Skip to main content
eLife logoLink to eLife
. 2025 May 20;14:RP104913. doi: 10.7554/eLife.104913

Secretory leukocyte protease inhibitor influences periarticular joint inflammation in Borrelia burgdorferi-infected mice

Qian Yu 1,†,, Xiaotian Tang 1,2,, Thomas Hart 1, Robert Homer 3, Alexia A Belperron 4, Linda K Bockenstedt 4, Aaron Ring 5,6, Akira Nakamura 7, Erol Fikrig 1
Editors: Huihui Li8, Dominique Soldati-Favre9
PMCID: PMC12092001  PMID: 40392222

Abstract

Lyme disease, caused by Borrelia burgdorferi, is the most common tick-borne infection in the United States. Arthritis is a major clinical manifestation of infection, and synovial tissue damage has been attributed to the excessive pro-inflammatory responses. The secretory leukocyte protease inhibitor (SLPI) promotes tissue repair and exerts anti-inflammatory effects. The role of SLPI in the development of Lyme arthritis in C57BL/6 mice, which can be infected with B. burgdorferi but only develop mild joint inflammation, was therefore examined. Slpi-deficient C57BL/6 mice challenged with B. burgdorferi had a higher infection load in the tibiotarsal joints and marked periarticular swelling compared to infected wild-type control mice. The ankle joint tissues of B. burgdorferi-infected Slpi-deficient mice contained significantly higher percentages of infiltrating neutrophils and macrophages. B. burgdorferi-infected Slpi-deficient mice also exhibited elevated serum levels of IL-6, neutrophil elastase, and MMP-8. Moreover, using a recently developed BASEHIT (BActerial Selection to Elucidate Host-microbe Interactions in high Throughput) library, we found that SLPI directly interacts with B. burgdorferi. These data demonstrate the importance of SLPI in suppressing periarticular joint inflammation in Lyme disease.

Research organism: Other

Introduction

Lyme disease is the most common tick-borne illness in the United States, affecting an estimated 500,000 people each year (Kugeler et al., 2021). The spirochete Borrelia burgdorferi is the causative agent of Lyme disease and is primarily transmitted by Ixodes scapularis ticks in North America (Mead, 2022). Early administration of antibiotics is usually successful in the treatment of Lyme disease. However, between 2008 and 2015, arthritis was the major manifestation in a third of Lyme disease cases reported to the CDC (Arvikar and Steere, 2022; Schwartz et al., 2017). Musculoskeletal symptoms occur at all stages of Lyme disease, with migratory arthralgias in the early stages and frank arthritis occurring months later. Lyme arthritis can present as acute or intermittent self-resolving episodes or persistent joint swelling and pain, which, if left untreated, can lead to irreversible joint dysfunction and debilitation (Arvikar and Steere, 2022; Steere et al., 1987; Miller and Aucott, 2021). Although Lyme arthritis resolves completely with antibiotic therapy in most patients, a small percentage of individuals experience persistent joint inflammation for months or several years, termed post-infectious Lyme arthritis (Arvikar and Steere, 2022; Steere et al., 1987; Lochhead et al., 2021).

Studies of synovial fluid from Lyme arthritis patients found infiltrating polymorphonuclear cells (PMNs), IFN-γ-producing mononuclear cells, and large amounts of NF-κB-induced pro-inflammatory cytokines and chemokines, such as IL-6, CXCL10, and TNF-α (Miller and Aucott, 2021; Shin et al., 2007; Lochhead et al., 2019b; Gross et al., 1998). An inverse correlation between the robust IFN-γ signature and tissue repair has been demonstrated in the synovial tissue and fluid from patients with post-infectious Lyme arthritis (Lochhead et al., 2019a). This suggests that the dysregulated excessive pro-inflammatory responses inhibit tissue repair and lead to extensive tissue damage.

B. burgdorferi infection of laboratory mice causes an acute arthritis, the severity of which is mouse strain dependent (Barthold et al., 1990). B. burgdorferi-infected-C3H/HeN mice develop pronounced neutrophilic infiltration of periarticular structures and the synovial lining, which peaks in severity several weeks after infection (Barthold et al., 1993). In contrast, infection of B. burgdorferi C57BL/6 mice causes mild, if any, arthritis (Ma et al., 1998). On a C57BL/6 background, the immune-deficient Rag1-/- and SCID mice are also resistant to B. burgdorferi-induced arthritis, indicating that responses independent of humoral and cellular immunity contribute to the milder phenotype of disease in these animals (Brown and Reiner, 1999). Similar to Lyme arthritis in humans, neutrophils, macrophages, and signaling involving IFN-γ and NF-κB contribute to the severity of murine joint inflammation (Ritzman et al., 2010; Miller et al., 2008; Brown et al., 2003; Anguita et al., 2002).

The secretory leukocyte protease inhibitor (SLPI) is a 12 kDa, secreted, non-glycosylated, cysteine-rich protein (Doumas et al., 2005). It strongly inhibits serine proteases, especially neutrophil-derived serine proteases (NSPs), including cathepsin G (CTSG) and elastase (NE) (Thompson and Ohlsson, 1986; Moreau et al., 2008). It is secreted by epithelial cells at various mucosal surfaces and is also produced by neutrophils, macrophages, mast cells, and fibroblasts (Maruyama et al., 1994; Sallenave et al., 1994). The major function of SLPI is to inhibit excessive protease activity at sites of inflammation, thus promoting tissue repair and wound healing (Ashcroft et al., 2000; Zhu et al., 2002). SLPI also exerts anti-inflammatory function by inhibiting NF-κB activation in macrophages (Taggart et al., 2005; Taggart et al., 2002; Jin et al., 1997). The roles of neutrophils and NSPs have been extensively studied in rheumatoid arthritis, a condition sharing some similarities with Lyme arthritis (Huet et al., 1992; Wilkinson et al., 2019). NE and CTSG induce potent destruction of cartilage proteoglycan in vitro and in vivo, which contributes to rheumatoid arthritis progression (McDonnell et al., 1993). Some studies also demonstrated that SLPI inhibits joint inflammation and bone destruction (Lee et al., 2016; Song et al., 1999). However, the importance of SLPI and NSPs has not been studied in the context of Lyme disease.

Thus, in this study, we examined the role of SLPI in the development of murine Lyme arthritis caused by B. burgdorferi. Using the Slpi-deficient C57BL/6 mice, we observed a significant increase in the infection burden and marked periarticular swelling in the ankle joints compared to WT mice following B. burgdorferi infection. Significant increases in infiltrating neutrophils and macrophages were observed in the ankle joints of infected Slpi-deficient mice. Elevated serum levels of IL-6, neutrophil elastase, and MMP-8 in the infected Slpi-deficient mice were also observed, which can lead to the recruitment of neutrophils and macrophages exacerbating the periarticular swelling. We further demonstrated the direct interaction between SLPI and B. burgdorferi. This is the first study showing the importance of anti-protease–protease balance in the development of murine Lyme arthritis.

Results

SLPI influences periarticular joint inflammation in B. burgdorferi-infected mice

To assess the importance of SLPI during murine Lyme arthritis, we compared the outcomes of B. burgdorferi infection of C57BL/6 WT and Slpi-/- mice. The C57BL/6 WT and Slpi-/- mice were infected with 105 spirochetes subcutaneously. Infection burdens in the skin were assessed by qPCR of B. burgdorferi DNA in ear punch biopsies at 7, 14, and between 21–24-day post-infection (dpi) (Figure 1A–C). Infection burdens in the heart (Figure 1D) and tibiotarsal joint (Figure 1E) tissues were assessed between 21 and 24 dpi. We did not observe any significant difference in infection burden in the skin between WT and Slpi-/- mice (n=24) at 7, 14, 21–24 dpi, or in the heart between 21–24 dpi (Figure 1A–D).

Figure 1. B. burgdorferi burden in C57BL/6 WT and Slpi-/- mice.

Figure 1.

WT and Slpi-/- mice were infected with 105 spirochetes by subcutaneous injection. (A–C) Spirochete burden in skin was assessed by ear punch biopsies at 7 days (A), 14 days (B), and between 21 and 24 days (C) post infection. (D, E) Spirochete burden in tibiotarsal joint and heart tissues was assessed between 21 and 24 days (D, heart, E, joint) post infection. At least n=6 mice were infected in each group. The spirochete burden was measured by qPCR detecting flaB and normalized to mouse β-actin. Each data point represents an individual animal. Representative data are shown from three separate experiments. The error bars represent mean ± SEM, and p-values were calculated using the nonparametric Mann–Whitney test.

Figure 1—source data 1. Source data value for Figure 1A-E.

Strikingly, we observed a significantly higher spirochete burden in the ankle joints of infected Slpi-/- mice (n=24) between 21 and 24 dpi (Figure 1E). Furthermore, at around 24 dpi, significant swelling was also observed solely in the infected Slpi-/- mice (Figure 2A, red arrow). The level of swelling was first scored visually. While 14 out of 20 infected Slpi-/- mice displayed visible swelling (score ≥1), only 1 in 14 infected WT mice displayed mild swelling (score 1) at the ankle (Figure 2B). The tibiotarsal joints were then dissected, fixed, and stained with H&E for histopathological evaluation of the level of inflammation (Figure 2C and D). Inflammation of bursa and soft tissue adjacent to the tibiotarsal joint, but not in the tibiotarsal synovium, was consistently observed in the infected Slpi-/- mice (Figure 2C, black rectangle). In contrast, only 1 out of 14 infected WT mice displayed modest inflammation (score = 2) in these sites (Figure 2D). The above data indicate the importance of SLPI in modulating the development of periarticular inflammation associated with murine Lyme arthritis.

Figure 2. Assessment of ankle inflammation in WT and Slpi-/- mice infected with B. burgdorferi between 21 and 24 dpi.

Figure 2.

(A) Representative images are shown of the tibiotarsal joints of WT and Slpi-/- mice with/without B. burgdorferi infection between 21 and 24 dpi. The swelling is indicated by the red arrow. (B) Swelling of the tibiotarsal joints of individual mice was scored visually by an observer blinded to the experimental groups (scale of 0 [negative] to 3 [severe]). (C) The tibiotarsal joint of each mouse was dissected, fixed, sectioned, and stained with H&E. Representative images from B. burgdorferi-infected C57BL/6 WT and Slpi-/- mice are shown. Lower magnification (left panels, scale bar: 100 μm) and higher magnification (right panels, scale bar: 50 μm) of selected areas (black rectangle) are shown. (D) The severity of periarticular inflammation was scored blindly by the pathologist on a scale of 0 (negative) to 3 (severe). black, PBS-sham infection; red, B. burgdorferi infection. Results from two independent experiments were pooled and shown here. The error bars represent mean ± SEM, and p-values were calculated using the nonparametric Mann–Whitney test.

Figure 2—source data 1. Source data value for Figure 2B and D.

SLPI influences immune responses in B. burgdorferi-infected mice

It has been established that SLPI exerts its anti-inflammatory effect by inhibiting neutrophil serine protease (NSP) and dampening NF-κB activation in macrophages (Moreau et al., 2008). Thus, to investigate the mechanism underlying the effect of SLPI on murine joint inflammation, we sought to identify the population of infiltrating cells in the periarticular tissues of infected WT and Slpi-/- mice. Between 21 and 24 dpi, the ankle joints were dissected. To obtain single-cell suspensions of infiltrating cells, bone marrow cells were removed and discarded and the joint and periarticular tissues were digested (Akitsu and Iwakura, 2016). The cells were stained for flow cytometry with CD45, CD11b, and LY6G to label neutrophils (Figure 3A), and CX3CR1, CD64, and LY6C to label macrophages (Figure 3B; Feng et al., 2023). After gating, we observed significantly higher percentages of infiltrating neutrophils and macrophages in the dissected tissues from infected Slpi-/- than WT mice (Figure 3A and B). To further eliminate the possibility of neutrophilic contamination within the macrophage population, we also implemented a Ly6G-negative gating strategy. The result showed a consistently higher percentage of macrophages in the infected Slpi-/- mice (Figure 3B, Figure 3—figure supplement 1). Using RT-qPCR on the tibiotarsal tissues extracted from B. burgdorferi-infected Slpi-/- mice, we detected increased gene expression of neutrophil chemoattractant receptor C-X-C motif chemokine receptor 2 (Cxcr2), monocyte chemoattractant protein 1 (Mcp-1), and its receptor C-C motif chemokine receptor 2 (Ccr2) (Figure 3C–E).

