Skip to main content
The Journal of Infectious Diseases logoLink to The Journal of Infectious Diseases
. 2024 Mar 25;230(2):403–410. doi: 10.1093/infdis/jiae143

Plasma Ribonuclease Activity in Antiretroviral Treatment–Naive People With Human Immunodeficiency Virus and Tuberculosis Disease

Oskar Olsson 1,2,, Rolf Søkilde 3, Fregenet Tesfaye 4,5, Sara Karlson 6, Sten Skogmar 7,8, Marianne Jansson 9, Per Björkman 10,11,✉,2
PMCID: PMC12102472  PMID: 38526179

Abstract

Background

The role of ribonucleases in tuberculosis among people with human immunodeficiency virus (HIV; PWH) is unknown. We explored ribonuclease activity in plasma from PWH with and without tuberculosis.

Methods

Participants were identified from a cohort of treatment-naive PWH in Ethiopia who had been classified for tuberculosis disease (HIV positive [HIV+]/tuberculosis positive [tuberculosis+] or HIV+/tuberculosis negative [tuberculosis−]). Ribonuclease activity in plasma was investigated by quantification of synthetic spike-in RNAs using sequencing and quantitative polymerase chain reaction and by a specific ribonuclease activity assay. Quantification of ribonuclease 1, 2, 3, 6, 7, and T2 proteins was performed by enzyme-linked immunosorbent assay. Ribonuclease activity and protein concentrations were correlated with markers of tuberculosis and HIV disease severity and with concentrations of inflammatory mediators.

Results

Ribonuclease activity was significantly higher in plasma of HIV+/tuberculosis+ (n = 51) compared with HIV+/tuberculosis− (n = 78), causing reduced stability of synthetic spike-in RNAs. Concentrations of ribonucleases 2, 3, and T2 were also significantly increased in HIV+/tuberculosis+ compared with HIV+/tuberculosis−. Ribonuclease activity was correlated with HIV viral load, and inversely correlated with CD4 cell count, mid–upper arm circumference, and body mass index. Moreover, ribonuclease activity was correlated with concentrations of interleukin 27, procalcitonin and the kynurenine-tryptophan ratio.

Conclusions

PWH with tuberculosis disease have elevated plasma ribonuclease activity, which is also associated with HIV disease severity and systemic inflammation.

Keywords: ribonuclease activity, tuberculosis, HIV, immune response, inflammation


Human immunodeficiency virus (HIV) infection is the strongest risk factor for progression of Mycobacterium tuberculosis (Mtb) infection to tuberculosis disease [1]. While the risk of tuberculosis is closely linked to CD4 cell count depletion [2], several additional mechanisms by which HIV affects Mtb-controlling immune responses have been demonstrated, such as preferential elimination of Mtb-specific CD4 T cells [3], impaired Mtb killing by macrophages [4], and reduced Mtb antigen presentation by dendritic cells [5], as well as dysfunctional immune regulation [6].

Ribonucleases are involved in the host defense against different pathogens [7]. For example, ribonuclease L and the monocyte chemotactic protein–­induced proteins are key intracellular immunoregulatory factors with ribonuclease activity [8, 9]. The ribonuclease A family (ribonucleases 1–13) and ribonuclease T2 are secreted extracellularly by different immune cells, such as macrophages, neutrophils, and eosinophils, and exert diverse functions such as cell death, chemoattraction, and immune modulation [7, 10]. Within the ribonuclease A family, ribonuclease 3 (also called eosinophil cationic protein) and 7 have the capacity to inhibit the growth of mycobacteria [11, 12] and concentrations of ribonuclease 2 (also called eosinophil-derived neurotoxin) have been reported to be increased in the blood of people with tuberculosis disease compared with individuals with latent tuberculosis infection [13]. Members of the ribonuclease A family have also been shown to have antiviral activity against HIV [14, 15]. However, the role of host ribonucleases in HIV and tuberculosis coinfection remains largely unknown.

As part of a large ongoing project on immune mediators in people with HIV (PWH) with tuberculosis, we have investigated the role of small noncoding RNA [16]. In pilot studies, we observed signs of increased ribonuclease activity in plasma from PWH with tuberculosis disease. This preliminary finding encouraged us to perform the current study, with the aim to explore ribonuclease activity in plasma from PWH with or without tuberculosis disease, to evaluate specific ribonuclease proteins that may contribute to the ribonuclease activity, and to investigate associations between ribonuclease activity and markers of tuberculosis and HIV disease severity.

METHODS

Study Participants and Sampling

Participants included in the current study were part of a prospective cohort of PWH meeting criteria for antiretroviral therapy initiation according to 2010 Ethiopian guidelines (World Health Organization stage 4 or CD4 cell count <350/μL), recruited at health centers in the uptake area of Adama, Ethiopia, between 2011 and 2013 [17, 18]. At inclusion, all cohort participants underwent bacteriological sputum investigations for tuberculosis (liquid culture, Gene Xpert MTB/RIF, and smear microscopy), regardless of symptoms. Fine-needle aspiration samples for similar bacteriological analyses were obtained from participants with peripheral lymphadenopathy. All tuberculosis cases were confirmed by ≥1 of these microbiological methods. Participants were accordingly classified as either HIV positive (HIV+)/tuberculosis positive (tuberculosis+) or HIV+/tuberculosis negative (tuberculosis−). In addition, individuals in the latter group were required to remain in care for the first 6 months after inclusion, without developing tuberculosis disease during this time period. All individuals meeting these criteria with available plasma samples were included in the current study. Sampling included venous blood collected for CD4 cell count, complete blood cell count, and separation of plasma for HIV viral load quantification. Remaining plasma was aliquoted and stored at −80° C. Aliquots of plasma were shipped on dry ice to the Biomedical Medical Center, Lund University, Lund, Sweden.

RNA Extraction and Quantification of RNA Spike-Ins

For quantification of RNA spike-ins, RNA was isolated from plasma using the miRNeasy serum/plasma advanced kit (Qiagen). Briefly 200 µL of plasma was mixed with 60 µL of RPL buffer, and subsequently synthetic RNA spike-ins were added, either intended for quantitative polymerase chain reaction (qPCR) (RNA Spike-In Kit for RT; Qiagen), or for next-generation sequencing (QIAseq microRNA [miRNA] Library QC Spike-Ins; Qiagen). The subsequent protocol followed the instructions of the manufacturer (Qiagen), and extracted RNA was eluted in 20 µL of water. Sequencing was performed at Qiagen’s facility in Hilden, Germany, using NextSeq (Illumina). The data were aligned to the miRNA reference database miRbase (version 22) and subsequently to the known sequences of the synthetic spike-ins and read counts of the spike-ins were determined.

For reverse-transcription, each reaction contained 4 µL of RNA, 1 µL of nucleotide mix, 1 µL of adenosine triphosphate, 1 µL of Escherichia coli poly-A polymerase, 1 µL of M-MuLV reverse-transcriptase (all from New England Biolabs), 1 µL of primers. And 0.5 µL of cel-miR-39 (Qiagen) as a spike-in control. The mix was incubated at 42°C for 60 minutes, followed by an enzyme inactivation step at 95°C for 5 minutes. The generated complementary DNA was diluted 1:170 and run in qPCR reactions consisting of 3 µL of diluted complementary DNA, 10 µL of SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories), 1 µL of each primer, and 5 µL of nuclease-free water. DNA primers were designed with the software miRprimer (Version 1) [19]. The cycling protocol was 95°C for 30 seconds, then 45 cycles with 30 seconds at 60°C and 15 seconds at 95°C, on a CFX Real-Time System (Bio-Rad Laboratory). The cycle threshold (Ct) values of the synthetic spike-ins were determined.

Quantification of Ribonuclease Activity

Ribonuclease activity in plasma was quantified using the RNAseAlert assay (Integrated DNA Technologies). Plasma was diluted 1:105 and run in 100-µL reactions containing 10 µL of diluted sample, 10 µL of reaction buffer, 70 µL of ribonuclease free water and 10 µL of RNAseAlert substrate (a fluorophore-emitting RNA). Degradation of the fluorophore-emitting RNA generates fluorescence, indicating ribonuclease activity. Fluorescence was read using a 480-nm excitation and 530-nm emission filter on a Victor Nivo Multimode Plate Reader (PerkinElmer).

Enzyme-Linked Immunosorbent Assay for Ribonuclease Protein Quantification

Ribonuclease 3, 6, and 7 proteins in plasma were quantified using enzyme-linked immunosorbent assay (ELISA) kits (Cloud-Clone). In brief, plasma was diluted 1:1 and 100 µL was used in the ELISA according to the manufacturer's instructions. Ribonuclease 1, 2, and T2 concentrations in plasma were quantified using ELISA kits (MyBioSource), and plasma samples were diluted 1:4, 1:1, and 1:19, respectively, and 100 µL of diluted plasma was used in the ELISA, according to the manufacturer's instructions. Results were read on a Multiskan FC Microplate Photometer (Thermo Fisher Scientific).

Quantification of Systemic Inflammation and Immunoregulatory Markers

Plasma concentrations of inflammation markers—including chemokine (C-C motif) ligand 5 (CCL5), C-reactive protein (CRP), interleukin 6 (IL-6), 12p70, 18 (IL-18), and 27, interferon γ–induced protein 10, procalcitonin (PCT), and soluble urokinase plasminogen activator receptor—had previously been measured using Magnetic Luminex Assay (R&D) [17]. In addition, ratios of kynurenine to tryptophan (KT ratios) had been measured using liquid chromatography–mass spectrometry at Red Glead Discovery in Lund, Sweden [20], and neutrophil counts had been determined for all patients at enrollment using FACSCalibur or FACScount (Beckton Dickinson).

Data Analysis and Statistics

The read count of sequencing spike-ins and Ct values of qPCR spike-ins were considered indicators of ribonuclease activity. Read count of spike-ins from sequencing, the Ct values from the qPCR, and the results of the ELISAs and the RNAseAlert assay were compared between HIV+/tuberculosis+ and HIV+/tuberculosis− participants, using the Mann-Whitney U test. Discriminatory capacity was assessed using receiver operating characteristic curves and presented as area under the curve values with 95% confidence intervals (CIs). These indicators of ribonuclease activity, as well as individual ribonuclease concentrations, were also correlated with continuous variables using Spearman rank correlation. The P values were corrected according to the Holm-Bonferroni method (with significance threshold adjustment considering the number of variables in each category: ribonuclease activity indicators, ribonucleases, HIV markers, clinical markers, and inflammation markers). Linear regression was performed with tuberculosis status and log-transformed CD4 cell count as predictors to assess whether both tuberculosis and HIV independently contributed to ribonuclease activity.

Ethical Considerations

Ethical approval was obtained from the National Research Ethics Review Committee at the Ministry of Science and Technology of Ethiopia (no. 3.10/825/05) and the Regional Ethical Review Board at Lund University, Lund, Sweden (no. 2010/672).

RESULTS

Participant Characteristics

Among the cohort participants, 137 had bacteriologically confirmed tuberculosis. For the current study, stored plasma samples were available from 51 HIV+/tuberculosis+ and 78 HIV+/tuberculosis− individuals. Among HIV+/tuberculosis+ individuals, 44 had pulmonary tuberculosis, 1 had peripheral lymph node tuberculosis, and 6 had both pulmonary and peripheral lymph node tuberculosis. Of the 50 participants with pulmonary tuberculosis, 29 were Xpert positive and 47 had Mtb growth in liquid culture. Additional study participant characteristics are displayed in Table 1.

Table 1.

Characteristics of Study Participants

Characteristic Value, Median (IQR)a
HIV+/Tuberculosis+ Participants HIV+/Tuberculosis− Participants
Female sex, no./total (%) 24/51 (47) 44/78 (56)
Age, y 33 (28–40) 32 (27–39)
Mid–upper arm circumference, cm 22 (20–24) 23 (21–25)
BMIb 18.0 (16.7–19.6) 19.3 (18.4–21.1)
CD4 cell count, cells/μL 182 (105–308) 226 (155–336)
HIV viral load, log10 copies/mL 5.3 (4.7–5.6) 5.0 (4.1–5.4)
Tuberculosis positive, no./total (%)
 Sputum Gene Xpert 29/51 (57)
 Sputum culture positive 47/51 (92)
 Sputum smear positive 8/51 (16)

Abbreviations: BMI, body mass index; HIV, human immunodeficiency virus; HIV+/tuberculosis+, HIV-positive/tuberculosis-positive; HIV+/tuberculosis−, HIV-positive/tuberculosis-negative.

aData represent median (IQR) unless otherwise specified.

bBMI calculated as weight in kilograms divided by height in meters squared.

Association of Plasma Ribonuclease Activity With Tuberculosis Disease in PWH

To study ribonuclease activity in HIV+/tuberculosis+ and HIV+/tuberculosis−, we initially studied the stability of synthetic spike-in RNA in plasma of the study participants using sequencing. Results from sequencing revealed that spike-in RNA read counts were lower in HIV+/tuberculosis+ than in HIV+/tuberculosis− individuals (P < .05 in all but one of the 52 spike-ins) (Figure 1A). The read counts of all different sequencing RNA spike-ins showed strong intercorrelation (all P < .05; median Spearman ρ = 0.92). Hence, we here present results only for UniSp101 (sequence uaccaaccuuucaucguuccc; hereafter referred to as sequencing spike-in).

Figure 1.

Figure 1.

Ribonuclease activity in plasma of human immunodeficiency virus (HIV)–positive (HIV+)/tuberculosis-positive (tuberculosis+) and HIV+/tuberculosis-negative (tuberculosis−) participants, assessed by different methods. A, Sequencing spike-in read count. B, Cycle threshold (Ct) values for quantitative polymerase chain reaction (qPCR) spike-in, where a higher Ct value indicates later detection of the RNA (ie, increased ribonuclease activity), C, Log10 fluorescence in the RNAseAlert assay, where more fluorescence indicates more ribonuclease activity. A–C, *P < .05; **P < .01 (Mann-Whitney U test). D, Correlation plot between RNAseAlert fluorescence and Ct value for qPCR spike-in. HIV+/tuberculosis− samples are indicated by blue dots, and HIV+/tuberculosis+ samples by red dots. Spearman ρ and P values are given in the top right corner.

These results spurred further studies using qPCR for quantification of 2 synthetic RNA spike-ins, UniSp2 and UniSp4, which were added to the plasma of all study participants (n = 125; 4 samples from the sequencing experiments were excluded from further analysis due to a technical error). The levels (analyzed as Ct values of the qPCR reaction, where higher values indicate later detection of RNA, ie, higher ribonuclease activity) of these 2 spike-ins were closely correlated (ρ = 0.97; P < .01), and for this reason only results of UniSp2 (sequence guacucggcuuacgaucguaa; hereafter referred to as qPCR spike-in) are described further. In line with results obtained by sequencing, the Ct values of qPCR spike-in were higher in HIV+/tuberculosis+ than in HIV+/tuberculosis− participants (P < .01) (Figure 1B). Ct values of spike-ins added at the reverse-transcription and the qPCR stages were unaltered by tuberculosis status, showing that interference with these steps was not the factor causing these findings.

To confirm that these changes indeed reflected ribonuclease activity in plasma, we next set out to analyze a subset of randomly chosen plasma samples from study participants (41 HIV+/tuberculosis−, 37 HIV+/tuberculosis+) using the RNAseAlert assay, which quantifies ribonuclease activity by the generation of fluorescence from degradation of an RNA fluorescent probe (sequence not publicly available) in the presence of ribonucleases. This confirmed higher ribonuclease activity in plasma of HIV+/tuberculosis+ than in HIV+/tuberculosis−, participants (P < .01) (Figure 1C). RNAseAlert results were also correlated with the stability of qPCR spike-in, assessed as Ct values in the qPCR (ρ = 0.40; P < .01) (Figure 1D) but not significantly with results of sequencing spike-in.

We further assessed the discriminatory potential for tuberculosis with receiver operating characteristic analysis, and the area under the curve values were 0.80 (95% CI, .61–1.00 for sequencing spike-in, 0.81 (.74–.89) for qPCR spike-in, and 0.72 (.60–.84) for RNAseAlert ribonuclease activity (Supplementary Figure 1). Taken together, these results show that plasma ribonuclease activity is elevated in PWH during tuberculosis disease, as supported by both synthetic spike-in RNA stability and an enzymatic activity assay.

Association of Plasma Ribonuclease Activity With Markers of Tuberculosis and HIV Disease Severity

Next, we assessed correlations between plasma ribonuclease activity and variables linked to tuberculosis and HIV disease severity. We found a significant inverse correlation between CD4 cell count and ribonuclease activity assessed by the RNAseAlert assay (ρ = −0.39; P < .01). Plasma RNAseAlert ribonuclease activity was weakly positively correlated with viral load (ρ = 0.24; P = .03). We also analyzed whether RNAseAlert ribonuclease activity was related to wasting, and we found significantly higher activity with lower body mass index (ρ = −0.34; P < .01) and lower mid­­–upper arm circumference (ρ = −0.46; P < .01).

Furthermore, to determine whether plasma ribonuclease activity was associated with Mtb bacterial burden, we compared the pulmonary tuberculosis groups with regard to detection of tuberculosis by Gene Xpert MTB/RIF compared with cases detected only with liquid culture. We found no differences in RNAseAlert ribonuclease activity or qPCR spike-in stability between these groups, but levels of sequencing spike-in were lower in plasma of HIV+/tuberculosis+ participants (median read count, 8520 vs 18184; P = .02, albeit not significant after adjusting for multiple testing). Both tuberculosis status and CD4 cell count remained independently significant when combined as predictors of qPCR spike-in and RNAseAlert ribonuclease activity in a linear regression model (P < .05), suggesting independent contributions of tuberculosis disease and HIV-related immunodeficiency to plasma ribonuclease activity.

We also assessed associations between ribonuclease activity and levels of plasma markers of systemic inflammation. The RNAseAlert ribonuclease activity was significantly correlated with interleukin 2 concentration (ρ = 0.46; P < .01), KT ratio (ρ = 0.42; P < .01), and PCT concentration (ρ = 0.56; P < .01) (Supplementary Table 1). The association between these markers and the stability of qPCR spike-in was overall weaker, and degradation of qPCR spike-in did instead show correlation with certain other markers including CRP, IL-6 and IL-18 (all P < .01) (Supplementary Table 1).

Elevated Plasma Concentrations of Specific Ribonuclease Proteins in PWH With Tuberculosis Disease

To explore specific ribonucleases that contributed to the increased ribonuclease activity noted in HIV+/tuberculosis+ individuals, we quantified plasma concentrations of specific ribonuclease proteins by ELISA. For this purpose, we selected proteins that previously have been reported to be secreted extracellularly and that have been associated with infectious diseases, [7], including ribonuclease 1, 2, 3, 6, 7, and T2.

Concentrations of ribonucleases 2, 3, and T2 were found to be significantly greater in plasma of HIV+/tuberculosis+ than in HIV+/tuberculosis− participants (P < .01) (Figure 2A2C) and to be correlated with RNAseAlert ribonuclease activity (ρ = 0.42 and P < .01, ρ = 0.28 and P = .02], and ρ = 0.49 and P < .01, respectively) (Supplementary Figure 2A–2C). The area under the curve values for tuberculosis of these ribonucleases were 0.71 (95% CI, .59–.84) for ribonuclease 2, 0.75 (.63–.88) for ribonuclease 3, and 0.72 (.60–.85) for ribonuclease T2 (Supplementary Figure 1). In contrast, we found no significant associations between ribonuclease 1, 6, or 7 and tuberculosis disease, nor with total ribonuclease activity. In summary, the findings suggest that ribonucleases 2, 3, and T2 may contribute to the increased ribonuclease activity observed in HIV+/tuberculosis+ individuals.

Figure 2.

Figure 2.

Plasma concentrations of specific ribonuclease proteins in immunodeficiency virus (HIV)–positive (HIV+)/tuberculosis-positive (tuberculosis+) and HIV+/tuberculosis-negative (tuberculosis−) participants, including concentrations of ribonuclease 2 (A), ribonuclease 3 (B), and ribonuclease T2 (C). Single asterisks (*) indicate outliers with their true values. **P < .01 (Mann-Whitney U test).

Both ribonuclease 2 and T2 showed similar correlations with CD4 cell count, HIV viral load, mid–upper arm concentration, and body mass index as those found for total ribonuclease activity. Ribonuclease 2 showed significant correlations with KT ratio and CRP, IL-6, IL-18, PCT, and soluble urokinase plasminogen activator receptor concentrations, of which the strongest correlation was with IL-6 (ρ = 0.63; P < .01) (Supplementary Table 1). In addition, ribonuclease T2 concentrations were correlated with KT ratio and IL-6, IL-18, and PCT plasma concentrations (ρ = 0.41–0.45; P < .01) (Supplementary Table 1).

DISCUSSION

Ribonucleases are involved in the regulation of immune responses against several pathogens [7, 10], but their role in tuberculosis/HIV coinfection remains largely unknown. Here, we report elevated ribonuclease activity in PWH with tuberculosis disease, as compared with PWH without tuberculosis disease. We further show that ribonuclease activity is associated with markers of disease severity in PWH with tuberculosis disease.

Our study is the first to show elevated ribonuclease activity in plasma from PWH with tuberculosis disease. The observed ribonuclease activity in PWH with tuberculosis disease could be part of host defense against Mtb. Ribonuclease activity may also be involved in the pathogenesis of HIV-related tuberculosis disease, like other infectious disease conditions characterized by dysregulated immune reactions, such as sepsis [21]. Since we did not include HIV-negative participants categorized for tuberculosis disease, we cannot determine whether the differences observed are restricted to PWH; it is possible that elevated ribonuclease activity occurs in individuals with tuberculosis disease regardless of HIV coinfection.

We identified 3 specific ribonucleases—ribonucleases 2, 3, and T2—that to a degree could contribute to the elevated plasma ribonuclease activity in PWH with tuberculosis disease. The finding of elevated concentration of ribonuclease 2 is in accordance with a study in Indian HIV-negative patients with tuberculosis [13]. However, the concentrations found among participants in our study were higher than those in HIV-negative persons, suggesting that HIV enhances this response. In contrast to our findings, Moideen et al [13] did not find any difference in ribonuclease 3 concentrations between individuals with tuberculosis disease and those with latent tuberculosis infection. This could point to a specific effect of HIV-tuberculosis coinfection on this ribonuclease. Ribonuclease 2 and 3 (eosinophil-derived-neurotoxin and eosinophil cationic proteins) are closely linked to eosinophil degranulation [22]. In fact, ribonuclease T2 is also highly expressed in eosinophils [10].

Although this cell type is not classically linked to tuberculosis immune responses, animal studies have demonstrated recruitment of eosinophils to the sites of Mtb infection [23], and Moideen et al [13] found eosinophil degranulation in peripheral blood of individuals with tuberculosis. In our study, ribonuclease 2 concentrations were also significantly correlated with several inflammation markers, with the strongest correlation to IL-6; a finding in line with a study showing that IL-6 was the dominant cytokine secreted from ribonuclease 2–stimulated dendritic cells [24]. Ribonuclease 2 is a chemoattractant of dendritic cells [25] and may consequently play a role in Mtb antigen presentation. Ribonuclease 3 has been shown to inhibit mycobacterial growth, both through direct antibacterial properties and by induction of autophagy [11, 12]. As ribonucleases 2 and 3 have been shown to have the capacity to restrict HIV—and mycobacteria—these types of proteins could be an interesting area for research on host-directed therapy in HIV-tuberculosis coinfection [11, 15].

The above associations suggest that these ribonucleases play a role in the host defense against tuberculosis. They may also be involved in the excessive immune response to tuberculosis that leads to tissue damage and disease. Interestingly, ribonuclease T2 has been shown to be down-regulated in sputum from people with latent tuberculosis infection [26]. This could suggest that down-regulation of ribonuclease T2 is a protective mechanism, establishing latency rather than leading to active disease accompanied by inflammation and tissue destruction.

In parallel experiments on small noncoding RNA expression in plasma from participants in the study cohort, we found no signs of general degradation of endogenous RNA (data not shown). This could be considered contradictory to the findings in the current study on the patterns of spike-in RNA stability. However, one explanation could be that RNA in plasma is protected in different ways, for example, in exosomes [27] or bound to proteins [28], which could lead to better stability compared with exogenously added spike-in RNA. It is also possible that extracellular RNAs exert functions that are difficult to elucidate ex vivo due to rapid degradation by ribonucleases. The true in vivo patterns of miRNA might not be reflected here owing to ribonuclease degradation. Ribonuclease activity may be an overlooked aspect in the research of RNA expression. While altered miRNA profiles in tuberculosis are most often reported to be due to impact on the expression of miRNA [29], altered degradation of miRNA may also affect these findings. Our findings on limited stability of exogenous spike-in RNAs can also have implications for the laboratory setup of studies on RNA expression using spike-in RNAs for the purpose of quantification, especially when samples from individuals with high degree of inflammation are used. During RNA extraction in the current study the ribonuclease-inactivating buffer was added to plasma before RNA spike-ins. However, it is still not clear why some ribonuclease activity remained.

Host ribonucleases could become potential biomarkers for clinical use in different fields of medicine [21]. However, similar to other mediators involved in inflammatory reactions, increased ribonuclease activity occurs in a range of conditions [21, 30], and the specificity of such markers might therefore be low. Here, the discriminatory potential did not approach the required performance of a tuberculosis biomarker [31].

Mtb encodes several ribonucleases, mainly involved in regulating bacterial RNA turnover, thereby regulating bacterial growth [32]. It is possible that during some circumstances these also could be secreted as a way of interacting with host protein synthesis. Given the moderate correlation between the specific host ribonucleases studied here and the total ribonuclease activity, as well as the fact that our indicators of ribonuclease activity showed modest or no intercorrelation, we cannot exclude the possibility that Mtb-encoded ribonucleases contribute to these phenomena. Although this is beyond the scope of our study, investigations of the role of these enzymes in tuberculosis/HIV coinfection would be of interest to further elucidate this topic.

The strengths of this study include the clearly defined study groups, reducing the risk of misclassification. In particular, tuberculosis disease was excluded in HIV+/tuberculosis− participants; apart from negative tuberculosis bacteriological results at inclusion, they were also required to remain in care without incident tuberculosis for >6 months after enrollment. We have also confirmed our findings by means of several techniques, including measurement of spike-in RNA stability using sequencing and qPCR, as well as a ribonuclease activity assay and ELISA for specific proteins. Furthermore, we have correlated our findings on ribonuclease activity and specific ribonucleases with data on several other markers of inflammation and immunoregulation, strengthening the biological plausibility. This study also has certain limitations. Although we were able to correlate the overall ribonuclease activity with three host ribonucleases that were increased in HIV+/tuberculosis+, it is likely that other factors not investigated here are also involved.

In conclusion, this study demonstrates that plasma ribonuclease activity is elevated in PWH with tuberculosis disease, and it shows that ribonuclease activity is correlated with tuberculosis and HIV disease severity, as well as with mediators of systemic inflammation. Further studies on ribonucleases in tuberculosis disease are warranted, both to characterize their role in pathogenesis and to explore their potential as biomarkers.

Supplementary Data

Supplementary materials are available at The Journal of Infectious Diseases online (http://jid.oxfordjournals.org/). Supplementary materials consist of data provided by the author that are published to benefit the reader. The posted materials are not copyedited. The contents of all supplementary data are the sole responsibility of the authors. Questions or messages regarding errors should be addressed to the author.

Supplementary Material

jiae143_Supplementary_Data

Contributor Information

Oskar Olsson, Clinical Infection Medicine, Department of Translational Medicine, Lund University, Malmö, Sweden; Department of Infectious Diseases, Skåne University Hospital, Malmö/Lund, Sweden.

Rolf Søkilde, Department of Clinical Medicine, Translational Neuropsychiatry Unit, Aarhus University, Aarhus, Denmark.

Fregenet Tesfaye, Clinical Infection Medicine, Department of Translational Medicine, Lund University, Malmö, Sweden; Armauer Hansen Research Institute, Addis Ababa, Ethiopia.

Sara Karlson, Department of Laboratory Medicine, Lund University, Lund, Sweden.

Sten Skogmar, Clinical Infection Medicine, Department of Translational Medicine, Lund University, Malmö, Sweden; Department of Infectious Diseases, Skåne University Hospital, Malmö/Lund, Sweden.

Marianne Jansson, Department of Laboratory Medicine, Lund University, Lund, Sweden.

Per Björkman, Clinical Infection Medicine, Department of Translational Medicine, Lund University, Malmö, Sweden; Department of Infectious Diseases, Skåne University Hospital, Malmö/Lund, Sweden.

Notes

Acknowledgments. First, we thank all the study participants. We also extend our gratitude to the staff at the health centers, the Adama Public Health Research and Referral Laboratory Center, and the Adama LU/AHRI research site team. Finally, we thank the Oromia Health Bureau for their support of this study.

Author contributions. Conceptualization: O. O., R. S., F. T., M. J., and P. B. Laboratory work: O. O., S. K., and M. J. Bioinformatic support: R. S. Cowriting of manuscript: O. O., R. S., S. S, M. J., and P. B. All authors contributed to data analysis and revised and approved the final version of the manuscript.

Disclaimer. The funding sources did not affect the content of this publication.

Financial support. This work was supported the Swedish Research Council (grant 2019-01439 to M. J.), the Hjärt-Lungfonden (grant 20170258), the Myndigheten för Samhällskydd och Beredskap (MSB), the Swedish Medical Association (support to P. B.), a donation to Lund University (grants to P. B.), the Kungliga Fysiografiska Sällskapet i Lund (grant to O. O.), and the Swedish Physicians Against Stiftelsen Läkare mot Aids Forskningsfond (grant to O. O.)

References

  • 1. Ai  JW, Ruan  QL, Liu  QH, Zhang  WH. Updates on the risk factors for latent tuberculosis reactivation and their managements. Emerg Microbes Infect  2016; 5:e10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Esmail  H, Riou  C, du Bruyn  E, et al.  The immune response to Mycobacterium tuberculosis in HIV-1-coinfected persons. Annu Rev Immunol  2018; 36:603–38. [DOI] [PubMed] [Google Scholar]
  • 3. Geldmacher  C, Schuetz  A, Ngwenyama  N, et al.  Early depletion of Mycobacterium tuberculosis-specific T helper 1 cell responses after HIV-1 infection. J Infect Dis  2008; 198:1590. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Pathak  S, Wentzel-Larsen  T, Åsjö  B. Effects of in vitro HIV-1 infection on mycobacterial growth in peripheral blood monocyte-derived macrophages. Infect Immun  2010; 78:4022–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Singh  SK, Andersson  AM, Ellegård  R, et al.  HIV interferes with Mycobacterium tuberculosis antigen presentation in human dendritic cells. Am J Pathol  2016; 186:3083–93. [DOI] [PubMed] [Google Scholar]
  • 6. Bell  LCK, Pollara  G, Pascoe  M, et al.  In vivo molecular dissection of the effects of HIV-1 in active tuberculosis. PloS Pathog  2016; 12:e1005469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Gupta  SK, Haigh  BJ, Griffin  FJ, Wheeler  TT. The mammalian secreted RNases: mechanisms of action in host defence. Innate Immun  2013; 19:86–97. [DOI] [PubMed] [Google Scholar]
  • 8. Ezelle  HJ, Malathi  K, Hassel  BA. The roles of RNase-L in antimicrobial immunity and the cytoskeleton-associated innate response. Int J Mol Sci  2016; 17:74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Jin  Z, Zheng  E, Sareli  C, Kolattukudy  PE, Niu  J. Monocyte chemotactic protein-induced protein 1 (MCPIP-1): a key player of host defense and immune regulation. Front Immunol  2021; 12:727861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Wu  L, Xu  Y, Zhao  H, Li  Y. RNase T2 in inflammation and cancer: immunological and biological views. Front Immunol  2020; 11:540254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Pulido  D, Torrent  M, Andreu  D, Nogues  MV, Boix  E. Two human host defense ribonucleases against mycobacteria, the eosinophil cationic protein (RNase 3) and RNase 7. Antimicrob Agents Chemother  2013; 57:3797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Lu  L, Arranz-Trullén  J, Prats-Ejarque  G, Pulido  D, Bhakta  S, Boix  E. Human antimicrobial RNases inhibit intracellular bacterial growth and induce autophagy in mycobacteria-infected macrophages. Front Immunol  2019; 10:1500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Moideen  K, Kumar  NP, Nair  D, Banurekha  VV, Bethunaickan  R, Babu  S. Heightened systemic levels of neutrophil and eosinophil granular proteins in pulmonary tuberculosis and reversal following treatment. Infect Immun  2018; 86:e00008–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Cocchi  F, DeVico  AL, Lu  W, et al.  Soluble factors from T cells inhibiting X4 strains of HIV are a mixture of β chemokines and RNases. Proc Natl Acad Sci U S A  2012; 109:5411–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Bedoya  VI, Boasso  A, Hardy  AW, Rybak  S, Shearer  GM, Rugeles  MT. Ribonucleases in HIV type 1 inhibition: effect of recombinant RNases on infection of primary T cells and immune activation-induced RNase gene and protein expression. AIDS Res Hum Retroviruses  2006; 22:897–907. [DOI] [PubMed] [Google Scholar]
  • 16. Olsson  O, Tesfaye  F, Søkilde  R, et al.  Expression of microRNAs is dysregulated by HIV while Mycobacterium tuberculosis drives alterations of small nucleolar RNAs in HIV positive adults with active tuberculosis. Front Microbiol  2022; 12:808250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Olsson  O, Björkman  P, Jansson  M, et al.  Plasma profiles of inflammatory markers associated with active tuberculosis in antiretroviral therapy-naive human immunodeficiency virus-positive individuals. Open Forum Infect Dis  2019; 6:ofz015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Reepalu  A, Balcha  TT, Skogmar  S, Guner  N, Sturegard  E, Bjorkman  P. Factors associated with early mortality in HIV-positive men and women investigated for tuberculosis at Ethiopian health centers. PloS One  2016; 11:e0156602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Busk  PK. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics  2014; 15:29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Olsson  O, Skogmar  S, Tesfaye  F, Mulleta  D, Jansson  M, Björkman  P. Kynurenine/tryptophan ratio for detection of active tuberculosis in adults with HIV prior to antiretroviral therapy. AIDS  2022; 36:1245–53. [DOI] [PubMed] [Google Scholar]
  • 21. Martin  L, Koczera  P, Simons  N, et al.  The human host defense ribonucleases 1, 3 and 7 are elevated in patients with sepsis after major surgery—a pilot study. Int J Mol Sci  2016; 17:294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Lu  L, Li  J, Moussaoui  M, Boix  E. Immune modulation by human secreted RNases at the extracellular space. Front Immunol  2018; 9:1012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Prakash Babu  S, Narasimhan  PB, Babu  S. Eosinophil polymorphonuclear leukocytes in TB: what we know so far. Front Immunol  2019; 10:490232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Yang  D, Chen  Q, Rosenberg  HF, et al.  Human ribonuclease a superfamily members, eosinophil-derived neurotoxin and pancreatic ribonuclease, induce dendritic cell maturation and activation. J Immunol  2004; 173:6134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Yang  D, Rosenberg  HF, Chen  Q, Dyer  KD, Kurosaka  K, Oppenheim  JJ. Eosinophil-derived neurotoxin (EDN), an antimicrobial protein with chemotactic activities for dendritic cells. Blood  2003; 102:3396–403. [DOI] [PubMed] [Google Scholar]
  • 26. HaileMariam  M, Yu  Y, Singh  H, et al.  Protein and microbial biomarkers in sputum discern acute and latent tuberculosis in investigation of pastoral Ethiopian cohort. Front Cell Infect Microbiol  2021; 11:595554. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Zhang  J, Li  S, Li  L, et al.  Exosome and exosomal microRNA: trafficking, sorting, and function. Genomics Proteomics Bioinformatics  2015; 13:17–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Arroyo  JD, Chevillet  JR, Kroh  EM, et al.  Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc Natl Acad Sci U S A  2011; 108:5003–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Daniel  EA, Sathiyamani  B, Thiruvengadam  K, Vivekanandan  S, Vembuli  H, Hanna  LE. MicroRNAs as diagnostic biomarkers for tuberculosis: a systematic review and meta- analysis. Front Immunol  2022; 13:954396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Kottel  RH, Hoch  SO, Parsons  RG, Hoch  JA. Serum ribonuclease activity in cancer patients. Br J Cancer  1978; 38:280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Denkinger  CM, Kik  SV, Cirillo  DM, et al.  Defining the needs for next generation assays for tuberculosis. J Infect Dis  2015; 211(suppl 2):S29–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Zhu  L, Zhang  Y, Teh  JS, et al.  Characterization of mRNA interferases from Mycobacterium tuberculosis. J Biol Chem  2006; 281:18638–43. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

jiae143_Supplementary_Data

Articles from The Journal of Infectious Diseases are provided here courtesy of Oxford University Press

RESOURCES