WIPF1 regulates stemness in small cell lung cancer

Abstract

Objective

Small cell lung cancer (SCLC) is a highly malignant subtype of lung cancer. Cancer stem cell (CSC)-like cells have been implicated in chemoresistance and recurrence. Although previous studies have demonstrated the significance of WASP-interacting protein (WIPF1) in malignant tumors, its underlying molecular mechanism in SCLC is not well known. Here, we demonstrate that WIPF1 can regulate tumorigenesis and its underlying molecular mechanism in SCLC.

Methods

Sphere-formation culture effectively enriches CSC-like cells, such as tumor stem cell-like cells. RNA-seq was used to identify differentially expressed genes between enriched CSCs (3D cultures) and differentiated cells. Next, we adopted RNA interference techniques to investigate the effects of WIPF1 on colony and sphere-formation capacity, as well as cisplatin sensitivity in SCLC cells. Furthermore, we performed western blot analysis to analyze protein expression and employed the STRING database to identify potential signaling pathways.

Results

WIPF1 was significantly upregulated in sphere-formed SCLC cells, relative to differentiated ones under adherent growth conditions (2D cultures). The gene was involved in the regulation of colony formation, sphere-formation capacity, and cisplatin sensitivity in SCLC cell line model. Knocking down of WIPF1 significantly suppressed the proliferation of cancer cells via the YAP/TAZ protein.

Conclusions

Sphere-formation and chemoresistance represent indispensable characteristics of CSC-like cells. Notably, sphere-formation culture is a more effective approach for enriching of CSCs-like cells than traditional adherent culture. Upregulation of WIPF1 in sphere-formed cells, relative to differentiated ones, indicated that it plays an important role in the tumorigenesis of SCLC. Moreover, this process is mediated by the YAP/TAZ pathway, suggesting that it may be a potential therapeutic target for SCLC.

Introduction

Malignant tumor is one of the most leading causes of death in humans. At present, lung cancer has the highest incidence rate and mortality among all types of malignancies, imposing a heavy burden on the society. ¹ Histopathologically, lung cancer is broadly categorized into two subtypes, namely non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC). ² SCLC, a type of neuroendocrine (NE) carcinoma characterized by aggressive phenotypes, consists of over 10% of all lung cancer patients. A previous study showed that almost all SCLC patients (87%) were diagnosed at an extensive stage and missed the opportunity for surgery. ³ Despite high initial response rates to chemotherapy/radiotherapy in SCLC, most patients ultimately experience poor treatment outcomes, due to early dissemination, chemoresistance, and recurrence.^4–6 Evidence from another study indicated that SCLC patients at limited stage exhibited a mOS (median overall survival time) with 15–20 months, and the 5 years survival rate is approximately 15%, Conversely, the mOS in patients at an advanced SCLC stage is less than 13 months, and their 2-year survival rate from diagnosis ranged from 5.2 to 19.5%. ⁷ Up to now, few studies have reported satisfactory outcomes after SCLC treatment, while therapeutic options remain scarce in clinical practice.^8,9 Mutations of TP53 and RB1 are frequently found in SCLC, and these have been associated with genetic alterations, including frequent chromosomal abnormality (deletion 3p), inactivated notch pathway, MYC family, and NFIB amplification, among others.^10–14 Immune checkpoint inhibitors have been reported to have a limited role in improving survival rate of SCLC patients, mainly due to downregulation of the MHC-1 antigen, aberrant Notch signaling and existence of few tumor infiltrating lymphocytes in most SCLC cases.^15–18 Understanding chemotherapy resistance and SCLC recurrence, coupled with elucidation of the underlying molecular mechanisms, is imperative to effective management of SCLC. The concept of cancer stem cells (CSCs) has promise as a therapeutic strategy for SCLC, with accumulating evidence indicating that a high proportion of CSCs in SCLC promotes its rapid dissemination, poor prognosis, chemotherapy or immunotherapy resistance, and spheroidal growth in vitro.^19,20

The WASP-interacting protein (WIPF1) binds to WASP, to activate formation of podosomes and neuron dendrites, and promote cell proliferation and migration by regulating cytoskeletal proteins.^21,22 Target genes of p53 highly overlapped with those co-expressed with WIPF1, while the upregulation of WIPF1 promoted tumorigenesis and tumor progression. Eike Staub and colleagues ²³ found that c-myc and ESR1, downstream target genes of p53, were co-expressed with WIPF1, and upregulated WIPF1 expression, a phenomenon that was associated with poor prognosis of patients with different malignancies. Reduced expression of WIPF1 in glioblastoma or breast cancer cells significantly downregulated CSC markers and suppressed tumor growth in vivo. ²⁴ Abnormal expression of WIPF1 enhances gastric cancer progression.^25,26 Besides, WIPF1 has been confirmed to be a major immune infiltration-related molecule in head and neck cancer. ²⁷ WIPF1 has also been implicated in abnormal cell proliferation, although its role in SCLC remains unknown. Previous reports have indicated that CSCs promote tumor initiation, resistance, and recurrence, thus targeting them may be a feasible strategy for management of SCLC.^28,29 On the other hand, although the specific markers for identifying of CSCs, ³⁰ sphere-formation cultures have been used to effectively enrich CSC-like cells, such as tumor stem cell-like cells (TSCLCs). ³¹

In this study, we investigated the function of WIPF1 in the regulation of cisplatin sensitivity and the underlying molecular mechanism in SCLC. Specifically, we performed RNA-Seq analysis and found that WIPF1 was markedly upregulated in sphere-formed cells relative to attached ones in NCI-H446. Next, we used small interfering RNA (siRNA) technology to knock down WIPF1. Since WIPF1 has been shown to regulate autonomous cell growth via the YAP/TAZ. ³² Therefore, we also analyzed expression of YAP/TAZ proteins and their associations with WIPF1in SCLC.

Materials and methods

Cell lines

Human SCLC cell lines used in the article include NCI-H446 (HTB-171), NCI- NCI-H209 (HTB172), and H526 (CRL-5811). We bought SCLC cell lines from FuHeng Cell Center, Shanghai, China, and the cell lines were cultured in RPMI 1640 medium added with 10% fetal bovine serum (Gibco Technologies, Grand Island, USA). The cell lines were digested with trypsin-EDTA buffer (Invitrogen) when passaged, then placed in incubator.

Cell transfection with WIPF1-siRNAs

WIPF1-siRNAs, synthesized by GenePharma (Shanghai, China), for use in this study are listed in Table 1. Cancer cells were plated in RPMI-1640 medium for 12 h or more, then transfected with 100 nM of WIPF1-siRNAs or control siRNAs that had been diluted in Opti-MEM (Gibco Technologies, Grand Island, USA) mixing well with lipofectamine 2000 (Life technologies, Carlsbad, USA) as described in our previous work. ³³

Table 1.

Sequences of WIPF1-siRNAs and control siRNA used in this study.

RNA oligo names		RNA oligo sequences
WIPF1-siRNA1	sense	5'CCUUUCUGAUAUCAGCAAATT3'
	antisense	5'UUUGCUGAUAUCAGAAAGGTT3'
WIPF1-siRNA2	sense	5'CCAAGACCCAUUCAAUCAATT3'
	antisense	5'UUGAUUGAAUGGGUCUUGGTT3'
WIPF1-siRNA3	sense	5'GGAUCCAACCGAAGAGAAATT3'
	antisense	5'UUUCUCUUCGGUUGGAUCCTT3'
Control siRNA	sense	5’ UUCUCCGAACGUGUCACGUTT3'
	antisense	5’ ACGUGACACGUUCGGAGAATT3'

siRNA: small interfering RNA.

Quantitative real-time PCR

The aforementioned SCLC cell lines were treated with WIPF1-siRNAs for 24 h, then total RNA isolated using commercial RNApure Kit (CWbio biotech Co., Ltd, Jiangsu, China). Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, USA) was used to determine, then equal RNA concentrations used to synthesize cDNA using HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme biotech Co., Ltd, Nangjing, China). Taq Pro Universal SYBR qPCR Master Mix(Vazyme biotech Co., Ltd, Nangjing, China) was then applied on a 7500 Fluorescent quantitative PCR System (Applied Biosystems, USA), targeting genes whose primers are outlined in Table 2.

Table 2.

Sequences of primers used for qRT-PCR.

Gene	Sequence	Size (bp)	Tm (°C)
WIPF1	F: AGCCTCAGAGGAACCGAATG	107	60
	R:CGGACTTGATTGAATGGGTCTTG
ALDH3A1	F: TGTTCTCCAGCAACGACAAGG	108	60
	R: AGGGCAGAGAGTGCAAGGT
EYA4	F: CTTCTTGCAGTCAAAACAGAGC	166	60
	R: GTGGATAGGGCTTGGAAGGAT
CACNA2D1	F: ACGCAGCAGTCCATATTCCTA	129	60
	R:GCCACAATAATGAAGGGTCTTC
LOX	F: CGGCGGAGGAAAACTGTCT	128	60
	R:TCGGCTGGGTAAGAAATCTGA
TRIM29	F: CTGTTCGCGGGCAATGAGT	100	60
	R: TGCCTTCCATAGAGTCCATGC
AKR1C1	F: TCCAGTGTCTGTAAAGCCAGG	257	60
	R: CCAGCAGTTTTCTCTGGTTGAA
LZTS1	F: AGCGTCAGTAGCCTCATCTC	187	60
	R: AGTCTTCGCTCTTGCCCATTT
ACTB	F: CATGTACGTTGCTATCCAGGC	250	60
	R: CTCCTTAATGTCACGCACGAT

qrt-PCR: quantitative real-time PCR.

Cell viability assay

SCLC cell line cells were seeded in a microplate (Corning life sciences, USA), at a density of 5000 cells per well, and incubated with WIPF1- or control siRNAs. Cells viability was analyzed through the CCK8 assay kit. Subsequently, in 3 consecutive days, 10 μl of the CCK-8 reagent (Dojin Laboratories, Kumamoto, Japan) was added to each well, followed by determination of absorbance on a Microplate reader (Thermo Fisher Scientific, USA) at a wavelength of 450 nm.

Sphere-formation assay

SCLC cells were placed in ultra-low attachment microplates, and cultured for 14 days in DMEM/F12 medium (Gibco Technologies, Grand Island, USA), with EGF (20 ng/mL, Proteintech, Wuhan, China), bFGF (FGF-basic, 20 ng/mL, Invitrogen, USA), and B27 (20 μl/mL, Gibco Technologies, Grand Island, USA). Thereafter, the number of cell spheres (diameter larger than 100μm) was calculated under a phase-contrast microscope (Nikon Corporation Japan).

Colony formation assay

SCLC cells were placed in conventional microplates and cultured for 14 days in DMEM/F12 medium (Gibco Technologies, Grand Island, USA), with EGF (20 ng/mL, Proteintech, Wuhan, China), bFGF (FGF-basic, 20 ng/mL, Invitrogen, USA), and B27 (20 μl/mL, Gibco Technologies, Grand Island, USA). Thereafter, the Giemsa staining was conducted, and the number of cell colony (diameter larger than 100μm) was calculated under a phase-contrast microscope (Nikon Corporation Japan).

Western blot assay

NCI-H446 cells were harvested, 48 h after treatment with WIPF1-siRNAs. The proteins were quantified via the BCA method, and 45μg separated via SDS-PAGE. The membrane was incubated for 10 h with primary antibodies, namely WIPF1, TAZ, and YAP antibodies (Table 3) at 4 °C, then with peroxidase-conjugated IgG secondary antibody, then analyzed on the Chemi-Doc XRS system. Protein expression was performed using the Image J software.

Table 3.

Information on primary antibodies used for western blot analysis.

Antibody	Vendor	Source	Working dilution
WIPF1	abways	rabbit	1:1000
YAP1	abways	rabbit	1:1000
TAZ	abways	rabbit	1:1000
β-actin	Proteintech	rabbit	1:20000
CD133	Abcam	rabbit	1:2000
CgA	CST	rabbit	1:1000

Flow cytometry

The average expression intensity of CD133 in sphere-formed cells and attached cells were determined using Alexa FluorR488labeled primary antibody. Human SCLC lung cancer cells (NCI-H446) were stained with Alexa FluorR488 conjugated CD133 primary antibody (Abcam, USA), Rabbit normal IgG served as the control, facilitating the determination of the average expression intensity in SCLC cells.

Transcriptomic analysis

Transcriptome analysis was performed by the Personal Biotechnology Company Limited (Nanjing, China). Briefly, Total RNA was isolated from sphere-formed cells relative to attached ones in NCI-H446, and mRNAs enriched using oligo dT beads. The number of reads falling in the exons of this meta-transcript were counted and normalized by the size of the meta-transcript and by the size of the library. Differentially expressed genes (DEGs) were identified using NOISeq, as previously described.^33,34

Statistical analysis

All experimental data were analyzed using GraphPad Prism Version 5.0. t-test was used to analyze differences between groups; p < 0.05 was considered statistically significant.

Results

WIPF1 was upregulated in sphere-formed relative to attached cells

Although CSC markers have not been clearly identified in SCLC, CD133, uPAR, and CACNA2D1 have been associated with maintenance of stemness and drug resistance.^35,36 Our results showed that sphere-formation culture effectively enriched CSC-like cells, such as TSCLCs. Analysis of expression of CD133, CACNA2D1, and uPAR mRNAs revealed that they were upregulated under sphere-formation culture relative to control conditions (supplementary figure1A). Besides, the results implied that the average fluorescence of sphere-formed cells was significantly increased (supplementary figure1B). The results indicated that dissociated spheres can reform secondary spheres in (supplementary figure 1C). RNA-Seq analysis revealed that 296 and 336 genes were upregulated and downregulated, respectively ( Figure 1A ). We performed hierarchical clustering to visualize the DEGs between attached and sphere-formed SCLC cells ( Figure 1B ). We randomly selected nine significantly expressed (Table 4), for validation via quantitative real-time PCR (qRT-PCR) and found that their expression patterns were consistent with RNA-seq data ( Figure 1C ). Results from KEGG pathway analysis revealed that the DEGs were enriched in signaling pathways regulating pluripotency of stem cells, key among them cell adhesion molecules and molecules involved in ECM–receptor interaction. Previous studies showed that these molecules improved the CSC-like characteristics and epithelial-to-mesenchymal transition.^37,38 Furthermore, the DEGs were also enriched in pathways regulating PI3K-AKT, Hippo, and Ras signaling (supplementary figure 2 and 3). These pathways have been widely described in tumorigenesis and cancer progression. Notably, WIPF1 was found to bind to WASP, thereby regulating formation of podosomes and neuron dendrites, and promoting cell proliferation and migration by regulating cytoskeletal proteins. In addition, we observed that the cisplatin treatment (3.2 µg/ml) for 48 h upregulated WIPF1 expression in NCI-H446 cells (supplementary figure 4). Recent research has also revealed its role in tumorigenesis and CSCs in various malignancies. Therefore, we chose WIPF1 for further research.

Figure 1.

WIPF1 was upregulated in sphere-formed relative to attached cells. Scatter plot (A) and hierarchical clustering plot (B) displaying differentially expressed genes (DEGs) between attached and sphere-formed SCLC cells. Red and green dots in (A and B) represent upregulated and downregulated genes, respectively. Note: the selection criteria for the differentially expressed genes were log2|fold change| > 3 and p < 0.05. (C) qRT-PCR results showing changes in expression of TRIM29, WIPF1, EYA4, ALDH3A, LOX, AKR1C1, LZTS1, CRACR2A, and HEYL mRNAs in the sphere-formed relative to attached cells. *Statistically significant difference (p < 0.05) between sphere-formed and attached cells through t-test and at least three repetitions were conducted. SCLC: small cell lung cancer; qrt-PCR: quantitative real-time PCR.

Table 4.

Differentially expressed genes between attached and sphere-formed SCLC cells.

Gene symbol	Gene description
TRIM29	tripartite motif containing 29
WIPF1	WAS/WASL interacting protein family member 1
EYA4	EYA transcriptional coactivator and phosphatase 4
ALDH3A	aldehyde dehydrogenase 3 family member A1
LOX	lysyl oxidase
AKR1C1	aldo-keto reductase family 1 member C1
LZTS1	leucine zipper tumor suppressor 1
CACNA2D1	calcium voltage-gated channel auxiliary subunit alpha2 delta 1
HEYL	hes related family bHLH transcription factor with YRPW motif-like

SCLC: small cell lung cancer.

WIPF1-siRNAs downregulate WIPF1 thereby inhibiting proliferation capacity and promoting sensitivity to cisplatin of NCI-H446 and NCI-H209 cells

To suppress WIPF1 expression, SCLC cell lines were transfected with siRNAs designed to specifically target WIPF1, while non-targeting siRNAs served as negative controls. qRT-PCR results ( Figure 2A ) and western blots (Figure 2B and 2C) revealed that WIPF1 expression was indeed downregulated in NCI-446 after transfection with WIPF1- relative to control siRNAs. Results from the CCK8 assay its effects on proliferation ( Figure 2D ) and sensitivity to cisplatin (3.2 µg/ml) compared to control cells in NCI-H446 ( Figure 2E ). Besides, knocking down WIPF1 in SCLC cells resulted in decreased proliferation ( Figure 3A ) and higher sensitivity to cisplatin (3.2 µg/ml) compared to control cells in NCI-H209 ( Figure 3B ). Collectively, the results demonstrated that WIPF1 knockdown could significantly suppress proliferative capacity of but enhance sensitivity of SCLC cells to cisplatin.

Figure 2.

Knockdown of WIPF1 significantly suppressed the proliferation activity and enhanced sensitivity to cisplatin in small cell lung cancer cells. (A) qRT-PCR results showing changes in WIPF1 expression in WIPF1-siRNA1, 2, and 3 groups of SCLC cell line NCI-H446. (B, C) Western blots showing levels of WIPF1 proteins in WIPF1-siRNA1, 2, and 3 groups of NCI-H446 cells, β-actin was used as a loading control through t-test and 2 repetitions were conducted. (D) CCK-8 assay results showing proliferation of NCI-H446 after transfection with WIPF1-siRNA 1 and 2. (E) CCK-8 assay results showing proliferation of NCI-H446 after transfection with WIPF1-siRNA2 and cisplatin treatment (3.2 µg/ml). *Statistically significant differences (p < 0.05) between WIPF1-siRNA-treated cells and control siRNA (A, C-E) through t-test and at least three repetitions were conducted. SCLC: small cell lung cancer; siRNA: small interfering RNA; qrt-PCR: quantitative real-time PCR.

Figure 3.

WIPF1 CCK-8 assay results showing proliferation (A) and cisplatin treatment (3.2 µg/ml) (B) of NCI-H209 cells after transfection with WIPF1-siRNA2. *Statistically significant difference (p < 0.05) between sphere-formed and attached cells through t-test and at least three repetitions were conducted. siRNA: small interfering RNA.

WIPF1 knockdown significantly suppressed colony-forming capacity and sphere formation of SCLC cancer cells

Next, we performed colony formation and sphere-formation assays, on NCI-H446 cell line, to evaluate the function of WIPF1 in SCLC. Results showed a significant reduction in the number of both spheres formation (Figure 4A and 4B) and colonies formation (Figure 4C and 4D) in SCLC cells, after WIPF1-siRNA treatment, proving that this gene might perform a crucial role in tumor development thus could reflect the malignancy and metastatic capacity of cancer cells. ³⁹

Figure 4.

WIPF1 knockdown significantly suppressed colony formation and sphere-formation capacity of small cell lung cancer cells. WIPF1-siRNA2 significantly reduced the number of cell spheres (A, B) and the number of cell colonies (C, D). *Statistically significant differences (p < 0.05) between sphere-formed and attached cells through t-test and at least three repetitions were conducted, Scale bar is 100μm. siRNA: small interfering RNA.

WIPF1 regulates SCLC through the YAP/TAZ signaling pathway

Previous studies have shown that YAP/TAZ plays a crucial role in the Hippo signaling pathway and performs vital functions in cellular plasticity. ⁴⁰ Silencing the WIPF1 gene significantly suppressed proliferation capacity of CSC cells in glioblastoma and breast cancer cells through the YAP/TAZ pathway. To clarify the underlying molecular mechanism, we analyzed expression of YAP/TAZ proteins in SCLC using western blot assay and found that both TAZ and YAP proteins were significantly downregulated after treatment with WIPF1-siRNAs (Figure 5A and 5B).

Figure 5.

WIPF1 regulated small cell lung cancer cells through the YAP/TAZ signaling pathway. Western blots (A) and relative gray value (B) showed that WIPF1 knockdown significantly downregulated YAP, and YAZ expression in NCI-H446. β-actin served as the loading control. *Statistically significant difference (p < 0.05) between sphere-formed and attached cells through t-test and two repetitions were conducted.

Considering that CD133 is widely recognized CSC-like cells molecular marker and Chromogranin A (CgA) is useful NE marker in SCLC. Western blots were used to observe their expression after treatment with WIPF1-siRNA2. The preliminary results indicated that CD133 and CgA were downregulated after WIPF1-siRNA2 treatment (supplementary figure 5).

Protein–protein interaction network of WIPF1

To understand WIPF1's relationship with other proteins in the pathway, we used the STRING Version: 11.0 (https://www.string-db.org/) to construct a protein–protein interaction network and reveal the protein's direct physical binding and indirect functional connections. Results showed that WIPF1 interacted with four protein kinases, namely BTK, SYK, BRK, and NCK, which might affect the related signaling pathways ( Figure 6 ).

Figure 6.

Protein–protein interaction network showing that WIPF1 interacts with four protein kinases (BTK, SYK, BRK, and NCK) through STRING website (https://cn.string-db.org/).

Discussion

Numerous studies have suggested that tumors might possess a stem cell-like subpopulation called CSCs.^29,41 Notably CSCs or tumor initiating cells have unlimited self-renewal capacity and could produce heterogeneous tumor cells, while failure to eradicate CSCs is a predisposes a body to tumor recurrence. ⁴² Another study found that CSCs exhibited enhanced cell plasticity, loss of cell polarity, and experienced epithelial mesenchymal transition compared to differentiated tumor cells. Consequently, they easily adapted to changes in the surrounding microenvironment and became more resistant to conventional therapies. ⁴³ Although previous studies have shown that targeting CSCs can be an attractive approach for effective cancer treatment, ⁴⁴ the underlying mechanism of action is poorly understood and was the focus of this study.

Abundance of CSCs in SCLC has been associated with rapid emergence of chemoresistance and spheroidal growth in vitro.^45,46 Results of the present study showed that sphere-formation capacity and chemoresistance play crucial roles in growth of CSC-like cells, while sphere-formation cultures represent a more effective approach for acquisition of enriched CSCs-like cells compared to traditional adherent culture.^31,47 Transcriptomic analysis has revealed that WIPF1 was upregulated in sphere-formed cells comparing to differentiated ones under adherent growth conditions (2D cultures) in SCLC cell lines. Results from siRNA-mediated silencing of WIPF1 suggested that reduction of this gene suppressed the cell viability and sphere-formation capacity of SCLC cells.

Accumulating evidence has demonstrated the essential role of WIPF1 in tumorigenesis and cancer progression. For example, Lamont and colleagues ⁴⁸ analyzed methylation profiles in keloids and found that WIPF1 was one of the top 10 hypomethylated genes. While Escoll et al. ²⁴ found that decreased WIPF1 expression was associated with the p53 mutation and significantly downregulated CSC marker expression and suppressed of CSC cell viability, thus restraining tumor growth in vivo through the YAP/TAZ signaling pathway. Additional evidence has also shown that YAP/TAZ may act as coactivators of TEADs to initiate tumor development and progression. ⁴⁹ Furthermore, AKT2 was found to phosphorylate WIPF1, while the BRAFV600E mutation downregulated methylation in WIPF1's promoter region, thereby upregulating its expression in thyroid cancer. ⁵⁰ Moreover, WIPF1 is involved in the regulation of development and progression of head and neck cancer, ⁵¹ while in NSCLC, SNHG6 upregulates ETS1 expression, thereby promoting the transcription of WIPF1. ⁵² Apart from these, WIPF1 was shown to act as an oncogene in pancreatic ductal adenocarcinoma, by regulating the miR-141/200c-WIPF1-YAP/TAZ pathway, and its upregulation correlated poor patient prognosis. ⁵³ WIPF1 could mediate the pro-tumorigenic role of PD-L1 in lung cancer. ⁵⁴ Additional evidence suggests that CD133 is regulated by YAP1 in the Hippo pathway in SCLC, which might be involved in radiation resistance, ⁵⁵ while inability of YAP/TAZ to bind to TEAD molecules renders it ineffective as an oncogene. ⁵⁶ Furthermore, the inhibition of the YAP/TAZ-TEAD interface was found to be a promising approach for cancer treatment. ⁵⁷ Chromogranin A (CgA) is a common diagnostic NE markers in lung NE carcinoma. ⁵⁸ Our preliminary results indicated that CgA were downregulated after WIPF1-siRNA2 treatment. Consistent with previous reports, these suggested YAP/TAZ might regulate NE to non-NE fate in SCLC, which was involved in therapeutic resistance in SCLC models. ⁵⁹ SCLC has been subclassified based on different transcription factors ASCL1, NEUROD1, and POU2F3, and recent studies suggest that different subtypes of SCLC cells would ultimately develop into YAP1-high tumors.^13,59 In the present study, we found that YAP/TAZ proteins were significantly downregulated in SCLC cells after treatment with WIPF1-siRNAs, suggesting that this is the underlying mechanism.

Protein–protein interaction network revealed that WIPF1 interacted with four protein kinases, namely BTK, SYK, BRK, and NCK, which might affect related signaling pathways. Taken together, the result of this study indicated that WIPF1 functions in pathogenesis and resistance of SCLC, suggesting its potential as a therapeutic target for this type of cancer.

The present study has several limitations. First, the precise molecular mechanism by which WIPF1 regulates the YAP/TAZ signaling pathway remains incompletely characterized, as we did not perform extended validation through animal models or human tumor specimen analyses. Considering the aggressive nature of SCLC and the scarcity of effective treatment options, further exploration of WIPF1's contribution to SCLC pathogenesis is both timely and warranted. Our subsequent research will focus on these key directions: (1) development of a WIPF1 overexpression plasmid system to proceed with the rescue experiments; (2) systematic screening for cellular proteins interacting with WIPF1 using co-immunoprecipitation coupled with mass spectrometry; and (3) collection of biopsy specimens from SCLC patients for further research. Additionally, we aim to investigate the potential involvement of WIPF1 in regulating novel cell death modalities in SCLC, particularly focusing on its possible connection with pyroptosis pathways. These proposed investigations may provide new insights into therapeutic target development for this recalcitrant malignancy.

Conclusion

In summary, WIPF1 regulates colony formation and sphere-forming ability in SCLC cells, as well as modulates their sensitivity to cisplatin. Knocking down WIPF1 significantly suppresses proliferation capacity and cisplatin sensitivity of SCLC cells via the YAP/TAZ signaling pathway. Protein–protein interaction networks revealed that WIPF1 interacts with four protein kinases (BTK, SYK, BRK, and NCK), which might affect related signaling pathways. Therefore, WIPF1 plays a crucial role in development and progression of SCLC.