Figure 3. Immune profile analysis of infected WT and Slpi-/- mice.

(A, B) Infiltrating cell population analysis of tibiotarsal joint tissues of infected WT and Slpi-/- mice. (A) The neutrophil population was gated on the CD11bLY6G double-positive cells among the CD45-positive cells. (B) The macrophage population was gated on the CD64-positive cells among the CX3CR1-positive myeloid cells. Results from two independent experiments were pooled and shown here. (C–E) Expression levels of C-X-C motif chemokine receptor 2 (Cxcr2, C), monocyte chemoattractant protein 1 (Mcp-1, D), and C-C motif chemokine receptor 2 (Ccr2, E) were assessed in the tibiotarsal tissue using RT-qPCR. (F) The serum cytokine profile was assessed using mouse cytokine/chemokine 32-plex array. An increase in IL-6 was observed in the infected Slpi-/- mice. (G, H) The serum level of neutrophil elastase (NE) was measured using an ELISA kit. (I) Serum levels of MMPs were assessed using a mouse MMP 5-Plex Discovery Assay. An increase in MMP-8 was observed in the infected Slpi-/- mice. Serum was obtained by cardiac puncture of WT and Slpi-/- C57BL/6 mice with/without infection between 21 and 24 dpi (F, G, and I) and of infected C3H/HeN mice at 21 dpi (H). black, PBS-sham infection; red, B. burgdorferi infection. Each data point represents an individual animal. The error bar represents mean ± SEM, and p-values were calculated using the nonparametric Mann–Whitney test.

Figure 3—source data 1. Source data value for Figure 3A-I.

Figure 3.

Figure 3—figure supplement 1. The macrophages population analyzed using Ly6G-negative gating strategy.

Figure 3—figure supplement 1.

The macrophage population was first gated on the Ly6G-negative population, then gated on the CD64-positive cells among the CX3CR1-positive myeloid cells. Results from two independent experiments were pooled and shown here. The error bar represents mean ± SEM, and p-values were calculated using the nonparametric Mann–Whitney test.
Figure 3—figure supplement 1—source data 1. Source data for Figure 3-figure supplement 1.
Figure 3—figure supplement 2. Serum and gene expression levels of TNF-α.

Figure 3—figure supplement 2.

(A) The serum level of TNF-α was assessed using a mouse cytokine/chemokine 32-plex array. (B) The gene expression level of Tnf-α was assessed in the tibiotarsal tissue using RT-qPCR. Serum was obtained by cardiac puncture and the tibiotarsal tissue was collected from WT and Slpi-/- C57BL/6 mice with/without B. burgdorferi infection between 21 and 24 dpi. black, PBS-sham infection; red, B. burgdorferi infection. Each data point represents an individual animal. The error bar represents mean ± SEM, and p-values were calculated using the nonparametric Mann–Whitney test.
Figure 3—figure supplement 2—source data 1. Source data for Figure 3-figure supplement 2.

Furthermore, the serum cytokine/chemokine profile was assessed from uninfected and B. burgdorferi-infected WT and Slpi-/- mice between 21 and 24 dpi. We observed a significant increase in IL-6 in infected Slpi-/- mice (Figure 3F). IL-6 recruits and stimulates neutrophils, leading to the secretion of neutrophil-derived serine proteases including neutrophil elastase (NE) and cathepsin G (CTSG) (Srirangan and Choy, 2010). The lack of serine protease inhibitors, such as SLPI, can cause excessive protease activity and subsequent tissue damage and inflammation (Wilkinson et al., 2019). Indeed, using ELISA, we observed a significantly higher level of NE solely in the serum of infected Slpi-/- mice (Figure 3G). An increased serum level of NE was also observed in the B. burgdorferi-infected, arthritis-susceptible C3H/HeN mice at 21 dpi (Figure 3H). These data suggest that, in the absence of SLPI, excessive serine protease activity can exacerbate murine Lyme arthritis.

A correlation between IL-6, macrophages, metalloproteinases (MMPs), and articular cartilage destruction has been observed in the synovial tissue of RA patients (Murphy and Nagase, 2008). Elevated levels of host matrix metalloproteinases (MMPs) have also been found in the synovial fluid of Lyme arthritis patients and can cause excessive tissue damage (Hu et al., 2001). Thus, a mouse MMP 5-Plex Discovery Assay was used to explore the serum levels of different MMPs. We observed a significant increase in the levels of MMP-8 solely in the infected Slpi-/- mice (Figure 3I). Taken together, our data suggest that SLPI suppresses inflammation in B. burgdorferi-infected mouse joint tissues by potentially inhibiting neutrophil and macrophage infiltration and subsequent protease-mediated tissue destruction.

Decreased serum level of SLPI in Lyme disease patients

Despite numerous studies of serum, synovial fluid, and tissue from Lyme arthritis patients, the importance of anti-protease–protease balance in Lyme arthritis has not been investigated (Lochhead et al., 2021). Based on our data obtained from the Slpi-deficient mice, we assessed the serum SLPI level in Lyme disease patients (Figure 4). Due to the limited samples available from Lyme arthritis patients, we included samples from Lyme disease patients who presented with earlier manifestations of Lyme disease. The serum level of human SLPI assessed by ELISA showed a significant decrease in the SLPI level in Lyme disease patients comparing to healthy adult controls (Figure 4). Similar to our data from B. burgdorferi-infected mice, this result suggests a correlation between the lack of SLPI and humans exhibiting clinical manifestations of Lyme disease, including arthritis.

Figure 4. Serum secretory leukocyte protease inhibitor (SLPI) levels in Lyme disease subjects versus healthy controls.

Figure 4.

The serum level of SLPI was measured by ELISA. Sera samples were from five adult healthy controls (HCs). 18 samples were from people with Lyme disease (LD) including 5 samples from three subjects presenting with Lyme arthritis (red) and 13 samples from four subjects with erythema migrans (black). The error bar represents mean ± SEM, and p-values were calculated using the nonparametric Mann–Whitney test.

Figure 4—source data 1. Source data for Figure 4.

SLPI interacts with B. burgdorferi

It has been demonstrated that B. burgdorferi interacts with various mammalian proteins to establish infection in the mammalian host (Gupta et al., 2020; Shi et al., 2008; Li et al., 2006; Koenigs et al., 2013). Thus, we postulated that B. burgdorferi could interact with SLPI to influence the progression of joint inflammation. To test this hypothesis, we probed a recently developed BASEHIT (BActerial Selection to Elucidate Host-microbe Interactions in high Throughput) library with B. burgdorferi (Gupta et al., 2020; Sonnert et al., 2024; Arora et al., 2022; Hart et al., 2024). BASEHIT utilizes a genetically barcoded yeast display library expressing 3324 human exoproteins, thus enabling a comprehensive screen of host–microbe interactions in a high-throughput fashion. Human SLPI is one of the exoproteins that passed the significance threshold, indicating B. burgdorferi-SLPI binding. To further establish that hSLPI directly binds to B. burgdorferi, we performed ELISA with whole-cell B. burgdorferi lysates. We observed strong binding between whole-cell B. burgdorferi lysates and hSLPI at a level as low as 10 nM (Figure 5A).

Figure 5. B. burgdorferi interaction with human and murine secretory leukocyte protease inhibitor (SLPI).

(A) Sandwich ELISA results show the interaction of B. burgdorferi whole-cell lysates with human SLPI. ELISA plates were coated with B. burgdorferi whole-cell lysates and probed with increasing amount of human SLPI (blue) or human Fc proteins (black) as the negative control. The values plotted represent the mean ± SEM of duplicates from two experiments. p-value is displayed in the graph and determined using the nonparametric Mann–Whitney test. (B, C) Flow cytometry histograms show binding of human (B) and murine (C) SLPI to B. burgdorferi cultured at 33°C (solid line) and 37°C (dash line). B. burgdorferi was cultured to a density of 106 /ml. The same volume of cultures was incubated at 33°C or 37°C for 24 h before adding 10 nM (green) or 1 μM (red) human or murine SLPI. The binding was detected with goat anti-human or murine SLPI and donkey anti-goat AF647 or AF488. B. burgdorferi alone (gray) and antibody control (without SLPI, blue) were used as negative controls. (D) Immunofluorescent microscopy was used to directly observe the binding of B. burgdorferi with human and murine SLPI. Merged and single-color images are shown. Representative histograms and fluorescent images are shown from three independent experiments. Scale bar: 10 μm.

Figure 5—source data 1. Source data for Figure 5A.

Figure 5.

Figure 5—figure supplement 1. The binding of human secretory leukocyte protease inhibitor (SLPI) to non-infectious B. burgdorferi B31A and proteinase K-treated B. burgdorferi B31A3.

Figure 5—figure supplement 1.

(A) Flow cytometry histogram shows the lack of binding of human SLPI (1 μM, red) to non-infectious B. burgdorferi B31A. B. burgdorferi alone (gray) and antibody control (without SLPI, blue) were used as negative controls. A representative histogram from two independent experiments is shown. (B) ELISA result shows the interaction between human SLPI and B. burgdorferi B31A3 whole-cell lysates in the presence (blue) or absence (black) of proteinase K. ELISA plates were coated with B. burgdorferi B31A3 whole-cell lysates and probed with increasing amount of human SLPI. The values plotted represent the mean ± SEM of triplicates from one experiment.
Figure 5—figure supplement 1—source data 1. Source data for Figure 5-figure supplement 1B.
Figure 5—figure supplement 2. The effect of human secretory leukocyte protease inhibitor (SLPI) binding on B. burgdorferi viability and antibody-mediated killing.

Figure 5—figure supplement 2.

(A) Human SLPI (hSLPI, 0–10 μM) was incubated with 105 B. burgdorferi at 33°C for 48 h. The viability was assessed by BacTiter Glo microbial cell viability assay. The percent viability was normalized to the control spirochetes culture without hSLPI treatment. Results from one independent experiment performed in triplicate samples are shown here. (B) Human SLPI (hSLPI, 0–5 μM) was incubated with 105 B. burgdorferi at 33°C for 2 h. 20% mouse B. burgdorferi antisera were then added for 2 and 4 h. The viability was measured as described above. The percent viability was normalized to the control spirochetes culture without any treatment. Results from two independent experiments performed in duplicate samples are shown here. The error bar represents mean ± SEM.
Figure 5—figure supplement 2—source data 1. Source data for Figure 5-figure supplement 2A and B.
Figure 5—figure supplement 3. Hoechst 33324 and propidium iodide double staining of B. burgdorferi whole organism with and without fixation.

Figure 5—figure supplement 3.

Immunofluorescent microscopy was used to directly observe the staining of B. burgdorferi. Merged and single-color images are shown. Representative images are shown from two independent experiments. Scale bar: 10 μm.

To extend these studies, flow cytometry was performed using intact B. burgdorferi and both human and murine SLPI. A significant increase in fluorescence intensity was observed when B. burgdorferi, cultivated at 33°C, was incubated with human SLPI at 10 nM and 1 µM level (Figure 5B). Though the binding to 10 nM rmSLPI was at background level, we observed a significant increase in fluorescence intensity when B. burgdorferi were incubated with 1 µM rmSLPI (Figure 5C). Flow cytometry also demonstrated increased binding of B. burgdorferi cultured at 37°C to 1 µM hSLPI or rmSLPI (Figure 5B and C). This indicates that the binding was more robust when performed at temperatures that B. burgdorferi encounter in the mammalian host. Immunofluorescent microscopy was an additional method that also demonstrated direct binding of B. burgdorferi with human or murine SLPI (Figure 5D).

In contrast to B. burgdorferi B31-A3, an infectious strain used throughout this study, we did not observe any binding between hSLPI and B. burgdorferi B31A, a high-passage non-infectious strain (Figure 5—figure supplement 1A; Caine and Coburn, 2015; Elias et al., 2002). The above observation further suggests that the direct interaction between SLPI and B. burgdorferi could impact the pathogenesis of murine Lyme arthritis. To further investigate the potential B. burgdorferi ligand that interacts with SLPI, we probed protease-treated B. burgdorferi lysates with hSLPI using ELISA. After treatment with proteinase K, we observed a marked decrease in binding of hSLPI to B. burgdorferi lysates (Figure 5—figure supplement 1B). This result suggests that hSLPI can directly interact with a B. burgdorferi protein.

It has been showed that SLPI has antimicrobial effects against multiple gram-negative and -positive bacteria (Wiedow et al., 1998; Nishimura et al., 2008; Hiemstra et al., 1996). However, using the BacTiter-Glow microbial cell viability assay, we did not observe any significant changes in B. burgdorferi viability in the presence of hSLPI (Figure 5—figure supplement 2A). A previous study also demonstrated that the tick salivary protein, Salp15, specifically interacted with B. burgdorferi outer surface protein C (OspC) (Ramamoorthi et al., 2005). The binding of Salp15 protected spirochetes from killing by polyclonal mouse or rabbit antisera in vitro (Ramamoorthi et al., 2005; Schuijt et al., 2008). However, again, using the BacTiter-Glow microbial cell viability assay, the pre-incubation of hSLPI did not protect spirochetes from killing by mouse B. burgdorferi antisera (Figure 5—figure supplement 2B). Thus, the importance of the SLPI-B. burgdorferi interaction and the direct effect of such an interaction on B. burgdorferi biology are likely independent of direct borreliacidal activity or any interference with the antibody-mediated B. burgdorferi killing.

Discussion

Lyme arthritis has been extensively documented and studied in patients and B. burgdorferi-infected mice. The pathogenesis of Lyme arthritis is characterized by synovial tissue damage caused by infiltration of immune cells and excessive pro-inflammatory responses (Lochhead et al., 2021). Transcriptomic studies also revealed the suppression of tissue repair genes in the synovial tissue of Lyme arthritis patients and tibiotarsal joint tissues of B. burgdorferi-infected mice (Lochhead et al., 2019a; Crandall et al., 2006). However, the roles of the genes involved in tissue repair have not been studied.

SLPI strongly inhibits serine proteases, especially cathepsin G and elastase secreted by neutrophils (Doumas et al., 2005). The major function of SLPI is to prevent unnecessary tissue damage caused by excessive protease activity, thus promoting tissue repair and homeostasis (Nugteren and Samsom, 2021). The lack of SLPI impairs wound healing and tissue repair (Ashcroft et al., 2000), and SLPI also inhibits NF-κB activation and downstream pro-inflammatory cytokine release from macrophages (Taggart et al., 2005; Jin et al., 1997). Thus, we hypothesized that SLPI plays an important role in Lyme arthritis. To test this hypothesis, we employed Slpi-/- C57BL/6 mice. As C57BL/6 mice only develop mild arthritis, if any, after challenge with B. burgdorferi, this mouse provided an ideal example to study whether the lack of SLPI could cause an arthritis-resistant mouse to become arthritis-susceptible. Compared to WT C57BL/6 mice, B. burgdorferi infection in the Slpi-/- mice consistently showed a significantly higher infection burden in tissues extracted from the ankle joint, which included periarticular structures (Figure 1E). Severe swelling and inflammation in the bursa and soft tissue around tibiotarsal joints were observed solely in the infected Slpi-/- mice (Figure 2). The significant increase in the infection burden in Slpi-/- mice can contribute to the enhanced periarticular inflammation following B. burgdorferi infection. However, these data also suggest the importance of SLPI in controlling the development of inflammation in periarticular tissues of B. burgdorferi-infected mice. Indeed, in a Streptococcal cell wall (SCW)-induced arthritis model in rats, the intraperitoneal injection of SLPI significantly decreased the severity of joint swelling (Song et al., 1999). Targeting the SLPI-associated anti-protease pathways could also potentially be a strategy for ameliorating periarticular inflammation that occurs in some rheumatic diseases.

Analysis of B. burgdorferi infection in the Slpi-/- and WT mice revealed a significant increase in infiltrating neutrophils and macrophages in the periarticular tissues of Slpi-/- mice (Figure 3A and B). This observation is consistent with clinical studies that showed a high percentage of neutrophils in the synovial fluid during active infection (Lochhead et al., 2017; Grillon et al., 2019). In post-infectious Lyme arthritis, fewer neutrophils and more macrophages are present in patients’ synovial fluid (Lochhead et al., 2021). In arthritis-susceptible C3H/He mice, B. burgdorferi infection also leads to neutrophil infiltration in the periarticular tissues as well as in the synovium of ankle joints (Barthold et al., 1993). The neutrophil chemoattractant KC (CXCL1) and receptor CXCR2 mediates neutrophil recruitment and is critical for the development of murine Lyme arthritis. Both Kc-/- and Cxcr2-/- C3H mice developed significantly less ankle swelling when infected with B. burgdorferi (Ritzman et al., 2010; Brown et al., 2003). Consistently, we observed a significant increase in Cxcr2 gene expression in the tibiotarsal joint tissues (Figure 3C), which can recruit neutrophils and cause more severe inflammatory soft-tissue infiltrates in the Slpi-/- mice. Monocyte chemoattractant protein-1 (MCP-1/CCL2) and receptor CCR2 contribute to macrophage infiltration (Deshmane et al., 2009). Though little to no difference in arthritis was observed in the Ccr2-/- mice, a high level of MCP-1 was detected in the tibiotarsal tissues of B. burgdorferi-infected, arthritis-susceptible C3H/He mice, suggesting a function for macrophages (Brown et al., 2003). In the infected Slpi-/- mice, a significant increase in both Mcp-1 and Ccr2 gene expression was observed in the tibiotarsal tissues (Figure 3D and E). Our data suggest that both neutrophils and macrophages contribute to the severe periarticular inflammation in the B. burgdorferi-infected Slpi-/- mice.

To investigate the underlying mechanism whereby SLPI deficiency enhanced periarticular joint inflammation, we examined the serum cytokine/chemokine profile of B. burgdorferi-infected Slpi-/- and WT mice. There was a significant increase in IL-6 solely in the infected Slpi-/- mice (Figure 3F). An elevated IL-6 level has been demonstrated in the serum, synovial fluid, and synovial tissue from Lyme arthritis patients (Lochhead et al., 2019b; Lochhead et al., 2017). IL-6 is also pivotal in the pathogenesis of rheumatoid arthritis and correlates with the disease severity and joint destruction (Srirangan and Choy, 2010). It has been shown that IL-6 recruited neutrophils in an in vitro co-culture rheumatoid arthritis model (Lally et al., 2005). Neutrophils can be activated by IL-6 through binding of IL-6 receptor (IL-6R) (Srirangan and Choy, 2010). Activated neutrophils release several NSPs including neutrophil elastase (NE), cathepsin G (CTSG), and proteinase-3 (PR3), which can lead to potent cartilage destruction (Wilkinson et al., 2019). Indeed, we observed a significant increase in the NE level in the serum of B. burgdorferi-infected Slpi-/- but not WT mice (Figure 3G). In the arthritis-susceptible C3H/HeN mice, B. burgdorferi infection also induced a significant increase in the serum NE level (Figure 3H). Interestingly, despite the known function of TNF-α in inflammatory responses, we did not observe any significant changes in either TNF-α serum protein levels or Tnf-α gene expression levels in the B. burgdorferi-infected Slpi-/- and WT mice (Figure 3—figure supplement 2). The result is consistent with previous microarray data that did not show significant changes in TNF-α levels in the C57BL/6 mice following B. burgdorferi infection (Crandall et al., 2006). The above data indicate that the excessive serum neutrophil elastase contributed to the periarticular inflammation in the B. burgdorferi-infected Slpi-/- mice.

MMPs target extracellular matrix and cause articular cartilage destruction (Grillet et al., 2023). A correlation between IL-6 and MMPs expression has been reported in the context of rheumatoid arthritis (Murphy and Nagase, 2008; Chang et al., 2008). Elevated levels of several MMPs have also been found in the synovial fluid of Lyme arthritis patients (Hu et al., 2001). Thus, we also investigated the MMPs profile in the B. burgdorferi-infected Slpi-/- and WT mice. We observed a significant increase in the serum level of MMP-8 in the infected Slpi-/- mice (Figure 3I). MMP-8 is known as neutrophil collagenase (Wen et al., 2015). Using synovial fluid samples, it has been reported that the level of MMP-8 was significantly higher in the patients with post-infectious Lyme arthritis than patients with active infection (Lin et al., 2001). A comprehensive examination of the MMP profile in the synovial fluid of Lyme arthritis patients revealed elevated levels of MMP-1, -3, -13, and -19 (Behera et al., 2005). B. burgdorferi infection induced MMP-3 and MMP-19 in the C3H/HeN mice but not in the Lyme arthritis-resistant C57BL/6 mice (Behera et al., 2005). The differences in the MMP profiles provide an explanation for the differences between human and murine Lyme arthritis. This finding further emphasizes that excessive protease activity can contribute to the severity of periarticular inflammation in B. burgdorferi-infected mice.

Previous research using serum, synovial fluid, and tissue from Lyme arthritis patients has been heavily focusing on innate and adaptive immune responses (Lochhead et al., 2021). As a result, limited data can be found regarding anti-protease and protease responses during Lyme arthritis in human patients. In this study, we tested serum SLPI level in five healthy subjects, eight Lyme disease patients, three of whom had overt arthritis. Though the number of healthy subjects is small, the median level of SLPI tested here (38.92 ng/ml, Figure 4) is comparable with previous studies showing in average about 40 ng/ml SLPI in the serum from healthy volunteers (Zakrzewicz et al., 2019; Grobmyer et al., 2000). While the clinical manifestation of five of the patients with Lyme disease was an EM skin lesion (Supplementary file 1), some symptoms persisted several months after diagnosis, a timeframe when acute arthritis often develops. We observed decreased SLPI in the serum of these patients (Figure 4), suggesting an inverse relationship between the SLPI level and B. burgdorferi infection. However, a large number of sera and synovial fluid samples from Lyme arthritis patients and other clinical manifestations of Lyme disease are needed to establish a definitive association.

B. burgdorferi first infects the skin of a vertebrate host following a tick bite, then disseminates throughout the body, colonizes various tissue, evades immune responses, and persists for a significant period of time. To survive the above processes, B. burgdorferi interacts with various mammalian proteins, including decorin (Shi et al., 2008), fibronectin (Li et al., 2006), and plasminogen (Koenigs et al., 2013), among others. To comprehensively study the potential interaction between B. burgdorferi and the host, our lab employed the BASEHIT to assess the interactions between B. burgdorferi and 3336 human extracellular and secreted proteins (Sonnert et al., 2024; Hart et al., 2024). Using BASEHIT, our lab previously identified a strong interaction between B. burgdorferi and Peptidoglycan Recognition Protein 1 (PGYRP1) (Gupta et al., 2020). Increased infection burden in the heart and joint was observed in the mice lacking PGYRP1, suggesting a role of PGYRP1 in the host response to B. burgdorferi infection. Expanding the use of BASEHIT, CD55 was identified to bind Borrelia crocidurae and Borrelia persica, two pathogens causing relapsing fever (Arora et al., 2022). CD55-deficient mice infected with B. crocidurae displayed lower pathogen load and elevated pro-inflammatory cytokines. The above data demonstrate BASEHIT as an effective method to identify host factors important in B. burgdorferi pathogenesis in vivo. In this study, we identified an interaction between SLPI and B. burgdorferi using BASEHIT library screening and subsequent flow cytometric analysis (Figure 5). The antimicrobial activity of SLPI has been demonstrated against both gram-negative and -positive bacteria, including Escherichia coli, Pseudomonas aeruginosa (Wiedow et al., 1998), Mycobacteria tuberculosis (Nishimura et al., 2008), Staphylococcus aureus (Hiemstra et al., 1996), and Staphylococcus epidermidis (Wiedow et al., 1998). Interaction between the positive charges of SLPI and the negative charges of bacteria surface, including lipopolysaccharide (LPS), can destabilize bacteria cell wall leading to the bactericidal effect (Tarhini et al., 2018). B. burgdorferi do not have LPS (Takayama et al., 1987), and this may account for the absence of the bactericidal effect of SLPI against B. burgdorferi (Figure 5—figure supplement 2A). Future research is needed to understand the significance of the SLPI-B. burgdorferi binding in the development of periarticular inflammation. The potential B. burgdorferi protein that interact with SLPI remains unknown. It is our hypothesis that SLPI may bind and inhibit an unknown B. burgdorferi virulence factor that could contribute to the development of murine Lyme arthritis.

In conclusion, our data demonstrated the importance of SLPI in suppressing B. burgdorferi-induced periarticular inflammation in mice by inhibiting recruitment of neutrophils and macrophages and subsequent protease levels. We propose that, during the active infection of the murine joint structures, the binding of B. burgdorferi with SLPI depletes the local environment of SLPI. Such binding is specific to the infectious strain of B. burgdorferi. As a potent anti-protease, the decrease in SLPI results in excessive protease activity, including neutrophil elastase and MMP-8. These unchecked proteases can lead to extensive tissue inflammation. Our study is the first to emphasize the importance of an anti-protease–protease balance in the development of the periarticular inflammation seen in B. burgdorferi-infected mice.

Materials and methods

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (Borrelia burgdorferi) B31-A3 Dr. Utpal Pal’s laboratory N/A See ‘Materials and methods’, ‘B. burgdorferi culture’
Strain, strain background (B. burgdorferi) B31-A This paper N/A See ‘Materials and methods’, ‘B. burgdorferi culture’
Strain, strain background (Escherichia coli) Rosetta-gami 2 (DE3) Novagen Cat#71351 Electrocompetent cells
Strain, strain background (Mus musculus) SLPI-/- Dr. Akira Nakamura’s laboratory (Takayama et al., 1987; Bernard et al., 2018) N/A https://doi.org/10.3389/fimmu.2017.01538
https://doi.org/10.1084/jem.20021824
Strain, strain background (M. musculus) C3H/HeN Charles River Laboratories N/A
Strain, strain background (M. musculus) C57BL/6 Jackson Laboratory Stock #: 000664
RRID:IMSR_JAX:000664
Biological samples (M. musculus) Mouse tibiotarsal tissue This paper N/A Freshly isolated from Mus musculus
Antibody TruStain FcX anti-mouse CD16/32 BioLegend Cat#101320
RRID:AB_1574975
Flow cytometry (1 μl per test)
Antibody PerCP anti-mouse CD45 BioLegend Cat#103130
RRID:AB_893339
Flow cytometry (1 μl per test)
Antibody BV711 anti-mouse Ly6G BioLegend Cat#127643
RRID:AB_2565971
Flow cytometry (1 μl per test)
Antibody PE anti-mouse CD11b BioLegend Cat#101208
RRID:AB_312791
Flow cytometry (1 μl per test)
Antibody APC/CY7 anti-mouse CX3CR21 BioLegend Cat#149047
RRID:AB_2892303
Flow cytometry (1 μl per test)
Antibody FITC anti-mouse Ly6C BioLegend Cat#128005
RRID:AB_1186134
Flow cytometry (1 μl per test)
Antibody APC anti-mouse CD64 BioLegend Cat#139305
RRID:AB_11219205
Flow cytometry (1 μl per test)
Antibody Goat anti-human SLPI R&D Systems Cat#AF1274
RRID:AB_2302508
Flow cytometry (1 μl per test)
Antibody Goat anti-murine SLPI R&D Systems Cat#AF1735
RRID:AB_2195050
Flow cytometry (1 μl per test)
Antibody Alexa Fluor 488 donkey anti-goat IgG (H+L) Invitrogen Cat#A32814
RRID:AB_2762838
Flow cytometry (1 μl per test)
Antibody Alexa Fluor 647 donkey anti-goat IgG (H+L) Invitrogen Cat#A-21447
RRID:AB_2535864
Flow cytometry (1 μl per test)
Recombinant DNA reagent Murine SLPI cDNA ORF clone (plasmid) GenScript OMu22721
Recombinant DNA reagent pET-22b (+) (plasmid) Novagen Cat#69744-3
Sequence-based reagent Mouse β-actin-F This paper PCR primers AGCGGGAAATCGTGCGTG
Sequence-based reagent Mouse β-actin-R This paper PCR primers CAGGGTACATGGTGGTGCC
Sequence-based reagent Borrelia flab-F This paper PCR primers TTCAATCAGGTAACGGCACA
Sequence-based reagent Borrelia flab-R This paper PCR primers GACGCRRGAGACCCTGAAAG
Sequence-based reagent Mouse Mcp1-F This paper PCR primers GTTGGCTCAGCCAGATGCA
Sequence-based reagent Mouse Mcp1-R This paper PCR primers AGCCTACTCATTGGGATCATCTTG
Sequence-based reagent Mouse Ccr2-F This paper PCR primers AGTAACTGTGTGGATTGACAAGCACTTAGA
Sequence-based reagent Mouse Ccr2-R This paper PCR primers CAACAAAGGCATAAATGACAGGAT
Sequence-based reagent Mouse Cxcr2-F This paper PCR primers CACCCTCTTTAAGGCCCACAT
Sequence-based reagent Mouse Cxcr2-R This paper PCR primers ACAAGGACGACAGCGAAGATG
Peptide, recombinant protein human SLPI R&D Systems Cat#1274-PI-100
Commercial assay or kit LIVE/DEADfixable violet stain kit Invitrogen Cat#L34955
Commercial assay or kit DNeasy Blood & Tissue Kit QIAGEN Cat#69504
Commercial assay or kit iScript cDNA Synthesis Kit Bio-Rad Cat#1708891
Commercial assay or kit Gibson Assembly Kit NEB Cat#E5510
Commercial assay or kit Mouse Neutrophil Elastase/ELA2 DuoSet ELISA R&D Systems Cat#DY4517-05
Commercial assay or kit Human SLPI DuoSet ELISA R&D Systems Cat#DY1274-05
Commercial assay or kit BacTiter-Glo Microbial Cell Viability Assay kit Promega Cat#G8230
Commercial assay or kit Mouse MMP 5-Plex Discovery Assay Array (MDMMP-S, P) Eve Technologies N/A
Commercial assay or kit Mouse Cytokine/Chemokine 32-Plex Discovery Assay Array (MD32) Eve Technologies N/A
Chemical compound, drug iQ SYBR Green Supermix Bio-Rad Cat#1725124
Chemical compound, drug Barbour-Stoenner-Kelly H (BSK-H) complete medium Sigma-Aldrich Cat#B8291
Chemical compound, drug Bouin’s solution Sigma-Aldrich Cat#HT10132
Chemical compound, drug Hyaluronidase Sigma-Aldrich Cat#H3506
Chemical compound, drug Collagenase Sigma-Aldrich Cat#C2139
Chemical compound, drug ACK Lysing buffer Gibco Cat#A1049201
Chemical compound, drug Trizol Invitrogen Cat#15596-018
Chemical compound, drug Mca-RPKPVE-Nval-WRK(Dnp)-NH2 Fluorogenic MMP Substrate R&D Systems Cat#ES002
Chemical compound, drug BugBuster Protein Extraction Reagent Novagen Cat#70921-3
Chemical compound, drug Proteinase K Thermo Scientific Cat#EO0491
Chemical compound, drug Ni-NTA agarose QIAGEN Cat#30230
Chemical compound, drug KPL Sureblue TMB Microwell Peroxidase substrate, 1-component Seracare Cat#5120-0077
Chemical compound, drug KPL TMB stop solution Seracare Cat#5150-0021
Chemical compound, drug Hoechst 33342 Invitrogen Cat#H1399
Chemical compound, drug RPMI 1640 Gibco Cat#11875-093
Software, algorithm Prism GraphPad RRID:SCR_002798
Software, algorithm FlowJo BD Biosciences https://www.flowjo.com/

Sex as a biological variable

Females Slpi-/- and WT C57BL/6 mice were used for the in vivo B. burgdorferi infection. We have examined B. burgdorferi infection in both male and female C57BL/6 mice, and no differences in the development of infection or disease have been noted. Both male and female Lyme disease patients were included in the study. Sex was not considered a biological variable.

Study approval

This study used archived serum samples from adult Lyme disease subjects and healthy controls that were previously collected under NIH U19AI089992 with approval of the Yale University Institutional Review Board for human subjects research (IRB protocol# 1112009475). All the animal experiments in this study were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of the National Institutes of Health. The animal protocol (2023-07941) was approved by the Institutional Animal Care and Use Committee at the Yale University School of Medicine.

Measurement of serum SLPI levels in Lyme disease subjects and controls

SLPI levels were measured in a total of 23 serum samples from seven subjects at the time of Lyme disease diagnosis (four with a single erythema migrans lesion and three with the late manifestation of Lyme arthritis) and from five healthy controls. Serum samples from Lyme disease subjects were available at up to three times points: (1) study entry, range 0–9 days after onset of symptoms; (2) 30 days post diagnosis; and (3) up to 3 months after the completion of antibiotic therapy (range 4.5–6 months after diagnosis). Additional details can be found in Supplementary file 1. The level of SLPI in the serum was measured using the Human SLPI DuoSet ELISA kit (R&D Systems, #DY1274-05).

B. burgdorferi culture

B. burgdorferi B31-A3, an infectious clonal derivative of the sequenced strain B31, was a generous gift from Dr. Utpal Pal at the Department of Veterinary Medicine, University of Maryland, College Park (Bernard et al., 2018). B. burgdorferi B31-A3 and B. burgdorferi B31A were grown in Barbour-Stoenner-Kelly H (BSK-H) complete medium (Sigma-Aldrich, #B8291) in a 33°C setting incubator. The live cell density was determined by dark field microscopy and using a hemocytometer (INCYTO, #DHC-N01). Low-passage (p<3) B. burgdorferi B31-A3 was used throughout this study.

In vivo infection of mice

The Slpi-/- C57BL/6 mice have been described previously (Matsuba et al., 2017; Nakamura et al., 2003). The wild-type (WT) C57BL/6 mice were purchased from the Jackson Laboratory and used as the controls. 5–7-week-old female WT and Slpi-/- C57BL/6 mice were used for infection. 4–6-week-old female C3H/HeN mice were purchased from Charles River Laboratories and used for infection. Both C57BL/6 and C3H/HeN mice were infected with low-passage 105 B. burgdorferi subcutaneously (5–9 mice/group). PBS sham-infected mice were used as controls. Mice were euthanized approximately 3 weeks post infection within a 3-day window (between 21 and 24 dpi) based on the feasibility and logistics of the laboratory. Ear punch biopsies were taken at 7, 14, and between 21–24 dpi to determine the infection burden in the skin. Between 21 and 24 dpi, mice were euthanized, and heart and joint tissues were collected to quantify the spirochete burden. The protocol for the use of mice was reviewed and approved by the Yale Animal Care and Use Committee.

Quantification of Borrelia burden

DNA was extracted from the heart, tibiotarsal joint, and ear punch samples using QIAGEN DNeasy Blood & Tissue Kit, QIAGEN. Quantitative PCR was performed using iQ-SYBR Green Supermix (Bio-Rad). For quantitative detection of B. burgdorferi burden within mouse tissue samples, q-PCR was performed with DNA using flagellin (flaB), a marker gene for Borrelia detection. The mouse β-actin gene was used to normalize the amount of DNA in each sample. The nucleotide sequences of the primers used in specific PCR applications were described previously (Gupta et al., 2020).

Joint histopathology analysis

Mice were euthanized by CO2 asphyxiation, and one rear leg from each mouse was dissected, immersion-fixed in Bouin’s solution (Sigma-Aldrich, #HT10132). Fixed tissues were embedded, sectioned, and stained with H&E by routine methods (Comparative Pathology Research Core in the Department of Comparative Medicine, Yale School of Medicine). Periarticular and joint inflammation was scored in a blinded fashion in a graded manner from 0 (negative), 1 (minimal), 2 (moderate), to 3 (severe).

Flow cytometry to quantify infiltrating cells in joint tissues in mice

The WT and Slpi-/- C57BL/6 mice were infected with B. burgdorferi as described above. The mice were euthanized between 21 and 24 dpi. The ankle joints were cut out at around 0.7 cm proximal to the ankle joint. The portion distal to the midfoot was discarded, and the skin removed. The bone marrow cells were flushed out with RPMI 1640 (Gibco, #11875-093) using a 27-gauge needle. The bone marrow-depleted ankles were cut into 3–4-mm-sized tissue pieces and incubated with digestion media containing 2.4 mg/ml hyaluronidase (Sigma-Aldrich, #H3506), 1 mg/ml collagenase (Sigma-Aldrich, #C2139) in RPMI 1640 (Gibco, #11875-093) supplemented with 10% fetal bovine serum (FBS) for 1 h at 37°C with 5% CO2. The digestion media containing the tissue pieces were passed through a 70 μm cell strainer (Thermo Scientific, #352350). The remaining tissue pieces were mashed using a 10 ml syringe plunger. The digestion media containing the isolated cells were neutralized with RPMI 1640 with 10% FBS (Akitsu and Iwakura, 2016). The red blood cells were lysed by ACK Lysing buffer (Gibco, #A1049201). The cells were rinsed and resuspended in FACS buffer and ready for staining for flow cytometry.

The cells were incubated with Fc receptor antibody TruStain FcX anti-mouse CD16/32; BioLegend, #101320, and antibodies including PerCP anti-mouse CD45 (BioLegend, #103130), BV711 anti-mouse Ly6G (BioLegend, #127643), PE anti-mouse CD11b (BioLegend, #101208), APC/CY7 anti-mouse CX3CR21 (BioLegend, #149047), FITC anti-mouse Ly6C (BioLegend, #128005), APC anti-mouse CD64 (BioLegend, #139305), and LIVE/DEAD fixable violet stain kit (Invitrogen, #L34955) on ice for 30 min. The samples were rinsed twice with FACS buffer and run through BD LSRII (BD Biosciences). The data was then analyzed using FlowJo (Feng et al., 2023).

Gene expression evaluation by quantitative real-time PCR

Mice were euthanized between 21 and 24 dpi. The ankle joints were excised as described above, snap-frozen in liquid nitrogen, and stored at −80°C. The frozen tissue was pulverized in liquid nitrogen using a mortar and pestle (Wilson et al., 2021). The RNA was purified using Trizol (Invitrogen, #15596-018) following a published protocol (Zheng and McAlinden, 2021). cDNA was synthesized using the iScript cDNA Synthesis Kits (Bio-Rad, #1708891). qPCR was performed using iQ SYBR Green Supermix (Bio-Rad, #1725124). The relative expression of each target gene was normalized to the mouse β-actin gene. The target genes and corresponding primer sequences are shown in the Key Resources Table.

Murine neutrophil elastase, cytokine, chemokine, and MMP profile

Blood samples from each group of mice was collected by cardiac puncture between 21 and 24 dpi, and sera were collected. The murine neutrophil elastase level was measured using the Mouse Neutrophil Elastase/ELA2 DuoSet ELISA (R&D Systems, #DY4517-05). Serum was sent for cytokine analysis by the Mouse Cytokine/Chemokine 32-Plex Discovery Assay Array (MD32) and the Mouse MMP 5-Plex Discovery Assay Array (MDMMP-S, P) performed by Eve Technologies. The cytokines and chemokines represented by MD32 are Eotaxin, G-CSF, GM-CSF, IFN-γ, IL-1α, IL-1β, IL-2, IL-3, IL-4, IL-5,IL-6, IL-7, IL-9, IL-10, IL-12 (p40), IL-12 (p70), IL-13, IL-15, IL-17A, IP-10, KC, LIF, LIX, MCP-1, M-CSF, MIG, MIP-1α, MIP-1β, MIP-2, RANTES, TNFα, and VEGF. The MMPs represented by MDMMP-S, P are MMP-2, MMP-3, MMP-8, proMMP-9, and MMP-12.

Purification of recombinant murine SLPI

The murine Slpi cDNA ORF clone was purchased from GenScript (OMu22721). The coding sequence was subsequently cloned into pET22b(+) expression vector (Novagen) in frame with the pelB signal peptide using Gibson Assembly (Maffia et al., 2007). E. coli strain Rosetta-gami 2 (DE3) (Novagen, #71351) was transformed with the SLPI-pET22b+ and grown at 37°C with ampicillin (100 μg/ml), tetracycline (12.5 μg/ml), streptomycin (50 μg/ml), and chloramphenicol (34 μg/ml). Cells were induced with 1 mM IPTG (18°C, overnight), harvested, and lysed with BugBuster Protein Extraction Reagent (Novagen, #70921-3). Recombinant mSLPI was purified with a Ni-NTA resin column as described by the manufacturer (QIAGEN). To evaluate the activity of the purified rmSLPI, the trypsin inhibitory activity was assayed with the fluorescent substrate Mca-RPKPVE-Nval-WRK(Dnp)-NH2 Fluorogenic MMP Substrate (R&D Systems, #ES002) and the absorbance was monitored at 405 nm using a fluorescent plate reader (Tecan).

Flow cytometry to validate B. burgdorferi-SLPI binding

Actively growing low-passage B. burgdorferi was cultured to a density of 106–107 cells/ml and harvested at 10,000 × g for 10 min. Cells were rinsed twice with PBS and blocked in 1% BSA for 1 h at 4°C. The cells were pelleted, rinsed, resuspended, and incubated with 10 nM and 1 µM human SLPI (R&D Systems, #1274-PI-100) and murine SLPI (produced in lab as described above) at 4°C for 2 h. The binding was detected with goat anti-human or murine SLPI (R&D Systems, #AF1274 and AF1735) and Alexa Fluor 488 or Alexa Fluor 647 donkey anti-goat IgG (H+L) (Invitrogen, #A32814, A-21447). The samples were fixed with 2% PFA before running through BD LSRII Green (BD Biosciences). The data was then analyzed using FlowJo. The integrity of B. burgdorferi organism was confirmed by Hoechst 33324/propidium iodide double staining (Figure 5—figure supplement 3). The fixed B. burgdorferi sample was included as a positive control for the propidium iodide staining. Permeabilization was not performed during this protocol. Thus, the binding detected was on the bacterial outer surface.

ELISA to validate B. burgdorferi-SLPI binding

B. burgdorferi was cultured to a density of 106–107 cells/ml and harvested at 10,000 × g for 10 min. To make the B. burgdorferi lysate, cells were rinsed twice with PBS, pelleted, and lysed using BugBuster Protein Extraction Reagent (Novagen, #70921-3). Protein concentration in the lysate was measured by absorbance at 280 nm using the nanodrop (Fisher Scientific). For the protease assay, the B. burgdorferi lysate was incubated in the presence or absence of proteinase K (0.2 mg/ml, Thermo Scientific, #EO0491) for 10 min. In an immuno 96-well plate (MaxiSorp), wells were coated with 200 ng of B. burgdorferi lysate. Samples were blocked with 1% BSA followed by incubation with human SLPI at varying concentrations (1–1000 ng) for 1 h at room temperature. The binding was probed with goat anti-human SLPI (R&D Systems, #AF1274) and rabbit anti-goat IgG (whole molecule)-peroxidases antibody (Sigma-Aldrich, #A8919-2ML). KPL Sureblue TMB Microwell Peroxidase substrate, 1-component (Seracare, #5120-0077) was used. The reaction was stopped with KPL TMB stop solution (Seracare, #5150-0021), and absorbance was read at 450 nm.

Immunofluorescence assay

Actively growing low-passage B. burgdorferi was cultured to a density of 106–107 cells/ml, rinsed twice with PBS, and blocked with 1% BSA for 1 h at 4°C. B. burgdorferi was incubated with human or murine SLPI at 4°C for 2 h. The spirochetes were probed with goat anti-human or murine SLPI (R&D Systems, #AF1274 and AF1735) and Alexa Fluor 488 donkey anti-goat IgG (H+L) (Invitrogen, #A32814). B. burgdorferi were then stained with Hoechst 33342 (Invitrogen, #H1399). The samples were fixed with 2% PFA before imaged with Leica SP8. The integrity of B. burgdorferi organism is confirmed in Figure 5—figure supplement 3. Permeabilization was not performed during this protocol. Thus, the binding detected was on the bacterial outer surface.

BacTiter Glo microbial cell viability assay to quantify B. burgdorferi viability

The BacTiter Glo microbial cell viability assay quantifies the ATP present in the microbial culture by measuring luminescence. The amount of ATP is proportional to the number of viable cells in culture (Gupta et al., 2020; Arora et al., 2022; Schwendinger et al., 2013). To test the borreliacidal activity of human SLPI, 1 × 105 spirochetes were treated with 0–10 μM hSLPI (R&D Systems, #1274-PI-100) at 33°C for 48 h. The luminescence was measured using a fluorescence plate reader (Tecan). The percent viability was normalized to the control spirochetes culture without hSLPI treatment. To test the effect of hSLPI on the antibody-mediated B. burgdorferi killing, 1 × 105 spirochetes were pretreated with 0–5 μM hSLPI (R&D Systems, #1274-PI-100) at 33°C for 2 h. 20% mouse B. burgdorferi antisera were then added and incubated for 2 and 4 h. The mouse antisera were collected from B. burgdorferi-infected mice between 21 and 24 dpi. The luminescence was measured as described above. The percent viability was normalized to the control spirochetes culture without any treatment.

Statistical analysis

The analysis of all data was performed using the nonparametric Mann–Whitney or ANOVA using Prism 10 software (GraphPad Software, Inc, San Diego, CA). A p-value of <0.05 was considered statistically significant.

Acknowledgements

We are grateful to Dr. Narasimhan for her input and suggestions during experiment design, and to Dr. Ming-Jie Wu for his assistance in conducting experiments. We are grateful to Ms. Ming Li for her effort in preparing human sera samples. This work was supported by NIH grants AI165499 and AI138949, the Steven and Alexandra Cohen Foundation, and the Howard Hughes Medical Institute Emerging Pathogens Initiative.

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Qian Yu, Email: qian.yu@yale.edu.

Huihui Li, Icahn School of Medicine at Mount Sinai, United States.

Dominique Soldati-Favre, University of Geneva, Switzerland.

Funding Information

This paper was supported by the following grants:

  • National Institute of Allergy and Infectious Diseases AI165499 to Erol Fikrig.

  • National Institute of Allergy and Infectious Diseases AI138949 to Erol Fikrig.

  • Steven and Alexandra Cohen Foundation to Qian Yu, Xiaotian Tang, Thomas Hart, Erol Fikrig.

  • Howard Hughes Medical Institute Emerging Pathogens Initiative to Qian Yu, Xiaotian Tang, Thomas Hart, Erol Fikrig.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing – original draft, Writing – review and editing.

Conceptualization, Data curation, Investigation, Methodology, Writing – review and editing.

Conceptualization, Resources, Formal analysis, Investigation, Methodology.

Data curation, Visualization.

Resources, Writing – original draft, Writing – review and editing.

Resources, Writing – original draft, Writing – review and editing.

Resources, Methodology.

Resources, Methodology.

Conceptualization, Resources, Data curation, Supervision, Funding acquisition, Investigation, Methodology, Writing – original draft, Project administration, Writing – review and editing.

Ethics

This study used archived serum samples from adult Lyme disease subjects and healthy controls that were previously collected under NIH U19AI089992 with approval of the Yale University Institutional Review Board for human subjects research (IRB protocol# 1112009475).

All the animal experiments in this study were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of the National Institutes of Health. The animal protocol (2023-07941) was approved by the Institutional Animal Care and Use Committee at the Yale University School of Medicine.

Additional files

Supplementary file 1. Subject characterization.
elife-104913-supp1.docx (16.4KB, docx)
MDAR checklist

Data availability

All data generated or analyzed in this study are included in the manuscript and the supplementary files.

References

  1. Akitsu A, Iwakura Y. Isolation of Joint-infiltrating Cells. BIO-PROTOCOL. 2016;6:e1911. doi: 10.21769/BioProtoc.1911. [DOI] [Google Scholar]
  2. Anguita J, Barthold SW, Persinski R, Hedrick MN, Huy CA, Davis RJ, Flavell RA, Fikrig E. Murine Lyme arthritis development mediated by p38 mitogen-activated protein kinase activity. Journal of Immunology. 2002;168:6352–6357. doi: 10.4049/jimmunol.168.12.6352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Arora G, Lynn GE, Tang X, Rosen CE, Hoornstra D, Sajid A, Hovius JW, Palm NW, Ring AM, Fikrig E. CD55 facilitates immune evasion by borrelia crocidurae, an agent of relapsing fever. mBio. 2022;13:e0116122. doi: 10.1128/mbio.01161-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Arvikar SL, Steere AC. Lyme Arthritis. Infectious Disease Clinics of North America. 2022;36:563–577. doi: 10.1016/j.idc.2022.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Ashcroft GS, Lei K, Jin W, Longenecker G, Kulkarni AB, Greenwell-Wild T, Hale-Donze H, McGrady G, Song XY, Wahl SM. Secretory leukocyte protease inhibitor mediates non-redundant functions necessary for normal wound healing. Nature Medicine. 2000;6:1147–1153. doi: 10.1038/80489. [DOI] [PubMed] [Google Scholar]
  6. Barthold SW, Beck DS, Hansen GM, Terwilliger GA, Moody KD. Lyme borreliosis in selected strains and ages of laboratory mice. The Journal of Infectious Diseases. 1990;162:133–138. doi: 10.1093/infdis/162.1.133. [DOI] [PubMed] [Google Scholar]
  7. Barthold SW, de Souza MS, Janotka JL, Smith AL, Persing DH. Chronic Lyme borreliosis in the laboratory mouse. The American Journal of Pathology. 1993;143:959–971. [PMC free article] [PubMed] [Google Scholar]
  8. Behera AK, Hildebrand E, Scagliotti J, Steere AC, Hu LT. Induction of host matrix metalloproteinases by Borrelia burgdorferi differs in human and murine lyme arthritis. Infection and Immunity. 2005;73:126–134. doi: 10.1128/IAI.73.1.126-134.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Bernard Q, Smith AA, Yang X, Koci J, Foor SD, Cramer SD, Zhuang X, Dwyer JE, Lin YP, Mongodin EF, Marques A, Leong JM, Anguita J, Pal U. Plasticity in early immune evasion strategies of a bacterial pathogen. PNAS. 2018;115:E3788–E3797. doi: 10.1073/pnas.1718595115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Brown CR, Reiner SL. Genetic control of experimental lyme arthritis in the absence of specific immunity. Infection and Immunity. 1999;67:1967–1973. doi: 10.1128/IAI.67.4.1967-1973.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Brown CR, Blaho VA, Loiacono CM. Susceptibility to experimental Lyme arthritis correlates with KC and monocyte chemoattractant protein-1 production in joints and requires neutrophil recruitment via CXCR2. Journal of Immunology. 2003;171:893–901. doi: 10.4049/jimmunol.171.2.893. [DOI] [PubMed] [Google Scholar]
  12. Caine JA, Coburn J. A short-term Borrelia burgdorferi infection model identifies tissue tropisms and bloodstream survival conferred by adhesion proteins. Infection and Immunity. 2015;83:3184–3194. doi: 10.1128/IAI.00349-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Chang YH, Lin IL, Tsay GJ, Yang SC, Yang TP, Ho KT, Hsu TC, Shiau MY. Elevated circulatory MMP-2 and MMP-9 levels and activities in patients with rheumatoid arthritis and systemic lupus erythematosus. Clinical Biochemistry. 2008;41:955–959. doi: 10.1016/j.clinbiochem.2008.04.012. [DOI] [PubMed] [Google Scholar]
  14. Crandall H, Dunn DM, Ma Y, Wooten RM, Zachary JF, Weis JH, Weiss RB, Weis JJ. Gene expression profiling reveals unique pathways associated with differential severity of lyme arthritis. Journal of Immunology. 2006;177:7930–7942. doi: 10.4049/jimmunol.177.11.7930. [DOI] [PubMed] [Google Scholar]
  15. Deshmane SL, Kremlev S, Amini S, Sawaya BE. Monocyte chemoattractant protein-1 (MCP-1): an overview. Journal of Interferon & Cytokine Research. 2009;29:313–326. doi: 10.1089/jir.2008.0027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Doumas S, Kolokotronis A, Stefanopoulos P. Anti-inflammatory and antimicrobial roles of secretory leukocyte protease inhibitor. Infection and Immunity. 2005;73:1271–1274. doi: 10.1128/IAI.73.3.1271-1274.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Elias AF, Stewart PE, Grimm D, Caimano MJ, Eggers CH, Tilly K, Bono JL, Akins DR, Radolf JD, Schwan TG, Rosa P. Clonal polymorphism of Borrelia burgdorferi strain B31 MI: implications for mutagenesis in an infectious strain background. Infection and Immunity. 2002;70:2139–2150. doi: 10.1128/IAI.70.4.2139-2150.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Feng G, Zhu C, Lin CY, Bredemeyer A, Förster I, Kreisel D, Lavine KJ. CCL17 protects against viral myocarditis by suppressing the recruitment of regulatory T cells. Journal of the American Heart Association. 2023;12:e028442. doi: 10.1161/JAHA.122.028442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Grillet B, Pereira RVS, Van Damme J, Abu El-Asrar A, Proost P, Opdenakker G. Matrix metalloproteinases in arthritis: towards precision medicine. Nature Reviews. Rheumatology. 2023;19:363–377. doi: 10.1038/s41584-023-00966-w. [DOI] [PubMed] [Google Scholar]
  20. Grillon A, Scherlinger M, Boyer P-H, De Martino S, Perdriger A, Blasquez A, Wipff J, Korganow A-S, Bonnard C, Cantagrel A, Eyer D, Guérin F, Monteiro I, Woehl J-M, Moreau P, Pennaforte J-L, Lechevallier J, Bastides F, Colombey A, Imbert I, Maugars Y, Gicquel P, Cuchet F, Brax M, Sibilia J, Zilliox L, Barthel C, Arnaud L, Jaulhac B. Characteristics and clinical outcomes after treatment of a national cohort of PCR-positive Lyme arthritis. Seminars in Arthritis and Rheumatism. 2019;48:1105–1112. doi: 10.1016/j.semarthrit.2018.09.007. [DOI] [PubMed] [Google Scholar]
  21. Grobmyer SR, Barie PS, Nathan CF, Fuortes M, Lin E, Lowry SF, Wright CD, Weyant MJ, Hydo L, Reeves F, Shiloh MU, Ding A. Secretory leukocyte protease inhibitor, an inhibitor of neutrophil activation, is elevated in serum in human sepsis and experimental endotoxemia. Critical Care Medicine. 2000;28:1276–1282. doi: 10.1097/00003246-200005000-00003. [DOI] [PubMed] [Google Scholar]
  22. Gross DM, Steere AC, Huber BT. T helper 1 response is dominant and localized to the synovial fluid in patients with Lyme arthritis. Journal of Immunology. 1998;160:1022–1028. [PubMed] [Google Scholar]
  23. Gupta A, Arora G, Rosen CE, Kloos Z, Cao Y, Cerny J, Sajid A, Hoornstra D, Golovchenko M, Rudenko N, Munderloh U, Hovius JW, Booth CJ, Jacobs-Wagner C, Palm NW, Ring AM, Fikrig E. A human secretome library screen reveals A role for Peptidoglycan Recognition Protein 1 in Lyme borreliosis. PLOS Pathogens. 2020;16:e1009030. doi: 10.1371/journal.ppat.1009030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hart TM, Sonnert ND, Tang X, Chaurasia R, Allen PE, Hunt JR, Read CB, Johnson EE, Arora G, Dai Y, Cui Y, Chuang Y-M, Yu Q, Rahman MS, Mendes MT, Rolandelli A, Singh P, Tripathi AK, Ben Mamoun C, Caimano MJ, Radolf JD, Lin Y-P, Fingerle V, Margos G, Pal U, Johnson RM, Pedra JHF, Azad AF, Salje J, Dimopoulos G, Vinetz JM, Carlyon JA, Palm NW, Fikrig E, Ring AM. An atlas of human vector-borne microbe interactions reveals pathogenicity mechanisms. Cell. 2024;187:4113–4127. doi: 10.1016/j.cell.2024.05.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hiemstra PS, Maassen RJ, Stolk J, Heinzel-Wieland R, Steffens GJ, Dijkman JH. Antibacterial activity of antileukoprotease. Infection and Immunity. 1996;64:4520–4524. doi: 10.1128/iai.64.11.4520-4524.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hu LT, Eskildsen MA, Masgala C. Host metalloproteinases in Lyme arthritis. Arthritis and Rheumatism. 2001;44:1401–1410. doi: 10.1002/1529-0131(200106)44:6<1401::AID-ART234>3.0.CO;2-S. [DOI] [PubMed] [Google Scholar]
  27. Huet G, Flipo RM, Richet C, Thiebaut C, Demeyer D, Balduyck M, Duquesnoy B, Degand P. Measurement of elastase and cysteine proteinases in synovial fluid of patients with rheumatoid arthritis, sero-negative spondylarthropathies, and osteoarthritis. Clinical Chemistry. 1992;38:1694–1697. [PubMed] [Google Scholar]
  28. Jin FY, Nathan C, Radzioch D, Ding A. Secretory leukocyte protease inhibitor: a macrophage product induced by and antagonistic to bacterial lipopolysaccharide. Cell. 1997;88:417–426. doi: 10.1016/s0092-8674(00)81880-2. [DOI] [PubMed] [Google Scholar]
  29. Koenigs A, Hammerschmidt C, Jutras BL, Pogoryelov D, Barthel D, Skerka C, Kugelstadt D, Wallich R, Stevenson B, Zipfel PF, Kraiczy P. BBA70 of Borrelia burgdorferi is a novel plasminogen-binding protein. The Journal of Biological Chemistry. 2013;288:25229–25243. doi: 10.1074/jbc.M112.413872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kugeler KJ, Schwartz AM, Delorey MJ, Mead PS, Hinckley AF. Estimating the frequency of lyme disease diagnoses, United States, 2010-2018. Emerging Infectious Diseases. 2021;27:616–619. doi: 10.3201/eid2702.202731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Lally F, Smith E, Filer A, Stone MA, Shaw JS, Nash GB, Buckley CD, Rainger GE. A novel mechanism of neutrophil recruitment in A coculture model of the rheumatoid synovium. Arthritis and Rheumatism. 2005;52:3460–3469. doi: 10.1002/art.21394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Lee SY, Nho TH, Choi BD, Jeong SJ, Lim DS, Jeong MJ. Secretory leukocyte protease inhibitor reduces inflammation and alveolar bone resorption in LPS-induced periodontitis in rats and in MC3T3-E1 preosteoblasts. Animal Cells and Systems. 2016;20:344–352. doi: 10.1080/19768354.2016.1250817. [DOI] [Google Scholar]
  33. Li X, Liu X, Beck DS, Kantor FS, Fikrig E. Borrelia burgdorferi lacking BBK32, a fibronectin-binding protein, retains full pathogenicity. Infection and Immunity. 2006;74:3305–3313. doi: 10.1128/IAI.02035-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lin B, Kidder JM, Noring R, Steere AC, Klempner MS, Hu LT. Differences in synovial fluid levels of matrix metalloproteinases suggest separate mechanisms of pathogenesis in Lyme arthritis before and after antibiotic treatment. The Journal of Infectious Diseases. 2001;184:174–180. doi: 10.1086/322000. [DOI] [PubMed] [Google Scholar]
  35. Lochhead RB, Strle K, Kim ND, Kohler MJ, Arvikar SL, Aversa JM, Steere AC. MicroRNA expression shows inflammatory dysregulation and tumor-like proliferative responses in joints of patients with postinfectious lyme arthritis. Arthritis & Rheumatology. 2017;69:1100–1110. doi: 10.1002/art.40039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lochhead RB, Arvikar SL, Aversa JM, Sadreyev RI, Strle K, Steere AC. Robust interferon signature and suppressed tissue repair gene expression in synovial tissue from patients with postinfectious, Borrelia burgdorferi-induced Lyme arthritis. Cellular Microbiology. 2019a;21:e12954. doi: 10.1111/cmi.12954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Lochhead RB, Ordoñez D, Arvikar SL, Aversa JM, Oh LS, Heyworth B, Sadreyev R, Steere AC, Strle K. Interferon-gamma production in Lyme arthritis synovial tissue promotes differentiation of fibroblast-like synoviocytes into immune effector cells. Cellular Microbiology. 2019b;21:e12992. doi: 10.1111/cmi.12992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lochhead RB, Strle K, Arvikar SL, Weis JJ, Steere AC. Lyme arthritis: linking infection, inflammation and autoimmunity. Nature Reviews. Rheumatology. 2021;17:449–461. doi: 10.1038/s41584-021-00648-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Ma Y, Seiler KP, Eichwald EJ, Weis JH, Teuscher C, Weis JJ. Distinct characteristics of resistance to Borrelia burgdorferi-induced arthritis in C57BL/6N mice. Infection and Immunity. 1998;66:161–168. doi: 10.1128/IAI.66.1.161-168.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Maffia PC, Zittermann SE, Scimone ML, Tateosian N, Amiano N, Guerrieri D, Lutzky V, Rosso D, Romeo HE, Garcia VE, Issekutz AC, Chuluyan HE. Neutrophil elastase converts human immature dendritic cells into transforming growth factor-beta1-secreting cells and reduces allostimulatory ability. The American Journal of Pathology. 2007;171:928–937. doi: 10.2353/ajpath.2007.061043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Maruyama M, Hay JG, Yoshimura K, Chu CS, Crystal RG. Modulation of secretory leukoprotease inhibitor gene expression in human bronchial epithelial cells by phorbol ester. The Journal of Clinical Investigation. 1994;94:368–375. doi: 10.1172/JCI117331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Matsuba S, Yabe-Wada T, Takeda K, Sato T, Suyama M, Takai T, Kikuchi T, Nukiwa T, Nakamura A. Identification of secretory leukoprotease inhibitor as an endogenous negative regulator in allergic effector cells. Frontiers in Immunology. 2017;8:1538. doi: 10.3389/fimmu.2017.01538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. McDonnell J, Lobner JM, Knight WB, Lark MW, Green B, Poe M, Moore VL. Comparison of the proteoglycanolytic activities of human leukocyte elastase and human cathepsin G in vitro and in vivo. Connective Tissue Research. 1993;30:1–9. doi: 10.3109/03008209309032926. [DOI] [PubMed] [Google Scholar]
  44. Mead P. Epidemiology of Lyme Disease. Infectious Disease Clinics of North America. 2022;36:495–521. doi: 10.1016/j.idc.2022.03.004. [DOI] [PubMed] [Google Scholar]
  45. Miller JC, Ma Y, Bian J, Sheehan KCF, Zachary JF, Weis JH, Schreiber RD, Weis JJ. A critical role for type I IFN in arthritis development following Borrelia burgdorferi infection of mice. Journal of Immunology. 2008;181:8492–8503. doi: 10.4049/jimmunol.181.12.8492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Miller JB, Aucott JN. Stages of Lyme Arthritis. Journal of Clinical Rheumatology. 2021;27:e540–e546. doi: 10.1097/RHU.0000000000001513. [DOI] [PubMed] [Google Scholar]
  47. Moreau T, Baranger K, Dadé S, Dallet-Choisy S, Guyot N, Zani ML. Multifaceted roles of human elafin and secretory leukocyte proteinase inhibitor (SLPI), two serine protease inhibitors of the chelonianin family. Biochimie. 2008;90:284–295. doi: 10.1016/j.biochi.2007.09.007. [DOI] [PubMed] [Google Scholar]
  48. Murphy G, Nagase H. Reappraising metalloproteinases in rheumatoid arthritis and osteoarthritis: destruction or repair? Nature Clinical Practice. Rheumatology. 2008;4:128–135. doi: 10.1038/ncprheum0727. [DOI] [PubMed] [Google Scholar]
  49. Nakamura A, Mori Y, Hagiwara K, Suzuki T, Sakakibara T, Kikuchi T, Igarashi T, Ebina M, Abe T, Miyazaki J, Takai T, Nukiwa T. Increased susceptibility to LPS-induced endotoxin shock in secretory leukoprotease inhibitor (SLPI)-deficient mice. The Journal of Experimental Medicine. 2003;197:669–674. doi: 10.1084/jem.20021824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Nishimura J, Saiga H, Sato S, Okuyama M, Kayama H, Kuwata H, Matsumoto S, Nishida T, Sawa Y, Akira S, Yoshikai Y, Yamamoto M, Takeda K. Potent antimycobacterial activity of mouse secretory leukocyte protease inhibitor. Journal of Immunology. 2008;180:4032–4039. doi: 10.4049/jimmunol.180.6.4032. [DOI] [PubMed] [Google Scholar]
  51. Nugteren S, Samsom JN. Secretory Leukocyte Protease Inhibitor (SLPI) in mucosal tissues: Protects against inflammation, but promotes cancer. Cytokine & Growth Factor Reviews. 2021;59:22–35. doi: 10.1016/j.cytogfr.2021.01.005. [DOI] [PubMed] [Google Scholar]
  52. Ramamoorthi N, Narasimhan S, Pal U, Bao F, Yang XF, Fish D, Anguita J, Norgard MV, Kantor FS, Anderson JF, Koski RA, Fikrig E. The Lyme disease agent exploits a tick protein to infect the mammalian host. Nature. 2005;436:573–577. doi: 10.1038/nature03812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Ritzman AM, Hughes-Hanks JM, Blaho VA, Wax LE, Mitchell WJ, Brown CR. The chemokine receptor CXCR2 ligand KC (CXCL1) mediates neutrophil recruitment and is critical for development of experimental Lyme arthritis and carditis. Infection and Immunity. 2010;78:4593–4600. doi: 10.1128/IAI.00798-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Sallenave JM, Shulmann J, Crossley J, Jordana M, Gauldie J. Regulation of secretory leukocyte proteinase inhibitor (SLPI) and elastase-specific inhibitor (ESI/elafin) in human airway epithelial cells by cytokines and neutrophilic enzymes. American Journal of Respiratory Cell and Molecular Biology. 1994;11:733–741. doi: 10.1165/ajrcmb.11.6.7946401. [DOI] [PubMed] [Google Scholar]
  55. Schuijt TJ, Hovius JWR, van Burgel ND, Ramamoorthi N, Fikrig E, van Dam AP. The tick salivary protein Salp15 inhibits the killing of serum-sensitive Borrelia burgdorferi sensu lato isolates. Infection and Immunity. 2008;76:2888–2894. doi: 10.1128/IAI.00232-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Schwartz AM, Hinckley AF, Mead PS, Hook SA, Kugeler KJ. Surveillance for lyme disease - United States, 2008-2015. Morbidity and Mortality Weekly Report. Surveillance Summaries. 2017;66:1–12. doi: 10.15585/mmwr.ss6622a1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Schwendinger MG, O’Rourke M, Traweger A, Savidis-Dacho H, Pilz A, Portsmouth D, Livey I, Barrett PN, Crowe BA. Evaluation of OspA vaccination-induced serological correlates of protection against Lyme borreliosis in a mouse model. PLOS ONE. 2013;8:e79022. doi: 10.1371/journal.pone.0079022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Shi Y, Xu Q, McShan K, Liang FT. Both decorin-binding proteins A and B are critical for the overall virulence of Borrelia burgdorferi. Infection and Immunity. 2008;76:1239–1246. doi: 10.1128/IAI.00897-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Shin JJ, Glickstein LJ, Steere AC. High levels of inflammatory chemokines and cytokines in joint fluid and synovial tissue throughout the course of antibiotic-refractory lyme arthritis. Arthritis and Rheumatism. 2007;56:1325–1335. doi: 10.1002/art.22441. [DOI] [PubMed] [Google Scholar]
  60. Song XY, Zeng L, Jin W, Thompson J, Mizel DE, Lei K, Billinghurst RC, Poole AR, Wahl SM. Secretory leukocyte protease inhibitor suppresses the inflammation and joint damage of bacterial cell wall-induced arthritis. The Journal of Experimental Medicine. 1999;190:535–542. doi: 10.1084/jem.190.4.535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Sonnert ND, Rosen CE, Ghazi AR, Franzosa EA, Duncan-Lowey B, González-Hernández JA, Huck JD, Yang Y, Dai Y, Rice TA, Nguyen MT, Song D, Cao Y, Martin AL, Bielecka AA, Fischer S, Guan C, Oh J, Huttenhower C, Ring AM, Palm NW. A host-microbiota interactome reveals extensive transkingdom connectivity. Nature. 2024;628:171–179. doi: 10.1038/s41586-024-07162-0. [DOI] [PubMed] [Google Scholar]
  62. Srirangan S, Choy EH. The role of interleukin 6 in the pathophysiology of rheumatoid arthritis. Therapeutic Advances in Musculoskeletal Disease. 2010;2:247–256. doi: 10.1177/1759720X10378372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Steere AC, Schoen RT, Taylor E. The clinical evolution of Lyme arthritis. Annals of Internal Medicine. 1987;107:725–731. doi: 10.7326/0003-4819-107-5-725. [DOI] [PubMed] [Google Scholar]
  64. Taggart CC, Greene CM, McElvaney NG, O’Neill S. Secretory leucoprotease inhibitor prevents lipopolysaccharide-induced IkappaBalpha degradation without affecting phosphorylation or ubiquitination. The Journal of Biological Chemistry. 2002;277:33648–33653. doi: 10.1074/jbc.M203710200. [DOI] [PubMed] [Google Scholar]
  65. Taggart CC, Cryan SA, Weldon S, Gibbons A, Greene CM, Kelly E, Low TB, O’neill SJ, McElvaney NG. Secretory leucoprotease inhibitor binds to NF-kappaB binding sites in monocytes and inhibits p65 binding. The Journal of Experimental Medicine. 2005;202:1659–1668. doi: 10.1084/jem.20050768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Takayama K, Rothenberg RJ, Barbour AG. Absence of lipopolysaccharide in the Lyme disease spirochete, Borrelia burgdorferi. Infection and Immunity. 1987;55:2311–2313. doi: 10.1128/iai.55.9.2311-2313.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Tarhini MFH, Bentaher A, Greige-Gerges H, Elaissari A. A potential new strategy for using elastase and its inhibitor as therapeutic agents. Journal of Translational Science. 2018;5:1–8. [Google Scholar]
  68. Thompson RC, Ohlsson K. Isolation, properties, and complete amino acid sequence of human secretory leukocyte protease inhibitor, a potent inhibitor of leukocyte elastase. PNAS. 1986;83:6692–6696. doi: 10.1073/pnas.83.18.6692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Wen G, Zhang C, Chen Q, Luong LA, Mustafa A, Ye S, Xiao Q. A novel role of matrix metalloproteinase-8 in macrophage differentiation and polarization. The Journal of Biological Chemistry. 2015;290:19158–19172. doi: 10.1074/jbc.M114.634022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Wiedow O, Harder J, Bartels J, Streit V, Christophers E. Antileukoprotease in human skin: an antibiotic peptide constitutively produced by keratinocytes. Biochemical and Biophysical Research Communications. 1998;248:904–909. doi: 10.1006/bbrc.1998.9069. [DOI] [PubMed] [Google Scholar]
  71. Wilkinson DJ, Arques MDC, Huesa C, Rowan AD. Serine proteinases in the turnover of the cartilage extracellular matrix in the joint: implications for therapeutics. British Journal of Pharmacology. 2019;176:38–51. doi: 10.1111/bph.14173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Wilson T, Kaur N, Davis J, Ali SA. Tissue collection and rna extraction from the human osteoarthritic knee joint. Journal of Visualized Experiments. 2021;10:3791. doi: 10.3791/62718. [DOI] [PubMed] [Google Scholar]
  73. Zakrzewicz A, Richter K, Zakrzewicz D, Siebers K, Damm J, Agné A, Hecker A, McIntosh JM, Chamulitrat W, Krasteva-Christ G, Manzini I, Tikkanen R, Padberg W, Janciauskiene S, Grau V. SLPI inhibits ATP-mediated maturation of IL-1β in human monocytic leukocytes: a novel function of an old player. Frontiers in Immunology. 2019;10:664. doi: 10.3389/fimmu.2019.00664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Zheng H, McAlinden A. RNA isolation from articular cartilage tissue. Methods in Molecular Biology. 2021;2245:121–133. doi: 10.1007/978-1-0716-1119-7_9. [DOI] [PubMed] [Google Scholar]
  75. Zhu J, Nathan C, Jin W, Sim D, Ashcroft GS, Wahl SM, Lacomis L, Erdjument-Bromage H, Tempst P, Wright CD, Ding A. Conversion of proepithelin to epithelins: roles of SLPI and elastase in host defense and wound repair. Cell. 2002;111:867–878. doi: 10.1016/s0092-8674(02)01141-8. [DOI] [PubMed] [Google Scholar]

eLife Assessment

Huihui Li 1

This study presents a valuable finding on the role of secretory leukocyte protease inhibitors (SLPIs) in developing Lyme disease in mice infected with Borrelia burgdorferi. The evidence supporting the authors' claims is solid. However, several concerns raised by the reviewers remain unaddressed. This paper would be of interest to scientists in the infectious inflammatory disease field.

Reviewer #2 (Public review):

Anonymous

This study by Yu and coworkers investigates the potential role of Secretory leukocyte protease inhibitor (SLPI) in Lyme arthritis. They show that, after needle inoculation of the Lyme disease agent, B. burgdorferi, compared to wild type mice, a SLPI-deficient mouse suffers elevated bacterial burden, joint swelling and inflammation, pro-inflammatory cytokines in the joint, and levels of serum neutrophil elastase (NE). They suggest that SLPI levels of Lyme disease patients are diminished relative to healthy controls. Finally, using a powerful screen of secreted mammalian proteins, they find that SLPI interacts directly B. burgdorferi.

The known role of SLPI in dampening inflammation and inflammatory damage by inhibition of NE makes the enhanced inflammation in the joint of B. burgdorferi-infected mice a predicted result but it has not previously been demonstrated and could spur further study. A limitation that is unaddressed experimentally is potential contribution of the greater bacterial burden to the enhanced inflammation, leaving open the question of whether greater immunologic stimulus or a defect in the regulation of inflammation is responsible for the observed enhanced disease. Answering this question would better justify the statement in the abstract that "These data demonstrate the importance of SLPI in suppressing periarticular joint inflammation in Lyme disease."

Although the finding of SLPI binding to bacteria is potentially quite interesting the biological relevance of this interaction is not addressed. Readers of only the abstract, which describes the direct interaction of SLPI with bacteria, may mistakenly conclude that the authors demonstrate that recruitment of this immunoregulatory factor to the bacterial surface enhances inflammation of infected tissues. This attractive possibility has not been demonstrated in this study; such assertion would require comparison of bacteria that either bind or do not bind SLPI in a mouse infection model.

Finally, the investigators take advantage of clinical samples to ask if serum SLPI levels a diminished in Lyme disease patients relative to healthy controls. The assessment of human samples is interesting and generally to be lauded, but here the comparison is limited by: (a) a small sample number, with only 5 healthy control samples (which should not be difficult to obtain); and (b) the inclusion of samples from 4 patients with erythema migrans rather than Lyme arthritis, which was the manifestation tracked in the mouse studies. Moreover, of the 3 Lyme arthritis patients, serum samples from multiple blood draws were included, resulting in 5 data points; similarly, of the 4 erythema migrans patients, 13 separate samples were included. The multiple samplings from some but not all subjects could result in differential "weighting" of samples. Therefore, although the investigators provide a statistical analysis of these data, it is difficult to evaluate the validity of this apparent difference.

In summary, this is an interesting study that provides new information regarding infection in a host deficient in SLPI and, using a state-of-the-art screen of the mammalian secretome to show that B. burgdorferi binds SLPI, raising the attractive possibility that this pathogen utilizes a host immune regulator to enhance inflammation. The conclusions that SLPI enhances inflammation directly due to its immunoregulatory activity and that SLPI levels are diminished in human Lyme disease patients, as well as the implication that SLPI binding by the bacterium has pathogenic significance, each require further study.

eLife. 2025 May 20;14:RP104913. doi: 10.7554/eLife.104913.4.sa2

Author response

Qian Yu 1, Xiaotian Tang 2, Thomas Hart 3, Robert Homer 4, Alexia A Belperron 5, Linda Bockenstedt 6, Aaron Ring 7, Akira Nakamura 8, Erol Fikrig 9

The following is the authors’ response to the current reviews.

We deeply appreciate the reviewer’s careful review and critiques. These are excellent critiques that we are working on and probably require a few more years of work. Published together, we believe these critiques add value to our manuscript.

The following is the authors’ response to the original reviews.

Reviewer #2 (Public review):

Summary:

This manuscript by Yu and coworkers investigates the potential role of Secretory leukocyte protease inhibitor (SLPI) in Lyme arthritis. They show that, after needle inoculation of the Lyme disease (LD) agent, B. burgdorferi, compared to wild type mice, a SLPI-deficient mouse suffers elevated bacterial burden, joint swelling and inflammation, pro-inflammatory cytokines in the joint, and levels of serum neutrophil elastase (NE). They suggest that SLPI levels of Lyme disease patients are diminished relative to healthy controls. Finally, they find that SLPI may interact directly the B. burgdorferi.

Strengths:

Many of these observations are interesting and the use of SLPI-deficient mice is useful (and has not previously been done).

Weaknesses:

(a) The known role of SLPI in dampening inflammation and inflammatory damage by inhibition of NE makes the enhanced inflammation in the joint of B. burgdorferi-infected mice a predicted result; (b) The potential contribution of the greater bacterial burden to the enhanced inflammation is acknowledged but not experimentally addressed; (c) The relationship of SLPI binding by B. burgdorferi to the enhanced disease of SLPI-deficient mice is not addressed in this study, making the inclusion of this observation in this manuscript incomplete; and (d) assessment of SLPI levels in healthy controls vs. Lyme disease patients is inadequate.

We greatly appreciate the critiques, and we do agree. Even though the observation of NE level is predictable, we believe that it is important to actually demonstrate it in the context of murine Lyme arthritis. The function of SLPI goes beyond inhibiting NE level. As an ongoing project in our lab, we believe that the current study serves as a good starting point to explore the pleiotropic effects SLPI in the pathogenesis of murine Lyme arthritis and in patients. And, the critiques here are of great value to our research.

Comments on revised version:

Several of the points were addressed in the revised manuscript, but the following issues remain:

Previous point that the relationship of SLPI binding to B. burgdorferi to the enhanced disease of SLPI-deficient mice is not investigated: The authors indicate that such investigations are ongoing. In the absence of any findings, I recommend that their interesting BASEHIT and subsequent studies be presented in a future study, which would have high impact.

We thank the reviewer for the critique. We do agree that this part of the story is not complete. However, we would like to keep the BASEHIT and binding data in the paper, as we believe that it is an important finding. We confirmed the binding using ELISA, flow cytometry, and immunofluorescent microscopy. We showed that the binding is specific to infectious strain of B. burgdorferi, thus likely to contribute to the pathogenesis of murine Lyme arthritis. Our data suggest that SLPI can directly interact with a B. burgdorferi protein. We are exploring the biological significance of the binding. And this finding can be further explored by other labs too.

Previous recommendation 1: (The authors added lines 267-68, not 287-68). This ambiguity is acknowledged but remains. In addition, in the revised manuscript, the authors state "However, these data also emphasize the importance of SLPI in controlling the development of inflammation in periarticular tissues of B. burgdorferi-infected mice." Given acknowledged limitations of interpretation, "suggest" would be more appropriate than "emphasize".

We thank the reviewer for the careful reading, and we apologize for the mistake. The change has been made accordingly (line 268).

Previous recommendation 5: The lack of clinical samples can be a challenge. Nevertheless, 4 of the 7 samples from LD patients are from individuals suffering from EM rather than arthritis (i.e., the manifestation that is the topic of the study) and some who are sampled multiple times, make an objective statistical comparison difficult. I don't have a suggestion as to how to address the difference in number of samples from a given subject. However, the authors could consider segregating EM vs. LA in their analysis (although it appears that limiting the comparison between HC and LA patients would not reveal a statistical difference).

We thank the reviewer for the critique. And we agree with the reviewer that the patient’s data presented are not ideal. We believe that at this point the combination of the samples is most logical, as the number of samples we have from patients with Lyme arthritis is fairly limited. We stated the limitation in the discussion. We do believe that the finding of the correlation is important. It suggests the potential function of SLPI in patients, beyond murine infection.

What’s more, various groups with large number of different samples can elucidate the relationship further.

Previous recommendation 6: Given that binding of SLPI to the bacterial surface is an essential aspect of the authors' model, and that the ELISA assay to indicate SLPI binding used cell lysates rather than intact bacteria, a control PI staining to validate the integrity of bacteria seems reasonable.

We appreciate the suggestion and has provided the propidium iodide staining in Supplemental Figure 5 (line 539-542, 568-569, 718-722).

Previous recommendation 8: The inclusion of a no serum control (that presumably shows 100% viability) would validate the authors' assertion that 20% serum has bactericidal activity.

We appreciate the suggestion. As stated in the manuscript (line 583-584), the percent viability was normalized to the control spirochetes culture without any treatment. Thus, the control spirochetes culture, without serum and SLPI treatment, showed 100% viability. We have revised Supplemental Figure 3 accordingly.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 1—source data 1. Source data value for Figure 1A-E.
    Figure 2—source data 1. Source data value for Figure 2B and D.
    Figure 3—source data 1. Source data value for Figure 3A-I.
    Figure 3—figure supplement 1—source data 1. Source data for Figure 3-figure supplement 1.
    Figure 3—figure supplement 2—source data 1. Source data for Figure 3-figure supplement 2.
    Figure 4—source data 1. Source data for Figure 4.
    Figure 5—source data 1. Source data for Figure 5A.
    Figure 5—figure supplement 1—source data 1. Source data for Figure 5-figure supplement 1B.
    Figure 5—figure supplement 2—source data 1. Source data for Figure 5-figure supplement 2A and B.
    Supplementary file 1. Subject characterization.
    elife-104913-supp1.docx (16.4KB, docx)
    MDAR checklist

    Data Availability Statement

    All data generated or analyzed in this study are included in the manuscript and the supplementary files.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES