Abstract
Objective
Small cell lung cancer (SCLC) is a highly malignant subtype of lung cancer. Cancer stem cell (CSC)-like cells have been implicated in chemoresistance and recurrence. Although previous studies have demonstrated the significance of WASP-interacting protein (WIPF1) in malignant tumors, its underlying molecular mechanism in SCLC is not well known. Here, we demonstrate that WIPF1 can regulate tumorigenesis and its underlying molecular mechanism in SCLC.
Methods
Sphere-formation culture effectively enriches CSC-like cells, such as tumor stem cell-like cells. RNA-seq was used to identify differentially expressed genes between enriched CSCs (3D cultures) and differentiated cells. Next, we adopted RNA interference techniques to investigate the effects of WIPF1 on colony and sphere-formation capacity, as well as cisplatin sensitivity in SCLC cells. Furthermore, we performed western blot analysis to analyze protein expression and employed the STRING database to identify potential signaling pathways.
Results
WIPF1 was significantly upregulated in sphere-formed SCLC cells, relative to differentiated ones under adherent growth conditions (2D cultures). The gene was involved in the regulation of colony formation, sphere-formation capacity, and cisplatin sensitivity in SCLC cell line model. Knocking down of WIPF1 significantly suppressed the proliferation of cancer cells via the YAP/TAZ protein.
Conclusions
Sphere-formation and chemoresistance represent indispensable characteristics of CSC-like cells. Notably, sphere-formation culture is a more effective approach for enriching of CSCs-like cells than traditional adherent culture. Upregulation of WIPF1 in sphere-formed cells, relative to differentiated ones, indicated that it plays an important role in the tumorigenesis of SCLC. Moreover, this process is mediated by the YAP/TAZ pathway, suggesting that it may be a potential therapeutic target for SCLC.
Keywords: Cisplatin-resistant, small cell lung cancer, tumor stem cell-like cells, WIPF1, YAP/TAZ
Introduction
Malignant tumor is one of the most leading causes of death in humans. At present, lung cancer has the highest incidence rate and mortality among all types of malignancies, imposing a heavy burden on the society. 1 Histopathologically, lung cancer is broadly categorized into two subtypes, namely non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC). 2 SCLC, a type of neuroendocrine (NE) carcinoma characterized by aggressive phenotypes, consists of over 10% of all lung cancer patients. A previous study showed that almost all SCLC patients (87%) were diagnosed at an extensive stage and missed the opportunity for surgery. 3 Despite high initial response rates to chemotherapy/radiotherapy in SCLC, most patients ultimately experience poor treatment outcomes, due to early dissemination, chemoresistance, and recurrence.4–6 Evidence from another study indicated that SCLC patients at limited stage exhibited a mOS (median overall survival time) with 15–20 months, and the 5 years survival rate is approximately 15%, Conversely, the mOS in patients at an advanced SCLC stage is less than 13 months, and their 2-year survival rate from diagnosis ranged from 5.2 to 19.5%. 7 Up to now, few studies have reported satisfactory outcomes after SCLC treatment, while therapeutic options remain scarce in clinical practice.8,9 Mutations of TP53 and RB1 are frequently found in SCLC, and these have been associated with genetic alterations, including frequent chromosomal abnormality (deletion 3p), inactivated notch pathway, MYC family, and NFIB amplification, among others.10–14 Immune checkpoint inhibitors have been reported to have a limited role in improving survival rate of SCLC patients, mainly due to downregulation of the MHC-1 antigen, aberrant Notch signaling and existence of few tumor infiltrating lymphocytes in most SCLC cases.15–18 Understanding chemotherapy resistance and SCLC recurrence, coupled with elucidation of the underlying molecular mechanisms, is imperative to effective management of SCLC. The concept of cancer stem cells (CSCs) has promise as a therapeutic strategy for SCLC, with accumulating evidence indicating that a high proportion of CSCs in SCLC promotes its rapid dissemination, poor prognosis, chemotherapy or immunotherapy resistance, and spheroidal growth in vitro.19,20
The WASP-interacting protein (WIPF1) binds to WASP, to activate formation of podosomes and neuron dendrites, and promote cell proliferation and migration by regulating cytoskeletal proteins.21,22 Target genes of p53 highly overlapped with those co-expressed with WIPF1, while the upregulation of WIPF1 promoted tumorigenesis and tumor progression. Eike Staub and colleagues 23 found that c-myc and ESR1, downstream target genes of p53, were co-expressed with WIPF1, and upregulated WIPF1 expression, a phenomenon that was associated with poor prognosis of patients with different malignancies. Reduced expression of WIPF1 in glioblastoma or breast cancer cells significantly downregulated CSC markers and suppressed tumor growth in vivo. 24 Abnormal expression of WIPF1 enhances gastric cancer progression.25,26 Besides, WIPF1 has been confirmed to be a major immune infiltration-related molecule in head and neck cancer. 27 WIPF1 has also been implicated in abnormal cell proliferation, although its role in SCLC remains unknown. Previous reports have indicated that CSCs promote tumor initiation, resistance, and recurrence, thus targeting them may be a feasible strategy for management of SCLC.28,29 On the other hand, although the specific markers for identifying of CSCs, 30 sphere-formation cultures have been used to effectively enrich CSC-like cells, such as tumor stem cell-like cells (TSCLCs). 31
In this study, we investigated the function of WIPF1 in the regulation of cisplatin sensitivity and the underlying molecular mechanism in SCLC. Specifically, we performed RNA-Seq analysis and found that WIPF1 was markedly upregulated in sphere-formed cells relative to attached ones in NCI-H446. Next, we used small interfering RNA (siRNA) technology to knock down WIPF1. Since WIPF1 has been shown to regulate autonomous cell growth via the YAP/TAZ. 32 Therefore, we also analyzed expression of YAP/TAZ proteins and their associations with WIPF1in SCLC.
