2014;10(7):e1004467. doi: 10.1371/journal.pgen.1004467 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Liu Z, Hou L, Liu Y, Gong J. LncRNA GAS5 exacerbates myocardial ischemia-reperfusion injury through regulating serpina3 by targeting miR-137. Int J Cardiol. 2020;306:9. doi: 10.1016/j.ijcard.2020.01.067 [DOI] [PubMed] [Google Scholar]
30.Matsui T, Amano M, Yamamoto T, Chihara K, Nakafuku M, Ito M, et al. Rho-associated kinase, a novel serine/threonine kinase, as a putative target for small GTP binding protein Rho. EMBO J. 1996;15(9):2208–16. doi: 10.1002/j.1460-2075.1996.tb00574.x [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Hartmann S, Ridley AJ, Lutz S. The function of rho-associated kinases ROCK1 and ROCK2 in the pathogenesis of cardiovascular disease. Front Pharmacol. 2015;6:276. doi: 10.3389/fphar.2015.00276 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Wu N, Zhang X, Bao Y, Yu H, Jia D, Ma C. Down-regulation of GAS5 ameliorates myocardial ischaemia/reperfusion injury via the miR-335/ROCK1/AKT/GSK-3β axis. J Cell Mol Med. 2019;23(12):8420–31. doi: 10.1111/jcmm.14724 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Kümper S, Mardakheh FK, McCarthy A, Yeo M, Stamp GW, Paul A, et al. Rho-associated kinase (ROCK) function is essential for cell cycle progression, senescence and tumorigenesis. Elife. 2016;5:e12994. doi: 10.7554/eLife.12203 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Lone W, Bouska A, Sharma S, Amador C, Saumyaranjan M, Herek TA, et al. Genome-wide miRNA expression profiling of molecular subgroups of peripheral T-cell lymphoma. Clin Cancer Res. 2021;27(21):6039–53. doi: 10.1158/1078-0432.CCR-21-0573 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Laurent M, Geoffroy M, Pavani G, Guiraud S. CRISPR-based gene therapies: from preclinical to clinical treatments. Cells. 2024;13(10):800. doi: 10.3390/cells13100800 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. 2025 May 20;20(5):e0324909. doi: 10.1371/journal.pone.0324909.r001

Author response to Decision Letter 0

26 Feb 2025

PLoS One. doi: 10.1371/journal.pone.0324909.r002

Decision Letter 0

Alexis Carrasco

19 Mar 2025

PONE-D-25-10451Downregulation of OIP5-AS1 Inhibits Apoptosis in Myocardial Ischemia/Reperfusion Injury via Modulating the MiR-145-5p/ROCK1 AxisPLOS ONE

Dear Dr. Zhang,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please check the reviewers' comments. Ensure that all figures are appropriately cited and that the methods are described in sufficient detail for reproducibility. Include catalog IDs for all products used, as well as the sequences for the miR-145-5p mimic. Specify which method was used for the 2^-ΔΔCq calculation (Livak, Pfaffl, or another approach) and provide the corresponding citation. Clearly describe the procedure for adaptor ligation during miRNA-to-cDNA conversion. Define all abbreviations upon their first mention and thoroughly review the English grammar throughout the document. Include melting curves to confirm the specific amplification of all target regions, including miR-145-5p. Replace bar plots with box plots or violin plots, supplemented by point or jitter plots to display all biological replicates, particularly for expression analyses, as this provides a more transparent representation of the results.

Please submit your revised manuscript by May 03 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org . When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols .

We look forward to receiving your revised manuscript.

Kind regards,

Alexis G. Murillo Carrasco

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information regarding the experiments involving animals and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering.

3. Thank you for stating the following financial disclosure:

“Natural Science Foundation of Shandong Province (grant no. ZR2022MH285)”

Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

4. Thank you for stating the following in the Funding Section of your manuscript:

“The authors gratefully acknowledge research support provided by Natural Science Foundation of Shandong Province (grant no. ZR2022MH285).”

We note that you have provided funding information that is currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

“Natural Science Foundation of Shandong Province (grant no. ZR2022MH285)”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

5. When completing the data availability statement of the submission form, you indicated that you will make your data available on acceptance. We strongly recommend all authors decide on a data sharing plan before acceptance, as the process can be lengthy and hold up publication timelines. Please note that, though access restrictions are acceptable now, your entire data will need to be made freely accessible if your manuscript is accepted for publication. This policy applies to all data except where public deposition would breach compliance with the protocol approved by your research ethics board. If you are unable to adhere to our open data policy, please kindly revise your statement to explain your reasoning and we will seek the editor's input on an exemption. Please be assured that, once you have provided your new statement, the assessment of your exemption will not hold up the peer review process.

6. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions

7. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section.

8. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

Reviewer #3: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Yang and his colleagues observed that the expression of the long non-coding RNA (lncRNA) OIP5-AS1 and apoptosis were increased in myocardial ischemia/reperfusion (I/R) injury. Based on their previous study, they further confirmed that the expression of miR-145-5p was increased, while its target, ROCK1, was decreased. They then demonstrated that reducing OIP5-AS1 expression led to a decrease in apoptosis and experimentally validated the relationship between OIP5-AS1 and miR-145-5p.

The paper presents a very straightforward mechanism, and the experimental evidence supporting each claim is convincing.

However, to strengthen the authors' argument, I suggest including additional experiments to clarify the relationship between ROCK1 and OIP5-AS1:

1. Does overexpression of ROCK1 in the context of reduced OIP5-AS1 modulate the level of apoptosis?

2. How does apoptosis change when anti-miR-145-5p is introduced in a setting where OIP5-AS1 is downregulated?

Reviewer #2: Thank you for the opportunity to review your manuscript titled "Downregulation of OIP5-AS1 Inhibits Apoptosis in Myocardial Ischemia/Reperfusion Injury via Modulating the MiR-145-5p/ROCK1 Axis." Your study addresses an important and relevant area of research with potential implications for novel therapeutic strategies targeting myocardial ischemia/reperfusion injury. The exploration of OIP5-AS1's interaction with miR-145-5p and its downstream impact on ROCK1 is promising and could significantly contribute to the existing literature.

However, the methodology section needs substantial improvement. The descriptions provided are too simplified and lack critical details necessary for replication. Specifically, information regarding the exact concentrations of siRNAs, miRNA mimics, and inhibitors utilized in the experiments is missing. Additionally, you should justify the choice of Lipofectamine 2000 over the more RNA-specific reagent Lipofectamine RNAiMAX. Clarification about whether optimization experiments using "killer" siRNA were conducted would also strengthen your methodological transparency. Including control experiments with Lipofectamine alone would clarify if observed effects are due specifically to the treatments or influenced by reagent toxicity. Also, crucial details such as the quantity of RNA used in qPCR reactions, conditions for replicates (technical or biological), the acceptable Ct variation between replicates, and explicitly mentioning the normalization gene used (presumably snU6) must be clearly stated.

In your results section, findings are presented clearly and accompanied by suitable statistical analyses. Nevertheless, minor typographical errors were identified—for instance, "Conrtol" should be corrected to "Control" in Figure 2. Moreover, please clarify whether control groups containing only Lipofectamine (without siRNAs or mimics) were included to exclude nonspecific reagent effects.

Your discussion section is somewhat superficial and would greatly benefit from a more thorough examination of the study's limitations. It is essential to explicitly address limitations, such as small sample sizes, potential off-target effects of transfection agents, and methodological constraints inherent to the model systems used. Additionally, clearly stating future research directions would significantly strengthen this section. For example, suggesting studies that could confirm your findings in larger or more clinically relevant contexts would substantially enhance the manuscript’s scientific and clinical significance.

Furthermore, you should provide clear steps or recommendations to explore the clinical applicability of your findings. For instance, how might the OIP5-AS1 and miR-145-5p/ROCK1 axis modulation translate into clinical interventions or therapeutic approaches?

Lastly, a minor typographical and grammatical revision is necessary throughout the manuscript to maintain professional standards, such as correcting the spelling of "Conrtol" to "Control" in Figure 2. A professional language review is recommended prior to resubmission.

In conclusion, the manuscript presents valuable and promising insights but requires substantial methodological clarifications, deeper acknowledgment of limitations, and a more comprehensive discussion before consideration for acceptance.

Reviewer #3: The authors showed that a long non-coding RNA OIP5-AS1 is upregulated upon ischemia/reperfusion (I/R)-induced apoptosis, and can act like a sponge for miR-145-5p and release the miR-145-5p target (ROCK1) expression. Both in vitro (culture cells) and in vivo models were used.

I could read until Figure 2 end, but started to fell unconfortable for reading the result section afterwards. This is because Figures are not cited correctly in the Result section of maintext and the writing is poor especially in the latter half.

[Methods section]

“miR-145 mimics and inhibitors” information was not shown.

[Result section]

In the paragraph “MiR-145-5p directly targeted by OIP5-AS1 and expressed at low levels in I/R”, Figure 3B is first cited, 3A cannot be found. Neither to 3C 3D 3F.

“Furthermore, silencing of OIP5-AS1 in I/R significantly upregulated miR-145-5p

expression (Fig. 2E).” – Figure 2E is not showing this evidence.

“These results indicated that miR-145-5p was downregulated in

I/R and was a target of OIP5-AS1.” – Better rephrase. Generally, a transcript is a target of miRNA.

“Western blot analysis

and RT-qPCR were performed to investigate ROCK1 expression. Results showed significant upregulation of ROCK1 in I/R cell models compared with controls (Fig.1F).” – Fig.1F is RNA data. No WB data was shown.

“The luciferase report assay demonstrated that miR-145-5p mimics substantially attenuated the luciferase activity of ROCK1-WT, while ROCK1-MUT showed no changes in response to miR-145-5p elevation (Fig. 3F).” – Need rephrase. More correctly, "no change after addition of miR-145-5p mimics.” It is very confusing that this figure is placed as Fig 3F.

“ROCK1 expression was reduced in I/R by OIP5-AS1 deficiency while miR-145-5p was highly

expressed (Fig. 2F and 2G).” – These data are showing ROCK1 RNA and protein levels. but not miR-145-5p level.

“Altogether, OIP5-AS1 behaved as a ceRNA against miR-145-5p, resulting in ROCK1 upregulation.” – Cannot give such strong conclusion from these data. Just “suggest”.

