PGC-1 alpha regulates mitochondrial biogenesis to promote silica-induced pulmonary fibrosis

Abstract

Silicosis is an incurable chronic fibrotic lung disease caused by long-term exposure to respirable silica particles. It is characterized by persistent inflammation and progressive fibrosis of lung tissues, which eventually leads to respiratory failure and seriously affects human health. The high incidence and mortality associated with silicosis have made the disease a widespread public health concern. However, its pathogenesis has not been fully elucidated. Mitochondrial biogenesis plays a crucial role under various fibrotic conditions. However, the mechanism of this process in silicosis is still unclear. Therefore, this study aimed to explore the influence of the PGC-1α gene on mitochondrial biogenesis in the development of silicosis. We established in vivo and in vitro silicosis models by exposing rats and rat type-2 alveolar epithelial cells (RLE-6TN) to silica. Our findings revealed alterations in the mitochondrial structure and function, decreased mitochondrial biogenesis, and reduced expression of mtDNA (Mitochondrial DNA) content. By upregulating the PGC-1α gene in RLE-6TN cells, we activated the PGC-1α- NRF1-TFAM signaling pathway, enhancing mitochondrial biogenesis, increasing citrate synthase and mtDNA content, improving mitochondrial function, and mitigating fibrosis. Our results indicate that the regulation of mitochondrial biogenesis can affect silicosis-induced fibrosis, highlighting the significance of reduced mitochondrial biogenesis in the progression of silicosis-induced fibrosis.

Graphical Abstract

Graphical Abstract.

Introduction

Pneumoconiosis refers to a group of occupational lung diseases that are mainly caused by diffuse fibrosis of the lung tissue due to long-term inhalation of productive dust with different pathogenicities, such as silica dust, coal dust, and asbestos dust, in occupational activities and retention in the lungs.¹ Although the etiology of pneumoconiosis is clear, its pathogenesis has not been fully elucidated. Pneumoconiosis is one of the most common and harmful occupational diseases.² Globally, the number of pneumoconiosis cases has increased from 36,186 in 1990 to 60,055 in 2017, with an average increase of 66.0%.³

Silicosis is one of the most important occupational diseases in developing countries as well as in developed countries. Silicosis is estimated to affect 2.2 million workers in the United States, 2 million workers in the European Union, and over 23 million workers in China,⁴ making it a serious occupational health problem with important social and economic impacts on workers and the healthcare system.⁵ Pneumoconiosis does not have a medical termination period, with an average lifetime economic burden of 2.075 million yuan per patient.⁶ It mainly manifests as diffuse nodular fibrosis of the lungs. Lesions continue to progress, ultimately leading to a significant decline in lung function, respiratory failure, and even death.⁷ Mitochondria have received increasing attention in the context of the complex pathology of silicosis. Long-term exposure to dust can damage the structure and function of the mitochondria in the lungs of patients with pneumoconiosis, which is characterized by mitochondrial swelling, destruction and disappearance of cristae, abnormal mitochondrial dynamic balance, and biosynthesis, decreased ATP production, increased oxidative pressure, and decreased mitochondrial membrane potential.⁸ This mitochondrial dysfunction exacerbates the imbalance in cellular energy metabolism and promotes inflammation and fibrosis in the lungs.

Mitochondria play a crucial role in intracellular energy metabolism, and their functional impairment is closely linked to their biological occurrence. Mitochondrial biogenesis is initiated under cellular stress or in response to various environmental stimuli, including exercise and heat restriction. This process leads to an increase in the inner membrane and mitochondrial DNA (mtDNA)⁹ as well as an increase in the number of mitochondria and the expression of enzymes such as citrate synthase, which are essential for mitochondrial function.^10,11 The regulation of mitochondrial biogenesis is complex and involves multiple signaling factors, with the PGC-1α-NRF1-TFAM pathway emerging as a critical regulatory pathway.^12,13 Specifically, PGC-1 α collaborates with NRF1 to transcriptionally activate TFAM, which is targeted at mitochondria and plays a key role in regulating mtDNA replication and transcription.¹⁴ TFAM is the final element of the mitochondrial biogenic regulatory pathway, directly participating in mtDNA replication and the activation of mitochondrial protein transcription.¹⁵ It is worth noting that PGC-1α and NRF-1 are pivotal regulatory factors in the process of mitochondrial biogenesis.¹⁶

PGC-1α, a widely expressed transcriptional coactivator,¹⁷ plays a crucial role in regulating metabolic processes and mitochondrial function. Prior studies have reported that mice lacking the PGC-1α gene display disruptions in glucose metabolism, reduced endurance, and decreased mitochondrial gene expression.¹⁸ Conversely, transgenic mice engineered to overexpress PGC-1α in their muscles exhibit enhanced exercise endurance, increased expression of mitochondrial genes, elevated oxidase activity, and augmented mitochondrial RNA levels.^19,20 This enhancement is attributed to PGC-1α’s ability to boost the expression and activity of various transcription factors through interactions. Moreover, PGC-1α is intricately linked to fatty acid oxidation and oxidative phosphorylation.²¹ Notably, PGC-1α stimulates the expression of nuclear genes encoding subunits of the oxidative phosphorylation system via the NRF-1 pathway, thereby enhancing energy synthesis efficiency and facilitating mitochondrial biogenesis.^22–24 NRF-1 is a core transcription factor that plays a pivotal role in regulating the expression of genes involved in mitochondrial respiration. By binding to the promoter regions of nuclear DNA genes encoding mitochondrial proteins, NRF-1 triggers their transcription, thereby facilitating mitochondrial function.

Previous studies have indicated that regulating mitochondrial biogenesis to prevent liver fibrosis may be an effective antifibrotic treatment method, providing new evidence for the possibility of using mitochondrial biogenesis to treat liver fibrosis.²⁵ Thyroid hormone (TH) induces PGC-1α-mediated mitochondrial biogenesis to combat lung fibroblast activation and malignant fibrosis circulation. The antifibrotic properties of thyroid hormones are related to the protection of alveolar epithelial cells and restore mitochondrial function.²⁶ Activating PGC-1α can restore the dynamics, morphology, and function of mitochondrial damage during kidney injury, thereby restoring renal cell death and fibrosis caused by mitochondrial damage.²⁷ However, the mechanism of this process in silicosis is still unclear.

In summary, we speculate that inducing mitochondrial biogenesis to increase mitochondrial quantity, improve mitochondrial structure and function, and maintain cellular and tissue energy homeostasis may be an effective strategy for preventing and treating silicosis-induced fibrosis. However, its mechanism of action on silicosis remains unclear. In this study, we investigate whether intervening in the PGC-1α-NRF1-TFAM signaling pathway can alleviate silicosis-induced pulmonary fibrosis by improving mitochondrial biogenesis. To this end, we replicate in vivo and in vitro silicosis models in order to provide new therapeutic targets and theoretical references for the treatment of silicosis fibrosis.

Materials and methods

Reagents

Silica particles (purity>99%) were purchased from Sigma-Aldrich, USA. The particle size was 0.5–10 μm with about 80% between 1 and 5 μm. PGC-1-alpha, NRF1, TFAM, and α-SMA antibodies were all purchased from Abcam in the UK. CS (citrate synthase) was purchased from Affinity Biosciences (Santa Clara, CA, USA). Rat type II alveolar epithelial cells (RLE-6TN) were purchased from Shanghai Mingjin Biotechnology Co. Ltd The plasmids were purchased from Sheweisi Biotechnology Co., Ltd (China).

Scanning electron microscope

Silica dust was spread on a copper mesh and then sprayed with gold. Finally, the silica dust particle size was observed using scanning electron microscopy (SEM).

Animal experiments

Specific pathogen classical Sprague–Dawley (SD) male rats with a weight of 200 (±20) g were purchased from Ningxia Medical University Animal Center, Yinchuan, China. Rats were randomly assigned to either the control group (n = 10) or the SiO₂ group (n = 10). Animal experiments were approved by the Animal Ethics Committee of Ningxia Medical University. In order to set up a rat model of silicosis, rats in the experimental group were exposed to silica once by disposable non-tracheal exposure, and intratracheal intubation was performed with the help of a laryngoscope. After successful intubation, the assistant took 1 mL of 50 mg/mL silica solution into the trachea slightly and smoothly. Control rats were administered sterile saline. The rats were then placed in a vertical position and their lungs were rotated back and forth and massaged ten times to ensure that the silica suspension entered their lungs and was evenly distributed, marked, and caged.

Cell culture and treatment

Rat type II alveolar epithelial cells (RLE-6TN) were cultured in a 1,640 cell culture medium with the 10% fetal calf serum (FBS) (Gibco, USA) and 1% penicillin and streptomycin (Solarbio, China) in an incubator (37 °C, 5% CO₂). To establish an in vitro silicosis model, RLE-6TN cells were exposed to 100 mg/L SiO₂ for 48 h. The morphological and ultrastructural changes of RLE-6TN cells after SiO₂ treatment were observed by inverted phase contrast microscopy and transmission electron microscopy, as well as the RNA and protein expression levels of fibrosis-related markers α-SMA were detected by RT-qPCR and western blotting methods. These results were used to determine whether an in vitro model of silicosis was successfully constructed.

Cell transfection

For transfection, PGC-1α overexpressing plasmid (OE-PGC-1α), the empty vector plasmid (OE-NC), the shRNA plasmids targeting PGC-1α (shRNA-PGC-1α), or scramble shRNA-negative control (shRNA-NC) was transfected into RLE-6TN cells using FV115 vector (Tianjin Shevis Biotechnology Co., Ltd, China) in line with the supplier’s recommendations. RLE-6TN cells (1 × 10⁵/well) were seeded into 6-well plates and incubated for 24 h. Plasmid DNA was mixed directly with the transfection reagent in a 1:1 ratio and allowed to stand at room temperature for 15 min to form a complex. Finally, the prepared complex was evenly added to a 6-well plate and cultivation was continued. After 48 h of transfection, cells were collected and PGC-1α mRNA levels were detected using RT-qPCR to assess the transfection efficiency and for subsequent experiments. The analysis was repeated at least three times.

Transmission electron microscope (TEM)

Lung tissue of 1 mm³ and RLE-6TN were placed in a 2.5% glutaraldehyde fixative for at least 2 h, respectively, then the phosphate buffer was placed at 4 °C, and the solution was changed every 1 h. Then, the samples were soaked in 1% citric acid for 1 h. The sample was washed twice with 0.1 M sodium dimethyl arsenate buffer for 15 min each. Rat lung tissues were dehydrated with 30%, 50%, 70%, 80%, 90%, 95%, and 100% alcohol and 100% acetone for 18 min each time. The tissues were then embedded in epoxy resin, trimmed, and positioned. Finally, cells were stained with uranyl acetate citrate and observed under a transmission electron microscope.

Organ coefficient calculation

The coefficient for measuring lung organs was calculated by stripping off the adipose tissue and mesentery surrounding the lung tissue and removing the bronchi. The lungs were then weighed using an electronic balance. Calculated based on lung organ coefficient: lung organ coefficient = lung tissue mass (g)/animal weight (g) × 100%.

MASSON and hematoxylin and eosin staining

The middle lobe of rat lung tissue was fixed in 4% paraformaldehyde, embedded in paraffin, and tissue sections were hematoxylin and eosin (HE) stained and Masson’s trichrome stained to evaluate pathological analysis and pulmonary fibrosis.

Immunohistochemistry

After dewaxing and dehydration, the paraffin sections were further sealed with 10% goat serum and then incubated overnight with primary antibodies against COL-I at 4 °C. After washing, incubate the slices with secondary antibodies at 37 °C for 1 h. The expression of COL-I was detected by hematoxylin staining and dehydration. Signal intensity was quantified at five points in each lung slice.

Cell proliferation assay

The CCK-8 (Beibo, China) proliferation assay was used to detect cell proliferation. RLE-6TN cells were seeded on a 96-well plate (2 × 10⁴ cells/well) and incubated overnight at 37 °C in a 5% CO₂ incubator. After the cells were attached, the culture medium was discarded and pre-prepared SiO₂ suspensions of different concentrations (0, 25, 50, 100, 150, 200, 300, 400, and 500 mg/L) were added. After 48 h, 10 μL of CCK-8 solution was added to each well and returned to the incubator for 2 h of cultivation. The absorbance was measured at 450 nm. All assays were conducted at least in triplicate.

Cell scratch healing test

Cell migration and motility were assessed using a cell scratch assay. RLE-6TN cells were seeded in 6-well plates at a density of 5 × 10⁵ cells per well. After 24 h of cultivation, a 10 μL gun tip was used to scratch in the 6-well plate. The cells were washed twice with PBS, and a serum-free medium was added. Photographs were captured under a microscope after 48 h. All measurements were performed in triplicate and independently repeated at least three times.

Clone formation assay

The cells were seeded in 6-well plates at a density of 1 × 10⁵ cells/well. After 24 h of culture, the cells were stimulated with a suspension of 100 mg/L silica dust. After 48 h, the cells were harvested by digestion, and 500 cells were inoculated into a new small culture dish for further cultivation. The culture was terminated when a colony of cloned cells was visible. The cells were fixed with 4% paraformaldehyde for 20 min and then stained with crystal violet. Photos of the cells were then taken. The experiment was independently repeated at least three times with three replicates each time.

Detection of mitochondrial ATP levels

The ATP detection kit was purchased from the Nanjing Jiancheng Biotechnology Research Institute. The ATP content in rat lung tissue and RLE-6TN cells was measured using the phosphomolybdic acid colorimetric method. Finally, the ATP content was calculated.

Detection of mitochondrial membrane potential in RLE-6TN cells

The mitochondrial transmembrane potential (MTP) of the cells was measured using the JC-1 staining kit (Beibo Biotechnology Co., Ltd, China). First, the cells were incubated in a medium containing 10 μM JC-1 for 20 min. The cells were then washed twice with JC-1 staining buffer (1×) and analyzed using a FACSCanto II flow cytometer (BD Biosciences).

Mitochondrial DNA copy number determination

Mitochondrial DNA copy number by real-time PCR. First, total DNA from RLE-6TN cells and rat lung tissue was isolated separately using a DNA isolation kit (Tiangen Co., Ltd, China). Then, mtDNA was quantified by normalizing the mitochondrial-encoded gene ND4 to nuclear-encoded gene 18 s using RT-qPCR and ΔΔ ct methods. The sequences of the primer pairs designed to amplify 18 s and ND4 were as follows: TAGAGGACAAGTGGCGTTC (F, 18 s); CGCTGAGCCAGTCAGTGT (R, 18 s); AGCCTAGTCATCACAGCCA (F, ND4); and GGTTAAGCCGTGTGGGCGATTA (R, ND4).

Real-time quantitative RT-qPCR

Total RNA was extracted from RLE-6TN cells using TRIzol reagent (Invitrogen, USA). The total RNA using a NanoDrop1000 spectrophotometer (Thermo Fisher Scientific). RNA was reverse transcription of RNA into deoxyribonucleic acid (CDNA) using a reverse transcription kit (Tiangen, China). RT-qPCR was performed using a CFX96 Real-Time Fluorescence Quantitative PCR Instrument (BioTek Technology). The reaction system consists of 10 μL 42 °C TB Green Premium Ex Taq II Fast qPCR (2×), 0.75 μL forward primers, 0.75 μL reverse primers, 0.2 μL cDNA, and 8.3uL ddH₂O.

RT-qPCR was performed as following: 42 °C for 15 min, 95 °C for 3 min, 95 °C for 30s, 95 °C for 5 s (40 cycles), and 60 °C for 10s. Primer pairs (Sangon Biotech, Shanghai, China) were used to amplify PGC-1α (Forward: CATACACAACCGCAGTCGCAAC; Reverse: GAGGAGGAGTCGTGGGAGGAG), NRF-1 (Forward: GTGGCTGATGGAGAGGTGGAAC; Reverse: TGCTTGCGTCGTCTGGATGG), TFAM (Forward: AAGTGATCTCATCCGTCGCAGTG; Reverse: CTTCTTGTGCCCAATCCCAATGAC), α-SMA (Forward: GGATGAAGCCCAGAGCAAGAGAG; Reverse: CAGTTGGTGATGATGCCGTGTTC), CS (Forward: GAACTCATCCTGCCTCGTCCTTG; Reverse: CTGTCTTCCCATGCTGCTGTCTG), GAPDH (Forward: AGGTCGGTGTGAACGGATTTG; Reverse: GGGGTCGTTGATGGCAACA), respectively. Target gene mRNA levels were normalized to GAPDH and fold changes were calculated using the 2^−ΔΔCt method. We selected four suitable housekeeping genes: GAPDH, β-ACTIN (ACTB), hydroxymethylbilane synthase (HMBS), and ubiquitin C (UBC), and assessed gene stability using GeNorm (see Fig. SS1).

Western blot

Western blot was used to detect the expression of PGC-1α, NRF1, TFAM, and CS proteins in lung tissue and RLE-6TN cells. The tissue lysate was added to lung tissue and cells, sonicated, and the supernatant was collected. The protein concentration was measured using a bicinchoninic acid (BCA) kit (Kaiji, China) and heated in a boiling water bath to fully denature the protein. A gel preparation kit (Keji, China) was used for gel preparation, followed by electrophoresis, membrane transfer, and sealing in 5% skim milk for 2 h. The corresponding primary antibody was added to the target protein, which was incubated at 4 °C overnight, reheated for 1 h, and washed with TBST 3 times for 10 min each. The corresponding secondary antibody was selected based on the species of the primary antibody and incubated for 1 h. After washing with TBST, the bands were visualized using an ultra-sensitive luminescent liquid. The grayscale value of the target protein was analyzed using Image J software. β-actin was used as an internal reference.

Statistical analysis

The experimental data were expressed as the mean ± SD and statistically analyzed using GraphPad Prism 8.0 and SPSS 24.0 (SPSS Inc., Chicago, IL). The mean values of the two independent samples were compared using Student’s t-test, and the mean values of the multiple groups of independent samples were compared using one-way analysis of variance (ANOVA), with a significance level of α = 0.05.

Results

Fibrotic lesions in lung tissue of SD rats exposed to silica

The silica particle size was measured using scanning electron microscopy (SEM). We observed that the particle size of silica in the field of view was all<5 μm (Fig. 1A). To construct a rat silicosis model, we perfused 1 mL of a 50 mg/mL silica suspension into the non-exposed trachea. The control group was perfused with 1 mL of physiological saline following the same procedure. After 60 days, the mice were euthanized. Analysis of lung organ coefficients revealed that the silica-exposed group showed an increase in lung organ coefficients compared to the control group (Fig. 1B). Upon observation (Fig. 2A), the lung tissue of the control group rats revealed an intact structure without defects, exhibiting a soft texture and an overall pink appearance. In contrast, the lung tissues of rats in the SiO₂ group appeared enlarged and pink-white in color, exhibiting prominent diffuse miliary nodules on the surface. Notably, nodular protrusions, cysts, and fused lesions were evident on the lung surface, which displayed a hardened texture and scattered bleeding points. Subsequent examination of the lung tissue through HE staining revealed that the control group rats exhibited a normal lung tissue structure characterized by an intact alveolar shape, consistent cell morphology, and the absence of atypia. Importantly, no inflammatory cell exudation or collagen deposition was observed in the lung parenchyma of the control mice. In contrast, the SiO₂ group displayed typical silicon nodules composed of collagen fibers that had undergone a glassy transformation, with an absence of an intrinsic lung structure and alveolar arrangement, along with the presence of diffuse fibrotic lesions in the lung tissue (Fig. 2B). Furthermore, examination of the collagen structure of the rat lung tissue and pathological changes by Masson staining (Fig. 2C) revealed a higher degree of blue collagen fibers in the SiO₂ group than in the control group. To further analyze the degree of pulmonary fibrosis, we analyzed changes in COL-I levels by immunohistochemistry. The results showed that COL-I (Fig. 2D) was upregulated in the silicosis group compared to the control group. These results indicate that the silicosis rat model was successfully established, and silicon nodules and fibrotic changes appeared in the lung tissue of rats exposed to silica.

Fig. 1.

The particle size of silica, the lung organ coefficient, and ATPase vitality in lung tissue result for SD rats. The particle size of silica taken by scanning electron microscope (SEM) (A). SD rats were given 1 mL of silica dust with a concentration of 50 mg/mL in the trachea, while the control group was given 1 mL of physiological saline. Rats were euthanized at two months, and lung tissue and body weight were weighed and analyzed (B). Lung organ coefficient = lung tissue mass (g)/animal body weight (g) × 100%. (C) ATP concentration in the lung tissue (μmol/gprot) = [(Measured OD value - Control OD value)]/[(Standard OD value - Blank OD value)] × Standard sample concentrationentration (1000umol/L) × Dilution factor prior to measurement (D)/Protein concentration of homogenate (P) (gprot/L). ^*p < 0.05.

Fig. 2.

Changes in lung tissue structure after SD rats were exposed to silica. The gross morphology of lung tissue in a silicosis SD rat model (A). The HE stain of SD rats lung tissue (B). MASSON staining of paraffin sections of rat lung tissue (C). Determination of COL-I protein expression in rat lung tissue by immunohistochemistry (D).

After exposure to silica, the proliferation and migration ability of RLE-6TN cells decreased, and the α-SMA protein was upregulated

Epithelial cells play crucial roles in SF development of silicotic fibrosis. To assess the effect of silica toxicity in RLE-6TN cells, the activity of SiO₂ in these cells was determined using the CCK8. RLE-6TN cells were exposed to various concentrations of SiO₂ (25 mg/L, 50 mg/L, 100 mg/L, 200 mg/L, and 400 mg/L) for 24 h. The analysis presented in Fig. 3A revealed a notable decrease in cell viability at SiO₂ concentrations of 50 mg/L, 100 mg/L, 200 mg/L, and 400 mg/L compared to the control group, with statistically significant differences (p< 0.05). It was determined that the survival rate of RLE-6TN cells in the 100 mg/L group exceeded 60%, designating it as the optimal experimental dust dose. The cell morphology was assessed using an inverted microscope. The findings shown in Fig. 3B indicated no significant alterations in cell morphology in the control group. Conversely, the SiO₂ group exposed to a concentration of 100 mg/L exhibited irregular cell morphology, a notable decrease in cell count, along with the presence of some cells showing early signs of cell death and significant disintegration. Scratch experiments showed that the cell migration ability decreased after exposure to RL-6TN at a concentration of 100 mg/L SiO₂ (Fig. 4A and C). Using plate cloning experiments, we observed that the cell cloning ability decreased after exposure to RL-6TN at a concentration of 100 mg/L SiO₂ (Fig. 4B and E).

Fig. 3.

Morphological, proliferative, and ultrastructural changes in RLE-6TN cells exposed to silica, as well as the ultrastructural changes in rat lung tissue. RLE-6TN cells were exposed to 0 mg/L, 25 mg/L, 50 mg/L, 100 mg/L, 200 mg/L, and 400 mg/L silica for 48 h. The effects of different concentrations of silica on the proliferation of cells were detected by CCK-8 (A). The results of CCK-8 are at least 3 independent experiments per group, repeated at least 5 times each. We used an inverted microscope to observe the morphological changes of cells exposed to 100 mg/L of silica (B). Ultrastructural changes of RLE-6TN cells (D) and rat lung tissue (C) were observed by TEM. (a) Normal mitochondria; (b) mitochondrial swelling, cavity, sputum disorder. ^*p< 0.05.

Fig. 4.

RLE-6TN cells show decreased proliferation and migration, along with disrupted mitochondrial structure and dysfunction when exposed to silica. The scratch healing pattern of RLE-6TN cells induced by silica exposure after 48 h (A). Quantitative analysis of cell relative mobility (C). RLE-6TN cells exposed to silica reduced colony formation (B). Quantitative analysis of colony formation assay (E). The ATP content in cells exposed to silica decreases (D). RLE-6TN cells were exposed to silica, resulting in a decrease in ΔΨm. The ΔΨm level was calculated as the red fluorescence intensity exceeds the green fluorescence intensity. The upper left quadrant represents the high ΔΨm level, and the lower right quadrant represents the low ΔΨm level (F). Quantitative analysis of cell ΔΨm level (G).^*p < 0.05.

Mitochondrial structural damage and dysfunction in lung tissue and RLE-6TN cells of silicotic rats

Transmission electron microscopy (TEM) was used to observe the structural changes in the mitochondria of rats and RLE-6TN cells induced by silica exposure. Rat lung tissue in the control group showed thin alveolar walls with evenly distributed mitochondria, displaying normal morphology and size (Fig. 3C). However, in the SiO₂ group, the alveolar walls thickened, the lung tissue solidified, diffuse fibrosis developed in the lung interstitium, and the number of mitochondria in the alveolar cells decreased, with visible swelling and vacuoles. Similarly, RLE-6TN cells exposed to SiO₂ exhibited uniformly distributed mitochondria in the control group with abundant and normal morphology. Conversely, in the SiO₂ group, the mitochondria displayed blurred spines, reduced numbers, and significant swelling (Fig. 3D). Furthermore, we assessed mitochondrial energy metabolism, specifically focusing on the crucial role of citrate synthase in regulating mitochondrial energy metabolism as the first key rate-limiting enzyme in the TCA cycle.²⁸ The ATP assay results indicate that the ATP concentration in the lung tissue of the control group is significantly higher than that in the SiO₂ group, suggesting a decreased metabolic capacity in the SiO₂ group (Fig. 1C). After rats and cells were exposed to silica, we detected chondroitin sulfate (CS) using western blotting (WB) and protein content evaluation (PCE). The results demonstrated a statistically significant decrease in CS protein expression of the mitochondrial function index in the SiO₂ group compared to that in the control group (p < 0.05) (Figs. 5A, B and  6A, C and F). In addition, we examined the ATP content and mitochondrial membrane potential and found that exposure to RLE-6TN cells at a concentration of 100 mg/L SiO₂ resulted in a decrease in ATP content (Fig. 4D) and mitochondrial membrane potential (Fig. 4F and G). These findings suggest that exposure to silica disrupts mitochondrial structure and function in both rats and cells.

Fig. 5.

Exposure to silica in SD rats reduces mitochondrial biogenesis-related genes and mitochondrial DNA copy number. Effects of silica exposure on the protein expression levels of PGC-1α, NRF1, TFAM, CS, and α-SMA by western blot in SD rats (A). Protein levels of PGC-1α, NRF1, TFAM, CS, and α-SMA (B). The copy number of mitochondrial DNA in SD rats exposed to silica decreased (C). Values represent the mean ± SD. The result of the animal part is the average of 10 samples per group, independent. Significant difference: ^*p<0.05, ^**p<0.01.

Fig. 6.

Overexpression of PGC-1α can promote mitochondrial biogenesis in RLE-6TN cells exposed to silica. Overexpression of PGC-1α in RLE-6TN cells using plasmids led to an increase in mRNA of PGC-1α (B). Effects of silica exposure on proteins (A) and mRNA expression levels of PGC-1α, NRF1, TFAM, CS, and α-SMA by western blot and RT-PCR in RLE-6TN, respectively. Expression levels of PGC-1α protein (C). Expression levels of NRF1 protein (D). Expression levels of TFAM protein (E). Expression levels of CS protein (F). Expression levels of α-SMA protein (G). Expression levels of PGC-1α mRNA (H). Expression levels of NRF1 mRNA (I). Expression levels of TFAM mRNA (J). Expression levels of PGC-1α mRNA (K). Expression levels of CS mRNA (L). Expression levels of α-SMA mRNA (M). The result of the cell fraction is at least 3 independent experiments per group, repeated at least 3 times each. Values represent the mean ± SD. Significant difference: (*) p < 0.05, ^*p < 0.05 (compared with negative group), ^**p < 0.01 (compared with negative group), ^***p < 0.001 (compared with negative group); ^#p< 0.05 (compared with the SiO₂ + OE-NC group), ^##p < 0.01 (compared with the SiO₂ + OE-NC group), ^###p< 0.001(compared with the SiO₂ + OE-NC group).

Mitochondrial biogenesis disorders in lung tissue and RLE-6TN cells of silicotic rats

Mitochondrial biogenesis plays an important role in maintaining mitochondrial structure and function. Next, we tested mitochondrial biogenic proteins. It was found that in the rat silicosis model and cell model, compared with the control group, the expression levels of PGC-1 α, NRF1, TFAM protein (Figs 5A, B and  6A, B) and relative content of mitochondrial DNA copy number (Figs 5C and  6H) in the SiO₂ group were reduced, and the differences were statistically significant (p < 0.05).

SiO₂ exposure interferes with the overexpression of PGC-1 alpha factor expression in cell models, promoting mitochondrial biogenesis and reducing the expression of fibrosis

We further analyzed the mechanism of mitochondrial biogenesis during silicosis. We first constructed a PGC-1α overexpression plasmid. Through RT-PCR detection of plasmid transfection, it was observed that the relative expression level of plasmid mRNA overexpressing the PGC-1α gene was increased in RLE-6TN cells transfected (as shown in Fig. 6B). To further observe the expression levels of mitochondrial biogenic markers PGC-1α, NRF1, TFAM protein, and fibrosis markers α-SMA protein and mRNA. The results showed that compared with the SiO₂ + OE-NC group, the SiO₂ + OE-PGC-1α group showed upregulation of mitochondrial biogenic markers PGC-1α, NRF1, TFAM protein (Fig 6A, C, D, and E) and mRNA levels (Fig. 6I, J, and K), while α-SMA protein and mRNA levels decreased (Fig. 6G and M) (p < 0.05). Compared with the SiO₂ + OE-NC group, the relative content of mitochondrial DNA (Fig. 6H) and CS protein and mRNA in the SiO₂ + OE-PGC-1α group were significantly increased (Fig. 6F and L). These differences were statistically significant (p< 0.05). In summary, the results indicate that overexpression of PGC-1α in RLE-6TN cells can promote mitochondrial biogenesis, upregulate CS, and alleviate fibrosis.

After SiO₂ exposure, knockout of RLE-6TN cells expressing PGC-1 alpha factor, mitochondrial biogenesis was downregulated and fibrosis was upregulated

We further analyzed the mechanism of mitochondrial biogenesis during silicosis. We constructed a PGC-1α knockout low-expression plasmid. Through qPCR detection of plasmid transfection, it was observed that the relative expression level of plasmid mRNA overexpressing the PGC-1α gene in RLE-6TN cells decreased (Fig. 7B). In order to further observe the expression levels of mitochondrial biogenic markers PGC-1α, NRF1, TFAM protein, and fibrosis markers α - SMA protein and mRNA, the results showed that compared with the SiO₂ + sh-RNA-NC group, the SiO₂ + sh-RNA-PGC-1α group showed that the mitochondrial biogenic markers PGC-1α, NRF1, TFAM protein (Fig. 7A, C, D, and E) and mRNA levels (Fig. 7I, J, and K) were downregulated, while α - SMA protein and mRNA were upregulated (Fig. 7G and M) (p < 0.05). Compared with the SiO₂ + shRNA NC group, the relative content of mitochondrial DNA Fig. 6H) and CS protein and mRNA (Fig. 6F and L) in the SiO₂ + shRNA PGC-1α group were significantly reduced. These differences were statistically significant (p < 0.05). In general, the results indicate that knocking out PGC-1α in RLE-6TN cells can weaken mitochondrial biogenesis, downregulate CS, and exacerbate fibrosis.

Fig. 7.

Knockdown of PGC-1α can reduce mitochondrial biogenesis in RLE-6TN cells exposed to silica. Knockdown of PGC-1α in RLE-6TN cells using plasmids led to a decrease in mRNA of PGC-1α (B). Western blot image of PGC-1α, NRF1, TFAM, CS, and α-SMA expression (A). Expression levels of PGC-1α protein (C). Expression levels of NRF1 protein (D). Expression levels of TFAM protein (E). Expression levels of CS protein (F). Expression levels of α-SMA protein (G). Expression levels of PGC-1α mRNA (H). Expression levels of NRF1 mRNA (I). Expression levels of TFAM mRNA (J). Expression levels of PGC-1α mRNA (K). Expression levels of CS mRNA (L). Expression levels of α-SMA mRNA (M). The result of the cell fraction is at least 3 independent experiments per group, repeated at least 3 times each. Values represent the mean ± SD. Significant difference: (*) p < 0.05, ^*p < 0.05 (compared with negative group), ^**p<0.01 (compared with negative group), ^***p < 0.001 (compared with negative group); ^#p < 0.05 (compared with the SiO₂ + OE-NC group), ^##p < 0.01 (compared with the SiO₂ + OE-NC group), ^###p < 0.001 (compared with the SiO₂ + OE-NC group).

Discussion

Pneumoconiosis is a chronic, progressive, irreversible, and incurable disease with a long latent period.^29,30 It is characterized by diffuse nodular fibrosis of the lungs that progresses and leads to decreased lung function, respiratory failure, and even death.³¹ The harm it causes is severe and it has significant social and economic impacts on workers and the health system.³² The exact mechanism of silica dust-induced pulmonary fibrosis remains unclear, and breakthrough therapeutic drugs or targeted treatment measures remain unavailable.³³ In recent years, mitochondria, energy factories, and metabolic centers within cells have become the focus of an important area of research with significant implications for the development of innovative methods for the prevention and treatment of pneumoconiosis.

Silicosis is mainly caused by pulmonary tissue fibrosis due to the inhalation of industrial dust. It is generally believed that when inhaled, dust particles with an aerodynamic diameter of 10–15 μm are mainly deposited in the upper respiratory tract. Dust below 5 μm, due to its small particle size, can enter the deep respiratory and alveolar areas, affecting lung tissue ventilation function. First, we measured the particle size of silica using scanning electron microscopy and found that the particle size of silica dust was all less than 5 μm (Fig. 1A), which is the main cause of pneumoconiosis. To construct an in vivo model of silicosis, we selected male Sprague–Dawley rats. Alveolar epithelial cells include type I and type II, among which type II epithelial cells are considered the stem cells of the alveoli. When the alveoli are damaged, the surface repair process mainly relies on type II epithelial cells, which have the potential to differentiate into type I epithelial cells. The proliferation rate of alveolar type II epithelial cells is crucial for the recovery of lung tissue following oxidative damage. Studies have shown that free SiO₂ dust can directly act on alveolar type II epithelial cells, inducing them to undergo EMT and differentiate into myofibroblasts, there by participating in pulmonary fibrosis.³⁴ Pulmonary fibrosis is a chronic, progressive, and fatal disease caused by the accumulation of a large number of fibroblasts and deposition of the extracellular matrix. The main cause of pulmonary fibrosis is repeated damage to alveolar epithelial cells (AECs), which is a critical step in the occurrence of pulmonary fibrosis and an important marker of pulmonary fibrosis injury.^35,36

Therefore, we selected the RLE-6TN cell line for the in vitro silicosis experiments. After undergoing silica poisoning, SD rats in the silicosis group became irritable over time, with their hair standing upright and rapid breathing. The lung tissue of the rats exposed to silica swelled and appeared grayish white, with diffuse miliary nodules clearly visible on the surface. The lung surface showed nodular protrusions, cysts, fused lesions with a hard texture, and scattered old bleeding points. The organ coefficient comprehensively reflects the effects of toxins on the organs. The increased organ coefficient of SD rats exposed to silica dust indicated changes in the lung tissue, such as congestion, edema, and hypertrophy.³⁷ Inflammation, silica nodules, and collagen deposition occurred in lung tissue stained with HE and MASSON in rats, and the expression of α-SMA and COL-I increased. This confirms that SiO₂ causes irreversible lung damage and pulmonary fibrosis. Exposure of RLE-6TN cells to silica results in changes in cell morphology, decreased cell proliferation ability, migration, and cloning abilities, and increased expression of α-SMA. This indicates that silica exposure caused cellular damage and fibrosis.

Mitochondria are crucial for normal cellular function and mitochondrial structure and dysfunction are closely associated with silicosis.³⁸ The mitochondria are extremely sensitive to environmental changes. When the external environment, such as nutrition and oxygen supply, changes, mitochondria make corresponding metabolic adaptations and are considered sensitive targets for toxic substances in the environment. AECIIs are active progenitor and secretory cells with high energy demand in the lungs, containing approximately 50% of the mitochondria in lung tissue.^39,40 This suggests the importance of mitochondrial quality and function in lung diseases, and that mitochondria can be a key target for the treatment of pneumoconiosis. Therefore, changes in mitochondrial structure and function may be an important mechanism of pneumoconiosis fibrosis. In order to observe the damage of silica to mitochondria, we observed SD rats and RLE-6TN cells exposed to SiO₂ through transmission electron microscopy. The results revealed a decrease in the number of mitochondria, blurred cristae, and significant swelling.

The main function of mitochondria is to produce ATP in the form of oxidative phosphorylation (OXPHOS), which is responsible for over 90% of ATP production in most cells. Ample evidence suggests that most of the ATP produced by mitochondria serves as the initial direct energy source for regulating critical cellular processes. ATP synthesis (oxidative phosphorylation) relies heavily on mitochondrial structural integrity. Toxin-stimulated cells can undergo changes in MOM permeability, leading to decreased MMP. Therefore, mitochondrial membrane potential can be used as an indicator of mitochondrial dysfunction.⁴¹ Prior studies have shown that mitochondrial dysfunction is closely related to Parkinson’s disease, Alzheimer’s disease, diabetes, multiple fibrosis idiopathic pulmonary fibrosis, cardiac fibrosis, and renal fibrosis.^42–44 Recently, mitochondrial dysfunction in fibrosis has become a popular research topic. Mitochondrial dysfunction is a novel driver of fibrosis.⁴⁵ In the pathogenesis of IPF, fibrosis can be reversed by blocking the abnormal epithelial-mesenchymal transition of epithelial cells.⁴⁶ We found that exposure to 100 mg/L silica decreased ATP activity and mitochondrial membrane potential in RLE-6TN cells. Research has shown⁴⁷ that the continuous inhalation of SiO₂ dust in patients with pneumoconiosis can damage the structure and function of the mitochondria, leading to a decrease in ATP production and mitochondrial membrane potential. Citrate synthase, the first rate-limiting enzyme in the TCA cycle, plays an important role in the regulation of mitochondrial energy metabolism.⁴⁸ For example, in the skeletal muscle cells of patients with chronic kidney disease, the expression of citrate synthase is significantly reduced, which inhibits the biogenic function of mitochondria, leading to a decrease in the number of mitochondria and ultimately resulting in mitochondrial dysfunction.⁴⁹ Mitochondrial dysfunction can trigger disorders in cellular energy metabolism and exacerbate pulmonary inflammation and fibrosis. In the experimental results of this study, compared to the control group, the relative expression levels of CS and mtDNA in the SiO₂ group were decreased (p< 0.05). These results indicate that SiO₂ exposure leads to mitochondrial structural damage in rats and RLE-6TN cells, as well as dysfunctions in energy metabolism processes, such as the tricarboxylic acid cycle response involved in CS.

Mitochondria are dynamic organelles that maintain their quantity, structure, and functional stability in response to changes in the physiological environment, making them highly adaptable. This process is called “mitochondrial homeostasis.”⁵⁰ Under normal circumstances, mitochondrial fusion and division are in a dynamic equilibrium state, and damaged mitochondria are removed through a mitochondrial quality control system. Damaged mitochondria maintain a steady state through a dynamic balance between mitochondrial biogenesis and clearance.⁵¹ Once this is imbalanced, mitochondrial dysfunction can occur. Therefore, inhibition of mitochondrial biogenesis is an important factor in mitochondrial dysfunction.⁵² Mitochondrial biogenesis is a regeneration process that maintains the number of mitochondria and replaces old, damaged mitochondria with new, healthy ones.⁵³ The PGC-1α-NRF1-TFAM pathway is a key regulatory pathway in mitochondrial biogenesis. Among them, PGC-1α is a key factor that can activate the substrate protein responsible for transcribing nuclear-encoded mitochondrial proteins and affect the modification of translated proteins. It has been confirmed in diseases like Parkinson’s that the expression level of PGC-1α is associated with mitochondrial dysfunction.⁵⁴ PGC-1α, as a potent transcriptional coactivator, can increase the level of intermediate transcription factor NRF1 and enhance its activation ability through interactions.⁵⁵ Furthermore, it activates the synthesis of TFAM and the expression of other mitochondrial proteins encoded by nuclear genes. This regulatory mechanism is crucial for maintaining the replication and transcription of mtDNA, thus driving an increase in the mitochondrial number. In this study, after exposure to silica in rats and RLE-6TN cells, the relative expression of mtDNA decreased in the SiO₂ group (P < 0.05), and the expression of PGC-1α, NRF1, and TFAM decreased. To further verify the role of PGC-1α-mediated mitochondrial biogenesis in silicosis. We overexpressed and downregulated the PGC-1α factor by constructing overexpression plasmids and shRNA plasmids to transfect cells. Compared with the SiO₂ + OE-NC group, the SiO₂ + OE-PGC-1α group showed an increase in mRNA and protein expression levels of PGC-1α, NRF1, TFAM, and CS, as well as an increase in the relative content of mtDNA (p < 0.05). Compared with the SiO₂ + shRNA-NC group, the expression levels of PGC-1α, NRF1, TFAM, and CS proteins were reduced in the SiO₂ + shRNA-PGC-1α group, while the mRNA expression levels of PGC-1α, NRF1, and CS were reduced in the SiO₂ + shRNA-PGC-1α group, and the relative expression level of mtDNA was reduced (p < 0.05). The TFAM mRNA expression level in the SiO₂ + shRNA-PGC-1α group increased, but there was no statistically significant difference compared to the SiO₂ + shRNA-NC group, and the expected effect was not observed. We further analyzed whether the reason may be the temporal and spatial isolation between transcription and translation, which are the two processes involved in gene expression in eukaryotic cells. The timing and location of these two processes may differ, leading to differences in transcription and translation levels.

Based on the above results, overexpression of the PGC-1α factor can interfere with the PGC-1α-NRF1-TFAM signaling pathway, increase the relative content of citrate synthase and mtDNA, promote mitochondrial biogenesis, and improve mitochondrial function. Interfering with the expression of the PGC-1α factor will inhibit mitochondrial biogenesis, and under SiO₂ exposure, it will exacerbate mitochondrial structure and dysfunction. In cell experiments, pulmonary fibrosis indicators showed that compared with the SiO₂ + OE-NC group, the SiO₂ + OE-PGC-1α group had a decrease in α -SMA mRNA and protein expression levels (p < 0.05). Compared with the SiO₂ + shRNA-NC group, the SiO₂ + shRNA-PGC-1α group showed an increase in α-SMA mRNA and protein expression levels (p < 0.05). The above indicates that upregulation of PGC-1α expression enhances the expression of citrate synthase and the relative content of mtDNA, reversing the damage of SiO₂ exposure to mitochondrial biogenesis and pulmonary fibrosis. It also suggests that SiO₂ exposure affects the expression of PGC-1α, affects its mitochondrial biogenesis function, and ultimately exacerbates pulmonary fibrosis damage.

Conclusions

The results of this study indicate that exposure to silica in rats and RLE-6TN cells leads to changes in the structure and function of mitochondria as well as obstacles in mitochondrial biogenesis. Upregulating the PGC-1α gene and activating the PGC-1α-NRF1-TFAM signaling pathway in RLE-6TN cells can promote mitochondrial biogenesis, increase the relative content of citrate synthase and mtDNA, improve mitochondrial function, and alleviate pulmonary fibrosis, interfering with PGC-1α expression, inhibiting mitochondrial biogenesis, and exacerbating fibrosis. Therefore, we speculate that the regulation of mitochondrial biogenesis may affect the development of silicosis-induced fibrosis; our results provide new evidence for the mechanism of SiO₂-induced silicosis. We will further investigate and confirm the effect of alleviating silicosis fibrosis by enhancing mitochondrial biogenesis function in clinical studies.

Institutional review board statement

The animal study protocol was approved by the Laboratory Animal Ethical and Welfare Committee of the Laboratory Animal Center, Ningxia Medical University (Approval No. 2022-G143).

Author contributions

Na Zhang (Conceptualization, Data curation, Formal analysis, Methodology, Writing), Xiaoqiang Han (Methodology, Data curation, Writing—Original draft), Mei Zhang (Formal analysis, Methodology), Daowei Liu (Methodology), Lulu Liu (Data curation, Methodology), Xin Ma (Methodology), Yu Xiong (Data curation), Huifang Yang (Conceptualization, Funding acquisition, Investigation, Project administration), and Zhihong Liu (Conceptualization, Formal analysis, Resources).

Funding

This study was supported by the National Natural Science Foundation of China (grant numbers 82260636, 82160608) and the Natural Science Foundation of Ningxia Hui Autonomous Region (grant number 2021BEB04059, 2021AAC02013, 2022AAC03141, 2021BEG02030), research projects at the school level of Ningxia Medical University (XT2020018). We would like to thank Editage (www.editage.cn) for English language editing.

Conflicts of interest. All authors declare that they have no conflict of interest.