Materials and methods
Cell lines
Human SCLC cell lines used in the article include NCI-H446 (HTB-171), NCI- NCI-H209 (HTB172), and H526 (CRL-5811). We bought SCLC cell lines from FuHeng Cell Center, Shanghai, China, and the cell lines were cultured in RPMI 1640 medium added with 10% fetal bovine serum (Gibco Technologies, Grand Island, USA). The cell lines were digested with trypsin-EDTA buffer (Invitrogen) when passaged, then placed in incubator.
Cell transfection with WIPF1-siRNAs
WIPF1-siRNAs, synthesized by GenePharma (Shanghai, China), for use in this study are listed in Table 1. Cancer cells were plated in RPMI-1640 medium for 12 h or more, then transfected with 100 nM of WIPF1-siRNAs or control siRNAs that had been diluted in Opti-MEM (Gibco Technologies, Grand Island, USA) mixing well with lipofectamine 2000 (Life technologies, Carlsbad, USA) as described in our previous work. 33
Table 1.
Sequences of WIPF1-siRNAs and control siRNA used in this study.
| RNA oligo names | RNA oligo sequences | |
|---|---|---|
| WIPF1-siRNA1 | sense | 5'CCUUUCUGAUAUCAGCAAATT3' |
| antisense | 5'UUUGCUGAUAUCAGAAAGGTT3' | |
| WIPF1-siRNA2 | sense | 5'CCAAGACCCAUUCAAUCAATT3' |
| antisense | 5'UUGAUUGAAUGGGUCUUGGTT3' | |
| WIPF1-siRNA3 | sense | 5'GGAUCCAACCGAAGAGAAATT3' |
| antisense | 5'UUUCUCUUCGGUUGGAUCCTT3' | |
| Control siRNA | sense | 5’ UUCUCCGAACGUGUCACGUTT3' |
| antisense | 5’ ACGUGACACGUUCGGAGAATT3' |
siRNA: small interfering RNA.
Quantitative real-time PCR
The aforementioned SCLC cell lines were treated with WIPF1-siRNAs for 24 h, then total RNA isolated using commercial RNApure Kit (CWbio biotech Co., Ltd, Jiangsu, China). Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, USA) was used to determine, then equal RNA concentrations used to synthesize cDNA using HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme biotech Co., Ltd, Nangjing, China). Taq Pro Universal SYBR qPCR Master Mix(Vazyme biotech Co., Ltd, Nangjing, China) was then applied on a 7500 Fluorescent quantitative PCR System (Applied Biosystems, USA), targeting genes whose primers are outlined in Table 2.
Table 2.
Sequences of primers used for qRT-PCR.
| Gene | Sequence | Size (bp) | Tm (°C) |
|---|---|---|---|
| WIPF1 | F: AGCCTCAGAGGAACCGAATG | 107 | 60 |
| R:CGGACTTGATTGAATGGGTCTTG | |||
| ALDH3A1 | F: TGTTCTCCAGCAACGACAAGG | 108 | 60 |
| R: AGGGCAGAGAGTGCAAGGT | |||
| EYA4 | F: CTTCTTGCAGTCAAAACAGAGC | 166 | 60 |
| R: GTGGATAGGGCTTGGAAGGAT | |||
| CACNA2D1 | F: ACGCAGCAGTCCATATTCCTA | 129 | 60 |
| R:GCCACAATAATGAAGGGTCTTC | |||
| LOX | F: CGGCGGAGGAAAACTGTCT | 128 | 60 |
| R:TCGGCTGGGTAAGAAATCTGA | |||
| TRIM29 | F: CTGTTCGCGGGCAATGAGT | 100 | 60 |
| R: TGCCTTCCATAGAGTCCATGC | |||
| AKR1C1 | F: TCCAGTGTCTGTAAAGCCAGG | 257 | 60 |
| R: CCAGCAGTTTTCTCTGGTTGAA | |||
| LZTS1 | F: AGCGTCAGTAGCCTCATCTC | 187 | 60 |
| R: AGTCTTCGCTCTTGCCCATTT | |||
| ACTB | F: CATGTACGTTGCTATCCAGGC | 250 | 60 |
| R: CTCCTTAATGTCACGCACGAT |
qrt-PCR: quantitative real-time PCR.
Cell viability assay
SCLC cell line cells were seeded in a microplate (Corning life sciences, USA), at a density of 5000 cells per well, and incubated with WIPF1- or control siRNAs. Cells viability was analyzed through the CCK8 assay kit. Subsequently, in 3 consecutive days, 10 μl of the CCK-8 reagent (Dojin Laboratories, Kumamoto, Japan) was added to each well, followed by determination of absorbance on a Microplate reader (Thermo Fisher Scientific, USA) at a wavelength of 450 nm.
Sphere-formation assay
SCLC cells were placed in ultra-low attachment microplates, and cultured for 14 days in DMEM/F12 medium (Gibco Technologies, Grand Island, USA), with EGF (20 ng/mL, Proteintech, Wuhan, China), bFGF (FGF-basic, 20 ng/mL, Invitrogen, USA), and B27 (20 μl/mL, Gibco Technologies, Grand Island, USA). Thereafter, the number of cell spheres (diameter larger than 100μm) was calculated under a phase-contrast microscope (Nikon Corporation Japan).
Colony formation assay
SCLC cells were placed in conventional microplates and cultured for 14 days in DMEM/F12 medium (Gibco Technologies, Grand Island, USA), with EGF (20 ng/mL, Proteintech, Wuhan, China), bFGF (FGF-basic, 20 ng/mL, Invitrogen, USA), and B27 (20 μl/mL, Gibco Technologies, Grand Island, USA). Thereafter, the Giemsa staining was conducted, and the number of cell colony (diameter larger than 100μm) was calculated under a phase-contrast microscope (Nikon Corporation Japan).
Western blot assay
NCI-H446 cells were harvested, 48 h after treatment with WIPF1-siRNAs. The proteins were quantified via the BCA method, and 45μg separated via SDS-PAGE. The membrane was incubated for 10 h with primary antibodies, namely WIPF1, TAZ, and YAP antibodies (Table 3) at 4 °C, then with peroxidase-conjugated IgG secondary antibody, then analyzed on the Chemi-Doc XRS system. Protein expression was performed using the Image J software.
Table 3.
Information on primary antibodies used for western blot analysis.
| Antibody | Vendor | Source | Working dilution |
|---|---|---|---|
| WIPF1 | abways | rabbit | 1:1000 |
| YAP1 | abways | rabbit | 1:1000 |
| TAZ | abways | rabbit | 1:1000 |
| β-actin | Proteintech | rabbit | 1:20000 |
| CD133 | Abcam | rabbit | 1:2000 |
| CgA | CST | rabbit | 1:1000 |
Flow cytometry
The average expression intensity of CD133 in sphere-formed cells and attached cells were determined using Alexa FluorR488labeled primary antibody. Human SCLC lung cancer cells (NCI-H446) were stained with Alexa FluorR488 conjugated CD133 primary antibody (Abcam, USA), Rabbit normal IgG served as the control, facilitating the determination of the average expression intensity in SCLC cells.
Transcriptomic analysis
Transcriptome analysis was performed by the Personal Biotechnology Company Limited (Nanjing, China). Briefly, Total RNA was isolated from sphere-formed cells relative to attached ones in NCI-H446, and mRNAs enriched using oligo dT beads. The number of reads falling in the exons of this meta-transcript were counted and normalized by the size of the meta-transcript and by the size of the library. Differentially expressed genes (DEGs) were identified using NOISeq, as previously described.33,34
Statistical analysis
All experimental data were analyzed using GraphPad Prism Version 5.0. t-test was used to analyze differences between groups; p < 0.05 was considered statistically significant.
Results
WIPF1 was upregulated in sphere-formed relative to attached cells
Although CSC markers have not been clearly identified in SCLC, CD133, uPAR, and CACNA2D1 have been associated with maintenance of stemness and drug resistance.35,36 Our results showed that sphere-formation culture effectively enriched CSC-like cells, such as TSCLCs. Analysis of expression of CD133, CACNA2D1, and uPAR mRNAs revealed that they were upregulated under sphere-formation culture relative to control conditions (supplementary figure1A). Besides, the results implied that the average fluorescence of sphere-formed cells was significantly increased (supplementary figure1B). The results indicated that dissociated spheres can reform secondary spheres in (supplementary figure 1C). RNA-Seq analysis revealed that 296 and 336 genes were upregulated and downregulated, respectively ( Figure 1A ). We performed hierarchical clustering to visualize the DEGs between attached and sphere-formed SCLC cells ( Figure 1B ). We randomly selected nine significantly expressed (Table 4), for validation via quantitative real-time PCR (qRT-PCR) and found that their expression patterns were consistent with RNA-seq data ( Figure 1C ). Results from KEGG pathway analysis revealed that the DEGs were enriched in signaling pathways regulating pluripotency of stem cells, key among them cell adhesion molecules and molecules involved in ECM–receptor interaction. Previous studies showed that these molecules improved the CSC-like characteristics and epithelial-to-mesenchymal transition.37,38 Furthermore, the DEGs were also enriched in pathways regulating PI3K-AKT, Hippo, and Ras signaling (supplementary figure 2 and 3). These pathways have been widely described in tumorigenesis and cancer progression. Notably, WIPF1 was found to bind to WASP, thereby regulating formation of podosomes and neuron dendrites, and promoting cell proliferation and migration by regulating cytoskeletal proteins. In addition, we observed that the cisplatin treatment (3.2 µg/ml) for 48 h upregulated WIPF1 expression in NCI-H446 cells (supplementary figure 4). Recent research has also revealed its role in tumorigenesis and CSCs in various malignancies. Therefore, we chose WIPF1 for further research.
Figure 1.
WIPF1 was upregulated in sphere-formed relative to attached cells. Scatter plot (A) and hierarchical clustering plot (B) displaying differentially expressed genes (DEGs) between attached and sphere-formed SCLC cells. Red and green dots in (A and B) represent upregulated and downregulated genes, respectively. Note: the selection criteria for the differentially expressed genes were log2|fold change| > 3 and p < 0.05. (C) qRT-PCR results showing changes in expression of TRIM29, WIPF1, EYA4, ALDH3A, LOX, AKR1C1, LZTS1, CRACR2A, and HEYL mRNAs in the sphere-formed relative to attached cells. *Statistically significant difference (p < 0.05) between sphere-formed and attached cells through t-test and at least three repetitions were conducted. SCLC: small cell lung cancer; qrt-PCR: quantitative real-time PCR.
Table 4.
Differentially expressed genes between attached and sphere-formed SCLC cells.
| Gene symbol | Gene description |
|---|---|
| TRIM29 | tripartite motif containing 29 |
| WIPF1 | WAS/WASL interacting protein family member 1 |
| EYA4 | EYA transcriptional coactivator and phosphatase 4 |
| ALDH3A | aldehyde dehydrogenase 3 family member A1 |
| LOX | lysyl oxidase |
| AKR1C1 | aldo-keto reductase family 1 member C1 |
| LZTS1 | leucine zipper tumor suppressor 1 |
| CACNA2D1 | calcium voltage-gated channel auxiliary subunit alpha2 delta 1 |
| HEYL | hes related family bHLH transcription factor with YRPW motif-like |
SCLC: small cell lung cancer.
WIPF1-siRNAs downregulate WIPF1 thereby inhibiting proliferation capacity and promoting sensitivity to cisplatin of NCI-H446 and NCI-H209 cells
To suppress WIPF1 expression, SCLC cell lines were transfected with siRNAs designed to specifically target WIPF1, while non-targeting siRNAs served as negative controls. qRT-PCR results ( Figure 2A ) and western blots (Figure 2B and 2C) revealed that WIPF1 expression was indeed downregulated in NCI-446 after transfection with WIPF1- relative to control siRNAs. Results from the CCK8 assay its effects on proliferation ( Figure 2D ) and sensitivity to cisplatin (3.2 µg/ml) compared to control cells in NCI-H446 ( Figure 2E ). Besides, knocking down WIPF1 in SCLC cells resulted in decreased proliferation ( Figure 3A ) and higher sensitivity to cisplatin (3.2 µg/ml) compared to control cells in NCI-H209 ( Figure 3B ). Collectively, the results demonstrated that WIPF1 knockdown could significantly suppress proliferative capacity of but enhance sensitivity of SCLC cells to cisplatin.
Figure 2.
Knockdown of WIPF1 significantly suppressed the proliferation activity and enhanced sensitivity to cisplatin in small cell lung cancer cells. (A) qRT-PCR results showing changes in WIPF1 expression in WIPF1-siRNA1, 2, and 3 groups of SCLC cell line NCI-H446. (B, C) Western blots showing levels of WIPF1 proteins in WIPF1-siRNA1, 2, and 3 groups of NCI-H446 cells, β-actin was used as a loading control through t-test and 2 repetitions were conducted. (D) CCK-8 assay results showing proliferation of NCI-H446 after transfection with WIPF1-siRNA 1 and 2. (E) CCK-8 assay results showing proliferation of NCI-H446 after transfection with WIPF1-siRNA2 and cisplatin treatment (3.2 µg/ml). *Statistically significant differences (p < 0.05) between WIPF1-siRNA-treated cells and control siRNA (A, C-E) through t-test and at least three repetitions were conducted. SCLC: small cell lung cancer; siRNA: small interfering RNA; qrt-PCR: quantitative real-time PCR.
Figure 3.
WIPF1 CCK-8 assay results showing proliferation (A) and cisplatin treatment (3.2 µg/ml) (B) of NCI-H209 cells after transfection with WIPF1-siRNA2. *Statistically significant difference (p < 0.05) between sphere-formed and attached cells through t-test and at least three repetitions were conducted. siRNA: small interfering RNA.
WIPF1 knockdown significantly suppressed colony-forming capacity and sphere formation of SCLC cancer cells
Next, we performed colony formation and sphere-formation assays, on NCI-H446 cell line, to evaluate the function of WIPF1 in SCLC. Results showed a significant reduction in the number of both spheres formation (Figure 4A and 4B) and colonies formation (Figure 4C and 4D) in SCLC cells, after WIPF1-siRNA treatment, proving that this gene might perform a crucial role in tumor development thus could reflect the malignancy and metastatic capacity of cancer cells. 39
Figure 4.
WIPF1 knockdown significantly suppressed colony formation and sphere-formation capacity of small cell lung cancer cells. WIPF1-siRNA2 significantly reduced the number of cell spheres (A, B) and the number of cell colonies (C, D). *Statistically significant differences (p < 0.05) between sphere-formed and attached cells through t-test and at least three repetitions were conducted, Scale bar is 100μm. siRNA: small interfering RNA.
WIPF1 regulates SCLC through the YAP/TAZ signaling pathway
Previous studies have shown that YAP/TAZ plays a crucial role in the Hippo signaling pathway and performs vital functions in cellular plasticity. 40 Silencing the WIPF1 gene significantly suppressed proliferation capacity of CSC cells in glioblastoma and breast cancer cells through the YAP/TAZ pathway. To clarify the underlying molecular mechanism, we analyzed expression of YAP/TAZ proteins in SCLC using western blot assay and found that both TAZ and YAP proteins were significantly downregulated after treatment with WIPF1-siRNAs (Figure 5A and 5B).
Figure 5.
WIPF1 regulated small cell lung cancer cells through the YAP/TAZ signaling pathway. Western blots (A) and relative gray value (B) showed that WIPF1 knockdown significantly downregulated YAP, and YAZ expression in NCI-H446. β-actin served as the loading control. *Statistically significant difference (p < 0.05) between sphere-formed and attached cells through t-test and two repetitions were conducted.
Considering that CD133 is widely recognized CSC-like cells molecular marker and Chromogranin A (CgA) is useful NE marker in SCLC. Western blots were used to observe their expression after treatment with WIPF1-siRNA2. The preliminary results indicated that CD133 and CgA were downregulated after WIPF1-siRNA2 treatment (supplementary figure 5).
Protein–protein interaction network of WIPF1
To understand WIPF1's relationship with other proteins in the pathway, we used the STRING Version: 11.0 (https://www.string-db.org/) to construct a protein–protein interaction network and reveal the protein's direct physical binding and indirect functional connections. Results showed that WIPF1 interacted with four protein kinases, namely BTK, SYK, BRK, and NCK, which might affect the related signaling pathways ( Figure 6 ).
Figure 6.
Protein–protein interaction network showing that WIPF1 interacts with four protein kinases (BTK, SYK, BRK, and NCK) through STRING website (https://cn.string-db.org/).
Discussion
Numerous studies have suggested that tumors might possess a stem cell-like subpopulation called CSCs.29,41 Notably CSCs or tumor initiating cells have unlimited self-renewal capacity and could produce heterogeneous tumor cells, while failure to eradicate CSCs is a predisposes a body to tumor recurrence. 42 Another study found that CSCs exhibited enhanced cell plasticity, loss of cell polarity, and experienced epithelial mesenchymal transition compared to differentiated tumor cells. Consequently, they easily adapted to changes in the surrounding microenvironment and became more resistant to conventional therapies. 43 Although previous studies have shown that targeting CSCs can be an attractive approach for effective cancer treatment, 44 the underlying mechanism of action is poorly understood and was the focus of this study.
Abundance of CSCs in SCLC has been associated with rapid emergence of chemoresistance and spheroidal growth in vitro.45,46 Results of the present study showed that sphere-formation capacity and chemoresistance play crucial roles in growth of CSC-like cells, while sphere-formation cultures represent a more effective approach for acquisition of enriched CSCs-like cells compared to traditional adherent culture.31,47 Transcriptomic analysis has revealed that WIPF1 was upregulated in sphere-formed cells comparing to differentiated ones under adherent growth conditions (2D cultures) in SCLC cell lines. Results from siRNA-mediated silencing of WIPF1 suggested that reduction of this gene suppressed the cell viability and sphere-formation capacity of SCLC cells.
Accumulating evidence has demonstrated the essential role of WIPF1 in tumorigenesis and cancer progression. For example, Lamont and colleagues 48 analyzed methylation profiles in keloids and found that WIPF1 was one of the top 10 hypomethylated genes. While Escoll et al. 24 found that decreased WIPF1 expression was associated with the p53 mutation and significantly downregulated CSC marker expression and suppressed of CSC cell viability, thus restraining tumor growth in vivo through the YAP/TAZ signaling pathway. Additional evidence has also shown that YAP/TAZ may act as coactivators of TEADs to initiate tumor development and progression. 49 Furthermore, AKT2 was found to phosphorylate WIPF1, while the BRAFV600E mutation downregulated methylation in WIPF1's promoter region, thereby upregulating its expression in thyroid cancer. 50 Moreover, WIPF1 is involved in the regulation of development and progression of head and neck cancer, 51 while in NSCLC, SNHG6 upregulates ETS1 expression, thereby promoting the transcription of WIPF1. 52 Apart from these, WIPF1 was shown to act as an oncogene in pancreatic ductal adenocarcinoma, by regulating the miR-141/200c-WIPF1-YAP/TAZ pathway, and its upregulation correlated poor patient prognosis. 53 WIPF1 could mediate the pro-tumorigenic role of PD-L1 in lung cancer. 54 Additional evidence suggests that CD133 is regulated by YAP1 in the Hippo pathway in SCLC, which might be involved in radiation resistance, 55 while inability of YAP/TAZ to bind to TEAD molecules renders it ineffective as an oncogene. 56 Furthermore, the inhibition of the YAP/TAZ-TEAD interface was found to be a promising approach for cancer treatment. 57 Chromogranin A (CgA) is a common diagnostic NE markers in lung NE carcinoma. 58 Our preliminary results indicated that CgA were downregulated after WIPF1-siRNA2 treatment. Consistent with previous reports, these suggested YAP/TAZ might regulate NE to non-NE fate in SCLC, which was involved in therapeutic resistance in SCLC models. 59 SCLC has been subclassified based on different transcription factors ASCL1, NEUROD1, and POU2F3, and recent studies suggest that different subtypes of SCLC cells would ultimately develop into YAP1-high tumors.13,59 In the present study, we found that YAP/TAZ proteins were significantly downregulated in SCLC cells after treatment with WIPF1-siRNAs, suggesting that this is the underlying mechanism.
Protein–protein interaction network revealed that WIPF1 interacted with four protein kinases, namely BTK, SYK, BRK, and NCK, which might affect related signaling pathways. Taken together, the result of this study indicated that WIPF1 functions in pathogenesis and resistance of SCLC, suggesting its potential as a therapeutic target for this type of cancer.
The present study has several limitations. First, the precise molecular mechanism by which WIPF1 regulates the YAP/TAZ signaling pathway remains incompletely characterized, as we did not perform extended validation through animal models or human tumor specimen analyses. Considering the aggressive nature of SCLC and the scarcity of effective treatment options, further exploration of WIPF1's contribution to SCLC pathogenesis is both timely and warranted. Our subsequent research will focus on these key directions: (1) development of a WIPF1 overexpression plasmid system to proceed with the rescue experiments; (2) systematic screening for cellular proteins interacting with WIPF1 using co-immunoprecipitation coupled with mass spectrometry; and (3) collection of biopsy specimens from SCLC patients for further research. Additionally, we aim to investigate the potential involvement of WIPF1 in regulating novel cell death modalities in SCLC, particularly focusing on its possible connection with pyroptosis pathways. These proposed investigations may provide new insights into therapeutic target development for this recalcitrant malignancy.
Conclusion
In summary, WIPF1 regulates colony formation and sphere-forming ability in SCLC cells, as well as modulates their sensitivity to cisplatin. Knocking down WIPF1 significantly suppresses proliferation capacity and cisplatin sensitivity of SCLC cells via the YAP/TAZ signaling pathway. Protein–protein interaction networks revealed that WIPF1 interacts with four protein kinases (BTK, SYK, BRK, and NCK), which might affect related signaling pathways. Therefore, WIPF1 plays a crucial role in development and progression of SCLC.
Supplemental Material
Supplemental material, sj-docx-1-sci-10.1177_00368504251345012 for WIPF1 regulates stemness in small cell lung cancer by Hongyong Fu, Mingji Quan, Qianqian Qiu and Fanjie Jin in Science Progress
Acknowledgement
We are grateful to all peer reviewers and editors for their opinions and suggestions, and our family and colleagues for supporting our work.
Footnotes
ORCID iD: Hongyong Fu https://orcid.org/0009-0006-6750-4344
Author contributions: H.F. performed the experiments, wrote the manuscript, and was responsible for the conception, and final approval of the manuscript. Q.Q. and M.Q. assisted with the experiments and helped with data analysis. F.J. assisted with the experiments and ordered reagents. We agreed on the journal to which the article has been submitted.
Funding: The authors disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by grants from Medical Science and Technology Research Program of Henan Province (Grant No. LHGJ20190636).
The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Data availability statement: All relevant data are within the manuscript and its additional files.
Informed consent statement: There are no human participants in this article and informed consent is not required.
Supplemental material: Supplemental material for this article is available online.
References
- 1.Wang Q, Gümüş ZH, Colarossi C, et al. SCLC: epidemiology, risk factors, genetic susceptibility, molecular pathology, screening, and early detection. J Thoracic Oncol: Official Publication of the International Association for the Study of Lung Cancer 2023; 18: 31–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.James JS, Boyle TA. Molecular pathology of lung cancer. Cold Spring Harbor Perspect Med 2022; 12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Pešek M, Mužík J. Small-cell lung cancer: epidemiology, diagnostics and therapy. Vnitrni lekarstvi 2018; 63: 876–883. Malobuněčný karcinom plic: epidemiologie, diagnostika a léčba. [PubMed] [Google Scholar]
- 4.Kalemkerian GP, Schneider BJ. Advances in small cell lung cancer. Hematol Oncol Clin North Am 2017; 31: 143–156. [DOI] [PubMed] [Google Scholar]
- 5.Povsic M, Enstone A, Wyn R, et al. Real-world effectiveness and tolerability of small-cell lung cancer (SCLC) treatments: a systematic literature review (SLR). PloS one 2019; 14: e0219622. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Palma DA, Warner A, Louie AV, et al. Thoracic radiotherapy for extensive stage small-cell lung cancer: a meta-analysis. Clin Lung Cancer 2016; 17: 239–244. [DOI] [PubMed] [Google Scholar]
- 7.Asai N, Ohkuni Y, Kaneko N, et al. Relapsed small cell lung cancer: treatment options and latest developments. Ther Adv Med Oncol 2014; 6: 69–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Zugazagoitia J, Paz-Ares L. Extensive-stage small-cell lung cancer: first-line and second-line treatment options. J Clin Oncol 2022; 40: 671–680. [DOI] [PubMed] [Google Scholar]
- 9.Fan L, Lin Y. Small cell lung cancer with liver metastases: from underlying mechanisms to treatment strategies. Cancer Metastasis Rev 2024; 44: 5. [DOI] [PubMed] [Google Scholar]
- 10.Gazdar AF, Bunn PA, Minna JD. Small-cell lung cancer: what we know, what we need to know and the path forward. Nat Rev Cancer 2017; 17: 725–737. [DOI] [PubMed] [Google Scholar]
- 11.Semenova EA, Kwon MC, Monkhorst K, et al. Transcription factor NFIB is a driver of small cell lung cancer progression in mice and marks metastatic disease in patients. Cell Reports. 2016; 16: 631–643. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Brägelmann J, Böhm S, Guthrie MR, et al. Family matters: how MYC family oncogenes impact small cell lung cancer. Cell Cycle (Georgetown, Tex) 2017; 16: 1489–1498. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Solta A, Ernhofer B, Boettiger K, et al. Small cells - big issues: biological implications and preclinical advancements in small cell lung cancer. Molecular Cancer 2024; 23: 41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Rudin CM, Brambilla E, Faivre-Finn C, et al. Small-cell lung cancer. Nature Rev Disease Primers 2021; 7: 3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Meijer JJ, Leonetti A, Airò G, et al. Small cell lung cancer: novel treatments beyond immunotherapy. Semin Cancer Biol 2022; 86: 376–385. [DOI] [PubMed] [Google Scholar]
- 16.Hiatt JB, Sandborg H. Inhibition of LSD1 with bomedemstat sensitizes small cell lung cancer to immune checkpoint blockade and T-cell killing. Clin Cancer Res 2022; 28: 4551–4564. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Roper N, Velez MJ, Chiappori A, et al. Notch signaling and efficacy of PD-1/PD-L1 blockade in relapsed small cell lung cancer. Nat Commun 2021; 12: 3880. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Zugazagoitia J, Osma H. Facts and hopes on cancer immunotherapy for small cell lung cancer. Clin Cancer Res 2024; 30: 2872–2883. [DOI] [PubMed] [Google Scholar]
- 19.Guo W, Qiao T, Li T. The role of stem cells in small-cell lung cancer: evidence from chemoresistance to immunotherapy. Semin Cancer Biol 2022; 87: 160–169. [DOI] [PubMed] [Google Scholar]
- 20.Codony-Servat J, Verlicchi A, Rosell R. Cancer stem cells in small cell lung cancer. Transl Lung Cancer Res 2016; 5: 16–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Antón IM, Jones GE, Wandosell F, et al. WASP-interacting protein (WIP): working in polymerisation and much more. Trends Cell Biol 2007; 17: 555–562. [DOI] [PubMed] [Google Scholar]
- 22.Gryaznova T, Gubar O, Burdyniuk M, et al. WIP/ITSN1 complex is involved in cellular vesicle trafficking and formation of filopodia-like protrusions. Gene 2018; 674: 49–56. [DOI] [PubMed] [Google Scholar]
- 23.Staub E, Groene J, Heinze M, et al. An expression module of WIPF1-coexpressed genes identifies patients with favorable prognosis in three tumor types. J Mol Med (Berlin, Germany) 2009; 87: 633–644. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Escoll M, Gargini R, Cuadrado A, et al. Mutant p53 oncogenic functions in cancer stem cells are regulated by WIP through YAP/TAZ. Oncogene 2017; 36: 3515–3527. [DOI] [PubMed] [Google Scholar]
- 25.Su F, Xiao R, Chen R, et al. WIPF1 promotes gastric cancer progression by regulating PI3K/Akt signaling in a myocardin-dependent manner. iScience 2023; 26: 108273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Liu Y, Lin W, Dong Y, et al. Long noncoding RNA HCG18 up-regulates the expression of WIPF1 and YAP/TAZ by inhibiting miR-141-3p in gastric cancer. Cancer Med 2020; 9: 6752–6765. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Ding Y, Chu L, Cao Q, et al. A meta-validated immune infiltration-related gene model predicts prognosis and immunotherapy sensitivity in HNSCC. BMC cancer 2023; 23: 45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Clarke MF. Clinical and therapeutic implications of cancer stem cells. The New England J Med 2019; 380: 2237–2245. [DOI] [PubMed] [Google Scholar]
- 29.Chan JM, Quintanal-Villalonga Á, Gao VR, et al. Signatures of plasticity, metastasis, and immunosuppression in an atlas of human small cell lung cancer. Cancer Cell 2021; 39: 1479–1496.e18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Lan L, Behrens A. Are there specific cancer stem cell markers?. Cancer Res 2023; 83: 170–172. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.De Vitis C, Corleone G, Salvati V, et al. B4GALT1 is a new candidate to maintain the stemness of lung cancer stem cells. J Clin Med 2019; 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Gargini R, Escoll M, García E, et al. WIP drives tumor progression through YAP/TAZ-dependent autonomous cell growth. Cell Reports 2016; 17: 1962–1977. [DOI] [PubMed] [Google Scholar]
- 33.Fu H, Zhang W, Yuan Q, et al. PAK1 promotes the proliferation and inhibits apoptosis of human spermatogonial stem cells via PDK1/KDR/ZNF367 and ERK1/2 and AKT pathways. Mol Therapy Nucleic Acids 2018; 12: 769–786. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Fu H, Zhou F, Yuan Q, et al. miRNA-31-5p mediates the proliferation and apoptosis of human spermatogonial stem cells via targeting JAZF1 and cyclin A2. Mol Therapy Nucleic Acids 2019; 14: 90–100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Prabavathy D, Ramadoss N. Heterogeneity of small cell lung cancer stem cells. Adv Exp Med Biol 2019; 1139: 41–57. [DOI] [PubMed] [Google Scholar]
- 36.Yu J, Wang S, Zhao W, et al. Mechanistic exploration of cancer stem cell marker voltage-dependent calcium channel α2δ1 subunit-mediated chemotherapy resistance in small-cell lung cancer. Clin Cancer Res: An Official J Am Assoc Cancer Res 2018; 24: 2148–2158. [DOI] [PubMed] [Google Scholar]
- 37.Li D, Lin TL, Lipe B, et al. A novel extracellular matrix-based leukemia model supports leukemia cells with stem cell-like characteristics. Leuk Res 2018; 72: 105–112. [DOI] [PubMed] [Google Scholar]
- 38.Nguyen N, Kumar A, Chacko S, et al. Human hyaluronic acid synthase-1 promotes malignant transformation via epithelial-to-mesenchymal transition, micronucleation and centrosome abnormalities. Cell Communication and Signaling 2017; 15: 48. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Qi Z, Zhang T, Song L, et al. PRAS40 hyperexpression promotes hepatocarcinogenesis. EBioMed 2020; 51: 102604. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Di Benedetto G, Parisi S, Russo T, et al. YAP and TAZ mediators at the crossroad between metabolic and cellular reprogramming. Metabolites 2021; 11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Greaves M, Maley CC. Clonal evolution in cancer. Nature 2012; 481: 306–313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Kumar VE, Nambiar R, De Souza C. Targeting epigenetic modifiers of tumor plasticity and cancer stem cell behavior. Cells 2022; 11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Fatma H, Siddique HR. Cancer cell plasticity, stem cell factors, and therapy resistance: how are they linked? Cancer Metastasis Rev 2023; 43: 423–440. [DOI] [PubMed] [Google Scholar]
- 44.Zhou H, Tan L, Liu B, Guan XY. Cancer stem cells: recent insights and therapies. Biochem Pharmacol 2023; 209: 115441. [DOI] [PubMed] [Google Scholar]
- 45.Eramo A, Lotti F, Sette G, et al. Identification and expansion of the tumorigenic lung cancer stem cell population. Cell Death Diff 2008; 15: 504–514. [DOI] [PubMed] [Google Scholar]
- 46.Gutova M, Najbauer J, Gevorgyan A, et al. Identification of uPAR-positive chemoresistant cells in small cell lung cancer. PloS one 2007; 2: e243. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Wang X, Sun W, Shen W, et al. Long non-coding RNA DILC regulates liver cancer stem cells via IL-6/STAT3 axis. J Hepatol 2016; 64: 1283–1294. [DOI] [PubMed] [Google Scholar]
- 48.Jones LR, Greene J, Chen KM, et al. Biological significance of genome-wide DNA methylation profiles in keloids. Laryngoscope 2017; 127: 70–78. [DOI] [PubMed] [Google Scholar]
- 49.Zhou Y, Huang T, Cheng AS, et al. The TEAD family and its oncogenic role in promoting tumorigenesis. Int J Mol Sci 2016; 17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Zhang T, Shen X, Liu R, et al. Epigenetically upregulated WIPF1 plays a major role in BRAF V600E-promoted papillary thyroid cancer aggressiveness. Oncotarget 2017; 8: 900–914. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Sanati N, Iancu OD, Wu G, et al. Network-based predictors of progression in head and neck squamous cell carcinoma. Front Genet 2018; 9: 83. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Geng H, Li S, Xu M. Long noncoding RNA SNHG6 functions as an oncogene in non-small cell lung cancer via modulating ETS1 signaling. Onco Targets Ther 2020; 13: 921–930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Pan Y, Lu F, Xiong P, et al. WIPF1 antagonizes the tumor suppressive effect of miR-141/200c and is associated with poor survival in patients with PDAC. J Exp Clin Cancer Res 2018; 37: 67. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Yu W, Hua Y, Qiu H, et al. PD-L1 promotes tumor growth and progression by activating WIP and β-catenin signaling pathways and predicts poor prognosis in lung cancer. Cell Death & Disease 2020; 11: 506. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Yang K, Zhao Y, Du Y, et al. Evaluation of hippo pathway and CD133 in radiation resistance in small-cell lung cancer. J Oncol 2021; 2021: 8842554. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Pobbati AV, Rubin BP. Protein-protein interaction disruptors of the YAP/TAZ-TEAD transcriptional complex. Molecules (Basel, Switzerland) 2020; 25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Crawford JJ, Bronner SM, Zbieg JR. Hippo pathway inhibition by blocking the YAP/TAZ-TEAD interface: a patent review. Expert Opinion Therapeutic Patents 2018; 28: 867–873. [DOI] [PubMed] [Google Scholar]
- 58.Baykara Y, Xiao Y, Yang D, et al. Utility of secretagogin as a marker for the diagnosis of lung neuroendocrine carcinoma. Virchows Arch 2022; 481: 31–39. [DOI] [PubMed] [Google Scholar]
- 59.Wu Q, Guo J, Liu Y, et al. YAP drives fate conversion and chemoresistance of small cell lung cancer. Sci Adv 2021; 7: eabg1850. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplemental material, sj-docx-1-sci-10.1177_00368504251345012 for WIPF1 regulates stemness in small cell lung cancer by Hongyong Fu, Mingji Quan, Qianqian Qiu and Fanjie Jin in Science Progress