“ceRNA” appears here for the first time without explanation. What is it.

“Figure 5” appears in the last paragraph, without any explanation of individual panels (5A~E). Very poor and unfriendly writing.

[Discussion section]

“OIP5-AS1. OIP5-AS1 was found to inhibit the protective function of miR-145-5p, and it was confirmed to target miR-145-5p.” – “confirmed” sounds too strong compared to the presented data.

The authors can try OIP5-AS1 overexpression experiment in the absence of IR treatment in vitro and in vivo. “a transcript is targeting a miRNA” is confusing, and better be rephrased, like “ OIP-AS1 can sequester miR-145-5p” or “OIP-AS1 has the target site of miR-145-5p”

“This further supports the relationship between OIP5-AS1and miR-145-5p.” – should explain more about the “relationship” in this sentence.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy .

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/ . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org . Please note that Supporting Information files do not need this step.

PLoS One. 2025 May 20;20(5):e0324909. doi: 10.1371/journal.pone.0324909.r003

Author response to Decision Letter 1

3 Apr 2025

Reviewer #1:

Yang and his colleagues observed that the expression of the long non-coding RNA (lncRNA) OIP5-AS1 and apoptosis were increased in myocardial ischemia/reperfusion (I/R) injury. Based on their previous study, they further confirmed that the expression of miR-145-5p was increased, while its target, ROCK1, was decreased. They then demonstrated that reducing OIP5-AS1 expression led to a decrease in apoptosis and experimentally validated the relationship between OIP5-AS1 and miR-145-5p.

The paper presents a very straightforward mechanism, and the experimental evidence supporting each claim is convincing.

However, to strengthen the authors' argument, I suggest including additional experiments to clarify the relationship between ROCK1 and OIP5-AS1:

1. Does overexpression of ROCK1 in the context of reduced OIP5-AS1 modulate the level of apoptosis?

We sincerely appreciate the reviewer’s insightful suggestion to further strengthen the mechanistic link between OIP5-AS1 and ROCK1 in regulating apoptosis. We overexpressed ROCK1 in OIP5-AS1-deficient cells. In Fig7, while OIP5-AS1 knockdown alone reduced apoptosis, concomitant ROCK1 overexpression reversed this effect.

2. How does apoptosis change when anti-miR-145-5p is introduced in a setting where OIP5-AS1 is downregulated?

In Fig6 of the manuscript, we investigated whether OIP5-AS1 regulates ischemia/reperfusion (I/R)-induced apoptosis through miR-145-5p. TUNEL staining results demonstrated that suppression of OIP5-AS1 significantly reduced cellular apoptosis, whereas treatment with a miR-145-5p inhibitor completely abolished this anti-apoptotic effect.

Reviewer #2:

Thank you for the opportunity to review your manuscript titled "Downregulation of OIP5-AS1 Inhibits Apoptosis in Myocardial Ischemia/Reperfusion Injury via Modulating the MiR-145-5p/ROCK1 Axis." Your study addresses an important and relevant area of research with potential implications for novel therapeutic strategies targeting myocardial ischemia/reperfusion injury. The exploration of OIP5-AS1's interaction with miR-145-5p and its downstream impact on ROCK1 is promising and could significantly contribute to the existing literature.

Thank you for your valuable advice. We acknowledge the need for a more detailed and transparent methodology section to ensure reproducibility and clarity.

We have added specific information regarding the use of siRNAs, miRNA mimics, and inhibitors in the manuscript. Lipofectamine 2000 was chosen for its proven efficacy, compatibility with our cell model, and alignment with prior research methodologies. This decision was further supported by optimization experiments and appropriate controls to ensure the reliability of our findings.

Optimization studies were performed using a cytotoxicity-inducing siRNA (a non-targeting siRNA with a known cytotoxic effect) to establish the optimal transfection conditions while minimizing cell toxicity. The final transfection conditions were selected based on achieving a knockdown efficiency exceeding 80% while maintaining cell viability above 90%.

For qPCR experiments, Acceptable Ct variation between replicates: ≤0.5. U6 was used as the endogenous control for normalization of miRNA expression levels. For mRNA quantification, Actin was used as the housekeeping gene.

Regarding the typographical error in Figure , we acknowledge the mistake and confirm that "Conrtol" will be corrected to "Control" in the revised version of the manuscript. We will thoroughly proofread the entire document to ensure no similar errors remain. Thank you again for your attention to detail and constructive suggestions. And we confirm that control groups containing only Lipofectamine (without siRNAs or mimics) were indeed included in all experiments.

We sincerely appreciate the reviewer’s constructive feedback. In response to the concerns raised, we have significantly expanded the limitations and future directions sections in the discussion section of the revised manuscript to address these critical points in greater depth.

Thank you for your careful review and valuable feedback. We appreciate your positive comments on the clarity of our results and the statistical analyses. Regarding the typographical error in Figure , we acknowledge the mistake and confirm that "Conrtol" will be corrected to "Control" in the revised version of the manuscript. We will thoroughly proofread the entire document to ensure no similar errors remain. Thank you again for your attention to detail and constructive suggestions.

Reviewer #3:

The authors showed that a long non-coding RNA OIP5-AS1 is upregulated upon ischemia/reperfusion (I/R)-induced apoptosis, and can act like a sponge for miR-145-5p and release the miR-145-5p target (ROCK1) expression. Both in vitro (culture cells) and in vivo models were used.

[Methods section]

“miR-145 mimics and inhibitors” information was not shown.

Thank you for pointing this out. We apologize for the oversight. The specific details regarding the miR-145 mimics and inhibitors have now been added to the revised manuscript.

[Result section]

In the paragraph “MiR-145-5p directly targeted by OIP5-AS1 and expressed at low levels in I/R”, Figure 3B is first cited, 3A cannot be found. Neither to 3C 3D 3F.

“Furthermore, silencing of OIP5-AS1 in I/R significantly upregulated miR-145-5p

expression (Fig. 2E).” – Figure 2E is not showing this evidence.

“These results indicated that miR-145-5p was downregulated in

I/R and was a target of OIP5-AS1.” – Better rephrase. Generally, a transcript is a target of miRNA.

“Western blot analysis

We sincerely thank the reviewer for pointing out the importance of ensuring consistency between figure citations and the main text descriptions. We have carefully reviewed all figure citations throughout the manuscript and we have verified that all figures are cited in the correct order and context within the text.We have revised the text to ensure that the descriptions of each figure panel are accurate and complete.

The original sentence has been revised to: “The luciferase report assay demonstrated that miR-145-5p mimics significantly reduced the luciferase activity of ROCK1-WT, whereas no change was observed in ROCK1-MUT after the addition of miR-145-5p mimics.”

“ROCK1 expression was reduced in I/R by OIP5-AS1 deficiency while miR-145-5p was highly

expressed (Fig. 2F and 2G).” – These data are showing ROCK1 RNA and protein levels. but not miR-145-5p level.

“Altogether, OIP5-AS1 behaved as a ceRNA against miR-145-5p, resulting in ROCK1 upregulation.” – Cannot give such strong conclusion from these data. Just “suggest”.

Thank you for your careful reading and constructive feedback. We agree that the data presentation and conclusions need to be more precise.We have further verified and confirmed that all figure/table citations are consistent with their descriptions in the main text. And we carefully revised the statement in question to better reflect the preliminary nature of our findings: “Collectively, these data suggest OIP5-AS1 may behave as a ceRNA against miR-145-5p, resulting in ROCK1 upregulation.”

“ceRNA” appears here for the first time without explanation. What is it.

“Figure 5” appears in the last paragraph, without any explanation of individual panels (5A~E). Very poor and unfriendly writing.

We sincerely appreciate the reviewer's valuable feedback regarding the clarity of our manuscript. We have added a clear definition when first introducing the term:“ceRNA” . We have completely rewritten the paragraph to provide a comprehensive explanation of Figure 9.

[Discussion section]

“OIP5-AS1. OIP5-AS1 was found to inhibit the protective function of miR-145-5p, and it was confirmed to target miR-145-5p.” – “confirmed” sounds too strong compared to the presented data.

We sincerely appreciate the reviewer's valuable feedback regarding the clarity of our manuscript. We have rewritten the discussion section. For example, we have carefully revised the statement in question to better reflect the preliminary nature of our findings: Our findings indicate that OIP5-AS1 negatively regulates the cardioprotective effects of miR-145-5p through direct interaction, as demonstrated by our mechanistic studies.

Thank you for your careful reading and constructive feedback. We have rewritten the discussion section.

“This further supports the relationship between OIP5-AS1and miR-145-5p.” – should explain more about the “relationship” in this sentence.

Thank you for your careful reading and constructive feedback. We have rewritten the discussion section. We have carefully revised the statement: This finding further supports the competitive binding relationship between OIP5-AS1 and miR-145-5p, where OIP5-AS1 acts as a molecular sponge to miR-145-5p.

Attachment

Submitted filename: Response to Reviewers.docx

pone.0324909.s005.docx^{(27.5KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0324909.r004

Decision Letter 1

Alexis Carrasco

30 Apr 2025

PONE-D-25-10451R1Downregulation of OIP5-AS1 Inhibits Apoptosis in Myocardial Ischemia/Reperfusion Injury via Modulating the MiR-145-5p/ROCK1 AxisPLOS ONE

Dear Dr. Zhang,

Please verify minor language and typo corrections suggested for reviewers, and run a complete proofreading of the manuscript.

Please submit your revised manuscript by Jun 14 2025 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org . When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Alexis G. Murillo Carrasco

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Reviewer #1: Thank you for conducting all the experiments I suggested and for including the corresponding results.

Reviewer #2: I have carefully evaluated the revised manuscript entitled "Downregulation of OIP5-AS1 Inhibits Apoptosis in Myocardial Ischemia/Reperfusion Injury via Modulating the MiR-145-5p/ROCK1 Axis."

I appreciate the authors' efforts to thoroughly address all the concerns raised in the initial review. The manuscript has undergone significant improvements, particularly in the following aspects:

Methodology: The authors have now provided detailed descriptions of the experimental procedures, including the concentrations of siRNAs, mimics, and inhibitors, the rationale for choosing Lipofectamine 2000, and optimization details. The methodology is now sufficiently transparent to allow reproducibility.

Controls: Appropriate negative controls were included and clearly described, addressing concerns about potential nonspecific effects of transfection reagents.

Results Presentation: Minor typographical errors, such as the correction of "Conrtol" to "Control," have been rectified.

Discussion and Limitations: The authors have expanded the discussion significantly, explicitly acknowledging key limitations and proposing valuable future research directions, which strengthen the manuscript's scientific rigor and translational relevance.

Language and Style: The manuscript's language has been improved considerably. Although minor editorial polishing could further enhance clarity, it does not hinder comprehension or scientific value.

Given the authors' careful and thoughtful revisions, I find that all my initial concerns have been satisfactorily addressed.

Therefore, I recommend the manuscript for acceptance after minor language editing (optional proofreading).

Congratulations to the authors for their excellent work and for the significant improvements made to the manuscript.

Reviewer #3: Many points were addressed by the authors.

I just give some points that would need correction before publication.

Table 1

si-OIP5-AS1 and miR mimic‑NC contain "T" in their sequence. If true, why control does not have them.

"Concentration" cannot be understood. Final concentration in culture?

Table 2

Oligos for miRNA would not be correct. Probably the reverse one is an adaptor for RT. Universal Rv primer should be used here.

I have no idea if "miR, microRNA; ROCK1, Rho-associated coiled-coil-containing kinase 1" included in Table 2 is needed in this position.

Line 246

Sentence stopped in the middle. "compared" to what.

Line 268

I didn't get what "pivoral" indicates here.

Line 275

Figure 5 and "8"

8A and 8B are not cited, although authors stated all Figures are to be correctly cited.

Figure legends for Fig1~9 were provided as supporting information.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean? ). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy .

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

**********

PLoS One. 2025 May 20;20(5):e0324909. doi: 10.1371/journal.pone.0324909.r005

Author response to Decision Letter 2

1 May 2025

Reviewer #1: Thank you for conducting all the experiments I suggested and for including the corresponding results.

We sincerely appreciate your insightful comments and are grateful for your acknowledgment of our work in implementing all suggested experiments. Your expertise has significantly strengthened our study.

I appreciate the authors' efforts to thoroughly address all the concerns raised in the initial review. The manuscript has undergone significant improvements, particularly in the following aspects:

Controls: Appropriate negative controls were included and clearly described, addressing concerns about potential nonspecific effects of transfection reagents.

Results Presentation: Minor typographical errors, such as the correction of "Conrtol" to "Control," have been rectified.

Language and Style: The manuscript's language has been improved considerably. Although minor editorial polishing could further enhance clarity, it does not hinder comprehension or scientific value.

Given the authors' careful and thoughtful revisions, I find that all my initial concerns have been satisfactorily addressed.

Therefore, I recommend the manuscript for acceptance after minor language editing (optional proofreading).

Congratulations to the authors for their excellent work and for the significant improvements made to the manuscript.

We are deeply grateful for your insightful comments that significantly improved our manuscript. We have implemented the minor language edits as suggested.

Reviewer #3: Many points were addressed by the authors.

I just give some points that would need correction before publication.

Table 1

si-OIP5-AS1 and miR mimic‑NC contain "T" in their sequence. If true, why control does not have them.

"Concentration" cannot be understood. Final concentration in culture?

We sincerely appreciate the reviewer's meticulous review. SiRNA sequences are shown as DNA templates (containing Thymine). MiRNA mimics/inhibitors are direct synthetic RNA oligos (containing Uracil). We have modified the si-NC sequence to be consistent with DNA template notation (using Thymine instead of Uracil).

We apologize for the ambiguity. The concentrations listed are indeed the final working concentrations in cell culture medium after transfection complex delivery. We have revised the table header to ‘Final working concentration (nM)’.

Table 2

Oligos for miRNA would not be correct. Probably the reverse one is an adaptor for RT. Universal Rv primer should be used here.

I have no idea if "miR, microRNA; ROCK1, Rho-associated coiled-coil-containing kinase 1" included in Table 2 is needed in this position.

We sincerely appreciate the reviewer's expert insights regarding Table 2. We have removed the redundant reverse primer sequence and moved "miR, microRNA; ROCK1..." to the general abbreviation list in the Table 2 footer.

Line 246

Sentence stopped in the middle. "compared" to what.

We sincerely appreciate the reviewer's careful reading. Regarding the incomplete sentence at Line 246 in the original manuscript, we have revised the full sentence “Compared with the control group, expression of miR-145-5p in H9c2 cardiomyocytes was significantly downregulated in I/R.”

Line 268

I didn't get what "pivoral" indicates here.

We sincerely appreciate the reviewer's careful reading and constructive feedback. We have modified the text to “The results suggested that ROCK1 played a significant role in mediating OIP5-AS1's effects on cardiomyocyte apoptosis in I/R.”

Line 275

Figure 5 and "8"

8A and 8B are not cited, although authors stated all Figures are to be correctly cited.

We sincerely appreciate the reviewer's careful reading and constructive suggestions. We have now ensured all figure panels are properly cited throughout the text. The relevant paragraph now reads “ In the present study, we initially corroborated the efficacy of OIP5-AS1 knockdown in our experimental models (Fig. 5A and 8A). Importantly, OIP5-AS1 deficiency led to a substantial decrease in ROCK1 expression, accompanied by an increase in miR-145-5p levels under I/R conditions (Fig. 5B-C and 8B-C). ”(Line 282)

Figure legends for Fig1~9 were provided as supporting information.

We sincerely appreciate the reviewer's careful reading. We have now uploaded all figure legends (for Fig1-9) as Supporting Information S4 File.

Attachment

Submitted filename: Response_to_Reviewers_auresp_2.docx

pone.0324909.s006.docx^{(16.5KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0324909.r006

Decision Letter 2

Alexis Carrasco

4 May 2025

Downregulation of OIP5-AS1 Inhibits Apoptosis in Myocardial Ischemia/Reperfusion Injury via Modulating the MiR-145-5p/ROCK1 Axis

PONE-D-25-10451R2

Dear Dr. Zhang,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Alexis G. Murillo Carrasco

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0324909.r007

Acceptance letter

Alexis Carrasco

PONE-D-25-10451R2

PLOS ONE

Dear Dr. Zhang,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

You will receive further instructions from the production team, including instructions on how to review your proof when it is ready. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few days to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Alexis G. Murillo Carrasco

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 File. Experimental data.

(XLSX)

pone.0324909.s001.xlsx^{(108.1KB, xlsx)}

S2 File. Melting curves.

(TIF)

pone.0324909.s002.tif^{(15.9MB, tif)}

S3 File. Original blot and gel image data.

(TIF)

pone.0324909.s003.tif^{(6.7MB, tif)}

Attachment

Submitted filename: Response to Reviewers.docx

pone.0324909.s005.docx^{(27.5KB, docx)}

Attachment

Submitted filename: Response_to_Reviewers_auresp_2.docx

pone.0324909.s006.docx^{(16.5KB, docx)}

Data Availability Statement

All data underlying the findings described in this manuscript are fully available without restriction in the Supporting information files accompanying this article.

[pone.0324909.ref001] 1.Kaski J-C, Crea F, Gersh BJ, Camici PG. Reappraisal of ischemic heart disease. Circulation. 2018;138(14):1463–80. doi: 10.1161/CIRCULATIONAHA.118.031373 [DOI] [PubMed] [Google Scholar]

[pone.0324909.ref002] 2.Yellon DM, Hausenloy DJ. Myocardial reperfusion injury. N Engl J Med. 2007;357(11):1121–35. doi: 10.1056/NEJMra071667 [DOI] [PubMed] [Google Scholar]

[pone.0324909.ref003] 3.Hausenloy DJ, Yellon DM. Myocardial ischemia-reperfusion injury: a neglected therapeutic target. J Clin Invest. 2013;123(1):92–100. doi: 10.1172/JCI62874 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref004] 4.Liu Y, Li L, Wang Z, Zhang J, Zhou Z. Myocardial ischemia-reperfusion injury; molecular mechanisms and prevention. Microvasc Res. 2023;149:104565. doi: 10.1016/j.mvr.2023.104565 [DOI] [PubMed] [Google Scholar]

[pone.0324909.ref005] 5.Heusch G, Gersh BJ. The pathophysiology of acute myocardial infarction and strategies of protection beyond reperfusion: a continual challenge. Eur Heart J. 2017;38(11):774–84. doi: 10.1093/eurheartj/ehw224 [DOI] [PubMed] [Google Scholar]

[pone.0324909.ref006] 6.Wang J, Zhou H. Mitochondrial quality control mechanisms as molecular targets in cardiac ischemia-reperfusion injury. Acta Pharm Sin B. 2020;10(10):1866–79. doi: 10.1016/j.apsb.2020.03.004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref007] 7.Hausenloy DJ, Chilian W, Crea F, Davidson SM, Ferdinandy P, Garcia-Dorado D, et al. The coronary circulation in acute myocardial ischaemia/reperfusion injury: a target for cardioprotection. Cardiovasc Res. 2019;115(7):1143–55. doi: 10.1093/cvr/cvy286 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref008] 8.Silvis MJM, Kaffka Genaamd Dengler SE, Odille CA, Mishra M, van der Kaaij NP, Doevendans PA, et al. Damage-associated molecular patterns in myocardial infarction and heart transplantation: the road to translational success. Front Immunol. 2020;11:599511. doi: 10.3389/fimmu.2020.599511 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref009] 9.Schirone L, Forte M, D’Ambrosio L, Valenti V, Vecchio D, Schiavon S, et al. An overview of the molecular mechanisms associated with myocardial ischemic injury: state of the art and translational perspectives. Cells. 2022;11(7):1165. doi: 10.3390/cells11071165 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref010] 10.Yao R-W, Wang Y, Chen L-L. Cellular functions of long noncoding RNAs. Nat Cell Biol. 2019;21(5):542–51. doi: 10.1038/s41556-019-0311-8 [DOI] [PubMed] [Google Scholar]

[pone.0324909.ref011] 11.Kopp F, Mendell JT. Functional classification and experimental dissection of long noncoding RNAs. Cell. 2018;172(3):393–407. doi: 10.1016/j.cell.2018.01.011 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref012] 12.Mowel WK, Kotzin JJ, McCright SJ, Neal VD, Henao-Mejia J. Control of immune cell homeostasis and function by lncRNAs. Trends Immunol. 2018;39(1):55–69. doi: 10.1016/j.it.2017.08.009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref013] 13.Sallam T, Sandhu J, Tontonoz P. Long noncoding RNA discovery in cardiovascular disease: decoding form to function. Circ Res. 2018;122(1):155–66. doi: 10.1161/CIRCRESAHA.117.311802 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref014] 14.Quinn JJ, Chang HY. Unique features of long non-coding RNA biogenesis and function. Nat Rev Genet. 2016;17(1):47–62. doi: 10.1038/nrg.2015.10 [DOI] [PubMed] [Google Scholar]

[pone.0324909.ref015] 15.Huang S, Xue L, Mou Q. Emodin regulates lncRNA XIST/miR-217 axis to protect myocardial ischemia-reperfusion injury. Oxid Med Cell Longev. 2023;2023:3612814. doi: 10.1155/2023/3612814 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref016] 16.Zhao Z, Sun W, Guo Z, Liu B, Yu H, Zhang J. Long noncoding RNAs in myocardial ischemia-reperfusion injury. Oxid Med Cell Longev. 2021;2021:8889123. doi: 10.1155/2021/8889123 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref017] 17.Hu F, Yang J, Chen X, Shen Y, Chen K, Fu X, et al. LncRNA 1700020I14Rik/miR-297a/CGRP axis suppresses myocardial cell apoptosis in myocardial ischemia-reperfusion injury. Mol Immunol. 2020;122:54–61. doi: 10.1016/j.molimm.2020.03.015 [DOI] [PubMed] [Google Scholar]

[pone.0324909.ref018] 18.Niu X, Pu S, Ling C, Xu J, Wang J, Sun S, et al. lncRNA Oip5-as1 attenuates myocardial ischaemia/reperfusion injury by sponging miR-29a to activate the SIRT1/AMPK/PGC1α pathway. Cell Prolif. 2020;53(6):e12818. doi: 10.1111/cpr.12818 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref019] 19.Cheng C, Xu D-L, Liu X-B, Bi S-J, Zhang J. MicroRNA-145-5p inhibits hypoxia/reoxygenation-induced apoptosis in H9c2 cardiomyocytes by targeting ROCK1. Exp Ther Med. 2021;22(2):796. doi: 10.3892/etm.2021.10228 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref020] 20.Degterev A, Yuan J. Expansion and evolution of cell death programmes. Nat Rev Mol Cell Biol. 2008;9(5):378–90. doi: 10.1038/nrm2393 [DOI] [PubMed] [Google Scholar]

[pone.0324909.ref021] 21.Salmena L, Poliseno L, Tay Y, Kats L, Pandolfi PP. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 2011;146(3):353–8. doi: 10.1016/j.cell.2011.07.014 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref022] 22.Maslov LN, Popov SV, Naryzhnaya NV, Mukhomedzyanov AV, Kurbatov BK, Derkachev IA, et al. The regulation of necroptosis and perspectives for the development of new drugs preventing ischemic/reperfusion of cardiac injury. Apoptosis. 2022;27(9–10):697–719. doi: 10.1007/s10495-022-01760-x [DOI] [PubMed] [Google Scholar]

[pone.0324909.ref023] 23.Xu Z, Mo Y, Li X, Hong W, Shao S, Liu Y, et al. The novel LncRNA AK035396 drives cardiomyocyte apoptosis through Mterf1 in myocardial ischemia/reperfusion injury. Front Cell Dev Biol. 2021;9:773381. doi: 10.3389/fcell.2021.773381 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref024] 24.Xiao H, Zhang M, Wu H, Wu J, Hu X, Pei X, et al. CIRKIL exacerbates cardiac ischemia/reperfusion injury by interacting with Ku70. Circ Res. 2022;130(5):e3–17. doi: 10.1161/CIRCRESAHA.121.318992 [DOI] [PubMed] [Google Scholar]

[pone.0324909.ref025] 25.Yu S-Y, Tang L, Zhou S-H. Long noncoding RNAs: new players in ischaemia-reperfusion injury. Heart Lung Circ. 2018;27(3):322–32. doi: 10.1016/j.hlc.2017.09.011 [DOI] [PubMed] [Google Scholar]

[pone.0324909.ref026] 26.Yu S-Y, Dong B, Zhou S-H, Tang L. LncRNA UCA1 modulates cardiomyocyte apoptosis by targeting miR-143 in myocardial ischemia-reperfusion injury. Int J Cardiol. 2017;247:31. doi: 10.1016/j.ijcard.2017.05.055 [DOI] [PubMed] [Google Scholar]

[pone.0324909.ref027] 27.Wang K, Long B, Zhou L-Y, Liu F, Zhou Q-Y, Liu C-Y, et al. CARL lncRNA inhibits anoxia-induced mitochondrial fission and apoptosis in cardiomyocytes by impairing miR-539-dependent PHB2 downregulation. Nat Commun. 2014;5:3596. doi: 10.1038/ncomms4596 [DOI] [PubMed] [Google Scholar]

[pone.0324909.ref028] 28.Wang K, Sun T, Li N, Wang Y, Wang J-X, Zhou L-Y, et al. MDRL lncRNA regulates the processing of miR-484 primary transcript by targeting miR-361. PLoS Genet. 2014;10(7):e1004467. doi: 10.1371/journal.pgen.1004467 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref029] 29.Liu Z, Hou L, Liu Y, Gong J. LncRNA GAS5 exacerbates myocardial ischemia-reperfusion injury through regulating serpina3 by targeting miR-137. Int J Cardiol. 2020;306:9. doi: 10.1016/j.ijcard.2020.01.067 [DOI] [PubMed] [Google Scholar]

[pone.0324909.ref030] 30.Matsui T, Amano M, Yamamoto T, Chihara K, Nakafuku M, Ito M, et al. Rho-associated kinase, a novel serine/threonine kinase, as a putative target for small GTP binding protein Rho. EMBO J. 1996;15(9):2208–16. doi: 10.1002/j.1460-2075.1996.tb00574.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref031] 31.Hartmann S, Ridley AJ, Lutz S. The function of rho-associated kinases ROCK1 and ROCK2 in the pathogenesis of cardiovascular disease. Front Pharmacol. 2015;6:276. doi: 10.3389/fphar.2015.00276 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref032] 32.Wu N, Zhang X, Bao Y, Yu H, Jia D, Ma C. Down-regulation of GAS5 ameliorates myocardial ischaemia/reperfusion injury via the miR-335/ROCK1/AKT/GSK-3β axis. J Cell Mol Med. 2019;23(12):8420–31. doi: 10.1111/jcmm.14724 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref033] 33.Kümper S, Mardakheh FK, McCarthy A, Yeo M, Stamp GW, Paul A, et al. Rho-associated kinase (ROCK) function is essential for cell cycle progression, senescence and tumorigenesis. Elife. 2016;5:e12994. doi: 10.7554/eLife.12203 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref034] 34.Lone W, Bouska A, Sharma S, Amador C, Saumyaranjan M, Herek TA, et al. Genome-wide miRNA expression profiling of molecular subgroups of peripheral T-cell lymphoma. Clin Cancer Res. 2021;27(21):6039–53. doi: 10.1158/1078-0432.CCR-21-0573 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0324909.ref035] 35.Laurent M, Geoffroy M, Pavani G, Guiraud S. CRISPR-based gene therapies: from preclinical to clinical treatments. Cells. 2024;13(10):800. doi: 10.3390/cells13100800 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Downregulation of OIP5-AS1 inhibits apoptosis in myocardial ischemia/reperfusion injury via modulating the MiR-145-5p/ROCK1 axis

Jingyan Yang

Jing Liu

Xiaobo Liu

Dongling Xu

Juan Zhang

Roles

Abstract

Purpose

Methods

Results

Conclusions

Introduction

Materials and methods

Myocardial I/R injury cell model

Cell transfection

Table 1. Transfection sequences.

Extraction of total RNA and RT-qPCR

Table 2. Primers used in reverse transcription-polymerase chain reaction.

Luciferase reporter assay

TUNEL staining

Western blot

Myocardial I/R injury rat model

Animal gene therapy

Histological analysis

Statistical analysis

Results

I/R induced apoptosis and OIP5-AS1 over-expression in cardiomyocytes

Fig 1. Myocardial I/R injury induces apoptosis and upregulation of OIP5-AS1 in cardiomyocytes.

Downregulation of OIP5-AS1 decreased I/R-induced cardiomyocytes apoptosis

Fig 2. Knockdown of OIP5-AS1 leads to reduced cell apoptosis in I/R cell models.

OIP5-AS1 bonded to miR-145-5p

Fig 3. OIP5-AS1 binds to miR-145-5p.

MiR-145-5p directly targeted ROCK1

Fig 4. ROCK1 is a target gene of miR-145-5p.

OIP5-AS1 regulated cell apoptosis in myocardial I/R cell models via miR-145-5p

Fig 5. OIP5-AS1 silencing rescues miR-145-5p and suppresses ROCK1.

Fig 6. OIP5-AS1 modulates cell apoptosis via miR-145-5p.

ROCK1 overexpression reversed anti-apoptotic effects of OIP5-AS1 downregulation

Fig 7. ROCK1 reverses OIP5-AS1 silencing-mediated apoptosis suppression.

OIP5-AS1 regulated apoptosis in myocardial I/R cell models by targeting miR-145-5p/ROCK1 axis

Fig 8. MiR-145-5p inhibition rescues ROCK1 expression following OIP5-AS1 silencing in I/R Injury.

Downregulation of OIP5-AS1 alleviated cardiomyocyte apoptosis in myocardial I/R rats

Fig 9. Silencing of OIP5-AS1 attenuates apoptosis by restoring miR-145-5p and suppressing ROCK1 in I/R rat models.

Discussion

Conclusions

Supporting information

Data Availability

Funding Statement

References

Author response to Decision Letter 0

Decision Letter 0

Alexis Carrasco

Roles

Author response to Decision Letter 1

Decision Letter 1

Alexis Carrasco

Roles

Author response to Decision Letter 2

Decision Letter 2

Alexis Carrasco

Roles

Acceptance letter

Alexis Carrasco

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases