Inhibition of histone deacetylases 3 attenuates imiquimod-induced psoriatic dermatitis via targeting cGAS-STING signaling in keratinocytes

Abstract

Background

Psoriasis is a common chronic inflammatory skin disease characterized by epidermal keratinocyte hyperproliferation and persistent immune activation. Histone deacetylase 3 (HDAC3), a member of the class I HDAC family, plays critical roles in regulating immunity and inflammation. However, its precise expression profile and functional contribution to psoriasis pathogenesis remain poorly defined.

Methods

We first performed bioinformatics analysis of HDAC3 expression using the Gene Expression Omnibus (GEO) database. Subsequently, we employed a combination of cellular and molecular techniques, including hematoxylin and eosin (H&E) staining, immunohistochemistry, flow cytometry, quantitative real-time PCR (qRT-PCR), western blotting, and transmission electron microscopy (TEM), to analyze the role of HDAC3 in IMQ-induced psoriasis-like inflammation in mice and in vitro psoriasis models.

Results

HDAC3 expression was significantly upregulated in psoriasis lesions of patients and in both in vitro and in vivo models of psoriasis. Pharmacological inhibition of HDAC3 using the specific inhibitor RGFP966 alleviated IMQ-induced skin inflammation in mice and suppressed psoriasis-like phenotypes in vitro. Mechanistically, HDAC3 upregulation in an inflammatory microenvironment promoted oxidative stress, disrupted mitochondrial structural integrity, and triggered mitochondrial DNA leakage into the cytosol, thereby activating the cGAS-STING pathway in keratinocytes.

Conclusion

Our findings establish HDAC3 as a pivotal mediator of psoriasis pathogenesis through the cGAS-STING pathway via mitochondrial dysfunction. The role of HDAC3 in exacerbating epidermal hyperproliferation and inflammation highlights its potential as a therapeutic target. Targeting HDAC3 in keratinocytes may offer a novel strategy for preventing and treating psoriasis by modulating epigenetic regulation, mitochondrial homeostasis, and innate immune responses.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12967-025-06544-w.

Introduction

Psoriasis is a common chronic immune-mediated, refractory systemic inflammatory skin disease characterized by high relapse rates following drug withdrawal, affecting approximately 3% of the global population [1, 2]. While significant therapeutic advancements have been made through the development of neutralizing antibodies and immunosuppressors over recent decades, both treatment-related adverse events and disease recurrence remain major challenges, imposing substantial physical, psychological, and economic burdens on patients. Emerging evidence further associates psoriasis with multiple comorbid conditions [3], thereby contributing to significant public healthcare economic costs. The pathophysiological hallmarks of psoriasis involve aberrant keratinocyte hyperproliferation and sustained inflammatory responses. Despite these well-characterized histopathological features, the etiology of psoriasis remains incompletely elucidated, with complex interactions between genetic predisposition, immune dysregulation, and environmental factors [4] implicated in its pathogenesis. Therefore, a comprehensive understanding of the molecular mechanisms underlying psoriasis is essential for future treatment strategies.

The keratinocytes are the critical cell population in mediating inflammation and tissue damage and serve as a key cellular target for the treatment of psoriasis [5, 6]. While the pathogenesis of psoriasis involves multifactorial interactions, accumulating evidence highlights inflammation and oxidative stress as critical pathogenic drivers [7–10]. Mitochondria, as central organelles for energy production and redox homeostasis, are the primary source of reactive oxygen species (ROS) under both physiological and pathological conditions. Chronic ROS overproduction combined with impaired antioxidant defenses disrupts mitochondrial function, manifesting as loss of mitochondrial membrane potential (MMP), mitochondrion DNA (mtDNA) damage, and cytosolic mtDNA leakage [11]. Notably, a recent study revealed significantly elevated levels of circulating extracellular mtDNA in psoriatic patients compared to healthy controls [12]; however, the molecular mechanisms underlying mtDNA elevation and exert function in this context remain poorly defined. The precise relationship between ROS accumulation, mtDNA dynamics, and psoriasis pathogenesis remains unresolved. Specifically, whether ROS-driven mitochondrial dysfunction directly contributes to mtDNA upregulation and subsequent promoting disease progression requires systematic investigation. Given the established links between oxidative stress and immunopathology in psoriasis, clarifying the functional roles of mtDNA in modulating ROS production and inflammatory responses holds significant translational potential. These findings may inform the development of targeted therapies aimed at restoring mitochondrial homeostasis and alleviating disease severity.

The cyclic GMP–AMP synthase (cGAS)- stimulator of interferon genes (STING) pathway, a crucial innate immune sensor of cytosolic DNA/RNA and DNA hybrids [13, 14], is upregulated in both psoriatic lesions and IMQ-induced psoriasis-like mouse models [15–17]. Upon DNA binding, cGAS undergoes conformational activation to stimulate STING, promoting the expression of proinflammatory cytokines and amplifying immune responses [18]. This pathway in autoimmune diseases is well-documented, including rheumatoid arthritis [19], systemic lupus erythematosus [20], and osteoarthritis [21]. In psoriasis, pharmacological blockade of the cGAS-STING pathway attenuates inflammation, underscoring its therapeutic potential. However, the precise molecular mechanisms linking HDAC3 to cGAS-STING axis activation in psoriasis remain unexplored.

Histone deacetylases (HDACs), which modulate epigenetic landscapes, mitochondrial function, and immune responses [22, 23], have emerged as critical regulators in psoriasis. HDAC3, a class I HDAC member, is significantly upregulated in psoriatic lesions [24] and imiquimod (IMQ) induced mouse models [25] macrophages stimulated by LPS or IMQ upregulate HDAC1, 2, 3, and 6 expression, while trichostatin A attenuates this response [26]. Bioinformatics analysis further reveals elevated hdac3 mRNA expression in psoriasis patients [25]. Despite these findings, the experimental investigation role of HDAC3 in keratinocytes and its functional mechanisms in psoriasis pathogenesis remains unexplored.

This study aims to investigate HDAC3 regulatory functions in keratinocytes and its contribution to psoriasis pathogenesis. We demonstrate that HDAC3 is significantly upregulated in both psoriatic patients and IMQ-induced models. Using pharmacological approach, we identify a novel HDAC3-cGAS-STING axis that drives ROS-mtDNA-mediated inflammation. HDAC3 inhibition reduces ROS production, preserves mitochondrial integrity, prevents mtDNA translocation into the cytosol, and suppresses cGAS-STING signaling, thereby alleviating inflammatory responses. Collectively, these findings establish HDAC3 as a pivotal therapeutic target for psoriasis, offering insights into precision medicine strategies targeting epigenetic-oxidative-mitochondrial pathways.

Materials and methods

Ethics statement

Skin tissues were collected from 20 psoriasis patients at Shunde Hospital, Southern Medical University (Foshan, China) between January 2023 and December 2024. Histopathological confirmation of psoriasis was performed through microscopic evaluation of hematoxylin and eosin (H&E)-stained sections. All samples were obtained with written informed consent from the participants, and the study protocol was approved by the Ethics Committee of Shunde Hospital, Southern Medical University (Approval No. KYLS20231055), in strict compliance with the Declaration of Helsinki and applicable ethical guidelines for human research.

Gene expression profiles and bioinformatics analysis

The gene expression profiles of psoriasis were obtained from the Gene Expression Omnibus (GEO) Database (https://www.ncbi.nlm.nih.gov/geo/), a public repository containing extensive high-throughput sequencing data submitted by global research institutions. For this study, we downloaded the microarray dataset GSE13355 from GEO, comprising skin transcriptomic profiles generated using the Affymetrix^® GPL570 platform (Human Genome U133 Plus 2.0 Array). The dataset includes 64 skin samples from healthy controls (NN: normal skin) and 58 psoriasis patients (PN: uninvolved skin; PP: lesional skin). The raw expression data were pre-processed by the Robust Multi-array Average (RMA) algorithm in the affy package in Bioconductor, which performed background correction and quantile normalization, and log2 transformation to standardize probe-level intensities across arrays. Differentially expressed genes (DEGs) were identified using the “limma” R package by fitting linear models to compare gene expression across NN, PN, and PP groups. The DEGs were seleted based on adjusted p-value < 0.05 and the absolute value of| log2 fold change| > 1. The hdac3 mRNA expression levels across the three cohorts were analyzed, with normalized expression visualized via bar plots generated by ggplot2 (v3.3.5).

Cell culture and treatment

The spontaneously immortalized human epidermal keratinocytes (HaCaT) were propagated in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, Cat. No. 11995-043) supplemented with 10% fetal bovine serum (FBS, Gibco, Cat. No. 10099-141), 100 U/mL penicillin (Gibco, Cat. No. 11875-047), and 100 µg/mL streptomycin (Gibco, Cat. No. 11407-047). Cells were maintained in a 37 °C humidified incubator with 5% CO₂ atmosphere, with medium replacement every 2 days. Passaging was performed using 0.25% trypsin-EDTA (Gibco, Cat. No. 25200-056) when reaching 80–90% confluency. For experimental treatments, cells were seeded at 2 × 10⁴ cells/cm² and cultured for 72 h prior to intervention.

Cell counting kit-8 assay

Cell viability was assessed using the Cell Counting Kit-8 (CCK-8, TargetMol, Cat. No. C0005). HaCaT cells were seeded into 96-well plates at a density of ​5 × 10³ cells/well in triplicate and cultured for 24 h to ensure cell attachment. Subsequently, cells were treated with RGFP966 (a specific HDAC3 inhibitor, Abcam, Cat. No. ab144819) at concentrations ranging from 0 to 20 µM for an additional 24 h. After treatment, 10 µL of CCK-8 reagent was added to each well, and the plates were incubated at 37 °C for 30 min. The absorbance at 450 nm was measured using a microplate reader (Victor Nivo 3 F, Perkin Elmer).

Psoriasis-like inflammatory cell model established

To establish a psoriasis-like inflammatory model in HaCaT cells, cells were seeded into 6-well plates at a density of ​1 × 10⁶ cells/well and synchronized in ​FBS-free medium for ​12 h to induce quiescence. Subsequently, cells were treated with proinflammatory cytokine combinations: IL-17 A (10 ng/mL), IL-1α (10 ng/mL), and TNF-α (5 ng/mL) as M1; IL-17 A (10 ng/mL), IL-1α (10 ng/mL), TNF-α (5 ng/mL), and IL-6 (5 ng/mL) as M2. Treatment was performed in complete medium for 24 h. After induction, cellular morphology was visualized using a phase contrast microscope (Leica DMI8). The psoriasis relevant gene was evaluated by qRT-PCR. This protocol reliably recapitulates key pathophysiological features of psoriasis.

5-ethynyl-2’-deoxyuridine (EdU) assay

Cell proliferation was quantified using the ​EdU Cell Proliferation Assay Kit (Thermo Fisher Scientific, Cat. No. E10187). HaCaT cells were first induced into a psoriasis-like inflammatory model as previously described. After treatment with RGFP966 (HDAC3 inhibitor) at a specific concentration (optimized in preliminary experiments) for 24 h in a 37 °C humidified incubator with 5% CO₂, cells were exposed to 50 µM EdU and further incubated for 2 h. Subsequently, cells were Fixed with 4% paraformaldehyde for 15 min at room temperature, permeabilized with 0.1% Triton X-100 for 5 min, stained with EdU solution (Thermo Fisher Scientific) for 30 min. Counter stained with Hoechst 33,342 (1 µg/mL) for 10 min. Fluorescent images were acquired using a Leica DMI8 microscope. Nuclei were counted in ​6 random fields per well using ImageJ software.

Intracellular reactive oxygen species measurement

HaCaT cells were seeded in 6-well or 24-well plates. For psoriasis-like inflammation induction, cells were treated with combination cytokines (IL-17 A/IL-1α/TNF-α + IL-6) in the presence of RGFP966 (5µM) at optimized concentrations. After 24-hour treatment, cells were incubated with DCFH-DA (Cat. No. EEA019, 2’,7’-dichlorofluorescin diacetate, Thermo Fisher Scientific) at a final concentration of 10 µM in pre-warmed fresh medium for 30 min at​37 °C. Cells were gently rinsed three times with PBS to remove excess probe, cells were analyzed using a flow cytometer (FACSAria, Becton Dickinson). Nuclei were stained with Hoechst 33,342 (1 µg/mL) for 5 min at room temperature and obtain image on confocal microscopy (Leica SP8). The mean fluorescence intensity was quantified by Image-Pro Plus 6.0 software (IPP 6.0; Media Cybernetics) and Flow Jo Version 10.8.1.

Mitochondrial membrane potential assay

The HaCaT cells were seeded in 6-well plate or 24 well plate with cells climbing treated with combination cytokines (IL-17 A/IL-1α/TNF-α + IL-6) in the presence of RGFP966, respectively. The mitochondrial membrane potential was evaluated with enhanced mitochondrial membrane potential assay kit (C2003S, Beyotime, China). JC-1 monomeric form in the cytoplasm and has a green fluorescence (529 nm), JC-1 aggregates form has red fluorescence (590 nm). The different treatment cells climbing or collecting cell were incubated with a diluted JC-1 probe in fresh medium at 1:1000 in the dark at 37 °C for 20 min. For microscope observation, after incubation, the cells climbing washed twice with JC-1 staining buffer, nuclear staining with Hoechst 33,342 images were captured using a confocal microscope (SP8, Leica). Mean fluorescent intensity was calculated using Image-Pro Plus 6.0 software. For flow analysis, the cells were washed with staining buffer analyzed by a flow cytometer (FACSAria, Becton Dickinson) and Flow Jo Version 10.8.1 was used for data analysis and calculated to assess the loss of mitochondrial membrane potential.

Transmission electron microscopy (TEM) analysis of mitochondrial ultrastructure

The treatment HaCaT cells were fixed with 4% glutaraldehyde solution(Servicebio, Wuhan, G1102) overnight and then post fixed with 1% osmium tetroxide for 2 h at 4 °C. The fixed cells were rinsed with distilled water, dehydrated with an ethanol and methanol gradient, and embedded. The samples were sectioned using an ultramicrotome and double stained with uranyl acetate and lead citrate. TEM images were taken under a Hitachi H-7650 instrument.

Immunofluorescence (IF) staining

The HaCaT cells were seeded in 24 well plate with cells climbing treated with combination cytokines in the presence of RGFP966 for 24 h. The cells were washed with cold PBS for 3 times, fixing with 4% paraformaldehyde for 15 min, permeabilised with 0.3% Triton X-100 for 30 min, and blocking with 5% BSA for 60 min, then incubated with primary anti- HDAC3 antibody (1:100, BM4434, Boster, China) and anti-cGAS antibody (1:100, sc-515777, Santa cruz biotechnology) overnight at 4 °C. Secondary antibody FITC/CY3 conjugated goat anti-mouse/rabbit (1:200, Boster, China) was added and incubated for 60 at room temperature. DAPI was used to stain cell nuclei. After final washing, sections were protected with coverslips, with the nucleus visualized with DAPI (Southern Biotech, USA). Immunofluorescence staining was then examined using a confocal microscope (Leica, SP8).

Animal grouping, model establishment, and intervention

C57BL/6 male mice (8 weeks old, 20 ± 2 g) were obtained from the Guangdong Medical Laboratory Animal Facility (Foshan, China) and maintained under a 12:12-hour light/dark cycle with free access to food and water. All experimental protocols were approved by the Animal Ethics Committee of Shunde Hospital, Southern Medical University and conducted in accordance with the NIH Guide for the Care and Use of Laboratory Animals. Animals were acclimated for 2 weeks prior to experimentation. On day 0, mice were anesthetized with 1.5% isoflurane (RWD Life Science, Shenzhen, China) and shaved on the dorsal back to create a 3–4 cm² area. Twenty-four mice were randomly divided into four groups (n = 6 per group). Control group: Vehicle treatment (0.1% cream); IMQ group: Topical application of 62.5 mg IMQ cream (Sichuan Med-Shine, China) daily for 6 days; Model + 3 mg/kg group: IMQ treatment + subcutaneous injection of RGFP966 (3 mg/kg) daily; Model + 10 mg/kg group: IMQ treatment + subcutaneous injection of RGFP966 (10 mg/kg) daily. Clinical assessments were performed as follows. Psoriasis Area and Severity Index (PASI): Independently graded by two investigators using a 4-point scale (0–4) for erythema and scaling. Body weight was recorded every day until sacrifice. The spleen weights were normalized with body weights to obtain spleen organ index (Spleen weight/Body weight) and results are expressed in mg/g. At day 7, mice were euthanized via carbon dioxide inhalation. Dorsal skin, peripheral blood, and spleen samples were collected for following analysis.

Histological analysis

Skin tissues from humans and mice, as well as spleen samples from mice, were fixed with 4% paraformaldehyde for 24 h at room temperature. Tissues were ​dehydrated through a graded ethanol series (70%, 80%, 90%, 100%), embedded in ​paraffin wax, and sectioned into 5 μm-thick slices. Hematoxylin and eosin (H&E) staining was performed using Solarbio H&E Staining Kit (Cat. No. G1120) according to standard histological protocols. For immunohistochemical analysis, paraffin sections were dewaxed in xylene and rehydrated in graded alcoho. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide (H₂O₂) for 10 min, followed by antigen retrieval in 0.1 M citrate buffer (pH 6.0) heated to 95 °C for 15 min, then cooled at room temperature for 30 min. Sections were blocked with 5% bovine serum albumin (BSA) (Cat. No. HY-D0842, MCE) for 1 h at room temperature. Primary antibodies from HUABIO (anti-HDAC3, 1:100; anti-cGAS, 1:100; anti-STING, 1:100) diluted in 5% BSA were incubated overnight at 4 °C. After three washes with PBST, sections were incubated with biotin-conjugated secondary antibodies (goat anti-rabbit IgG, 1:200; Invitrogen) for 1 h at room temperature. Positive signals were visualized using 3,3’-diaminobenzidine tetrahydrochloride (DAB, Cat. No. K1805, HUABIO), followed by hematoxylin counterstaining for 5 min at room temperature. Fluorescent and brightfield images were captured using a Leica DM4B microscope, and positive staining areas were quantified by calculating the integrated optical density (IOD) in five randomly selected fields per section using Image-Pro Plus 6.0 (Media Cybernetics).

Enzyme-linked immunosorbent assay (ELISA)

The concentrations of mouse serum cytokines (IL-6, IL-10, TNF-α, IL-17 A, and IL-22) were quantified using ​Bioswamp Life Science Lab ELISA Kits (Cat. Nos. MU30044, MU30055, MU30030, MU30386, MU30582). Serum samples were collected from mice, stored at -80 °C, and processed as follows: 40 µL of sample was combined with 10 µL of biotinylated primary antibody in each well, vortexed briefly, and incubated at room temperature for 1 h. Subsequently, 50 µL of HRP-conjugated secondary antibody was added, followed by 30-min incubation at 37 °C. Plates were washed three times with 1× washing buffer to remove unbound reagents. 100 µL of TMB chromogen solution was then added to each well, shaken gently, and incubated in the dark for 10 min. The reaction was terminated by adding 50 µL of stop solution, resulting in a color change from blue to yellow, and absorbance was measured at 450 nm using a Victor Nivo 3 F microplate reader (Perkin Elmer). Cytokine concentrations were determined by analyzing standard curves generated with recombinant cytokines using a four-parameter logistic equation.

MDA, GSH, LDH, and SOD quantification analysis

After homogenizing the mouse skin tissues and collecting treatment cells in pre-clod PBS and centrifuging the homogenate at 8000 r/min for 15 min at 4 °C, the supernatant was collected for the quantification of MDA, GSH, LDH, and SOD according to the manufacturer’s instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Briefly, for MDA quantification, the thiobarbituric acid (TBA) method was used, with samples incubated at 95 °C for 40 min and absorbance measured at 532 nm. GSH levels were determined using the 5,5-dithio-bis (2-nitrobenzoic acid) (DTNB) method, with absorbance measured at 412 nm after a 10-minute incubation at room temperature. LDH activity was assessed by adding the LDH substrate solution and measuring absorbance at 450 nm after a 30-minute incubation at 37 °C. SOD activity was measured using the hydroxylamine method, with absorbance measured at 550 nm after a 20-minute incubation at 37 °C.

RNA extraction, cDNA synthesis, and real-time RT-PCR

Total RNA from mouse skin tissues or HaCaT cells was extracted using TRIzol^® reagent (Invitrogen, Cat. No. 35968603 or Mabio, Guangzhou, Cat. No DNU333-02) according to the manufacturer’s instructions. RNA isolation was performed by homogenizing tissues in pre-chilled TRIzol, followed by centrifugation at 12,000 ×g for 15 min at 4 °C to separate the aqueous phase. The RNA pellet was washed twice with 75% ethanol, dried, and resuspended in RNase-free water. RNA quality was assessed using Nanodrop Spectrophotometer (Thermo Fisher Scientific), with A260/A280 ratios between 1.8 and 2.1 to confirm integrity. Reverse transcription was carried out using Vazyme PrimeScript™ RTase Kit with gDNA Eraser (Cat. No. R205-01) to eliminate genomic DNA contamination. The reaction mixture (20 µL) contained 1 µg RNA, 10 µL PrimeScript RTase Buffer, 2 µL gDNA Eraser Enzyme Mix, and 7 µL RNase-Free Water, incubated at 37 °C for 5 min, followed by 85 °C for 5 s to inactivate enzymes. For qPCR analysis, specific primers targeting genes of interest (Table 1) and GAPDH (internal control) were designed using Primer Premier 6.0. The PCR reaction consisted of 1 µL cDNA, 10 µL 2×SYBR^® Green PCR Master Mix (Applied Biosystems), 1 µL forward/reverse primer pair (10 µM each), and 7 µL ddH₂O. Amplification was performed on a CFX96 Touch Real-Time PCR System (Bio-Rad, Hercules, CA) with the following cycling conditions: 95 °C for 30 s, 60 °C for 30 s (annealing temperature depends on primer specificity), and 72 °C for 30 s, repeated for 40 cycles. Fluorescence signals were detected and relative mRNA expression levels were calculated using the 2^−ΔΔCT method. Each sample was run in ​triplicate, and data normalization was performed against GAPDH to account for inter-sample variation.

Table 1.

Reverse transcription-polymerase chain reaction primers

Gene	primer forward (5’-3’)	primer reverse (5’-3’)
Human-STING	CACTTGGATGCTTGCCCTC	GCCACGTTGAAATTCCCTTTTT
Human-Ki-67	CCTCAGCACCTGCTTGTTTG	TCCCTGAGCAACACTGTCTTT
Human-cGAS	ACATGGCGGCTATCCTTCTCT	GGGTTCTGGGTACATACGTGAAA
Human-TBK	GGAAGCGGCAGAGTTAGGTG	TCGGATGAGTGCCTTCTTGA
Human-HDAC3	CCTGGCATTGACCCATAGCC	CTCTTGGTGAAGCCTTGCATA
Human-Keratin 16	CAGCGAACTGGTACAGAGCA	GTTCTCCAGGGATGCTTTCA
Human-Keratin 17	CGAGGATTGGTTCTTCAGCA	GTTCTCTGTCTCCGCCAGGT
Human-S100A7	TGCTGACGATGATGAAGGAG	ATGTCTCCCAGCAAGGACAG
Human-TNF-α	ACCAGAGCGGCAAGAAGAA CCAT	CATCAGACATCGGAGGCAGGAAG
Human-PI3	CAGCTGAAGCAGAGGCTTAC	CAGGCTTAGTGGAGACTGGA
Human-GAPDH	AATCCCATCACCATCTTC	AGGCTGTTGTCATACTTC
Mouse -cGAS	AGGAAGCCCTGCTGTAACACTTCT	AGCCAGCCTTGAATAGGTAGTCCT
Mouse -STING	GGCGTCTGTATCCTGGAGTA	TAGACAATGAGGCGGCAGTTAT
Mouse-SOD-1	CCACGTCCATCAGTATGGGG	CGTCCTTTCCAGCAGTCACA
Mouse-SOD-2	GTGTCTGTGGGAGTCCAAGG	CCCCAGTCATAGTGCTGCAA
Mouse-HDAC3	CCGCATCGAGAATCAGAACTC	CCTTGTCGTTGTCATGGTCGCC
Mouse-GAPDH	GCACCGTCAAGGCTGAGAAC	TGGTGAAGACGCCAGTGGA

Mitochondrial DNA isolation and quantification

To extract all cell mitochondria, the mitochondrial isolation kit (Cat. No. SM002, Solarbio, Beijing, China) was used following the manufacturer’s instructions. Briefly, cells were collected by centrifugation at 600 × g for 5 minutes at 4°C, washed with ice - cold PBS, and resuspended in 1× Cytosol Extraction Buffer I. After incubation on ice for 10 minutes, the cells were homogenized using a Dounce tissue grinder. The homogenate was centrifuged at 1200 × g for 10 minutes at 4°C to remove nuclei and intact cells, and the supernatant was transferred to a fresh tube and centrifuged again at 10,000 g for 30 minutes at 4°C. The resulting pellet, containing the isolated mitochondria, was resuspended in 1× Cytosol Extraction Buffer I. Freshly isolated mitochondria were then used to isolate mtDNA using the mitochondrial DNA isolation kit (Cat. No. ab65321, Abcam). The mitochondrial pellet was lysed in Mitochondrial Lysis Buffer III on ice for 10 minutes, followed by the addition of Enzyme Mix and incubation at 50°C for 60 minutes until the solution became clear. Ethanol precipitation was performed by adding absolute ethanol and incubating at -20°C for 10 minutes, followed by centrifugation at full speed in a microcentrifuge for 5 minutes at room temperature. The DNA pellet was washed twice with 70% ethanol, air - dried, and resuspended in TE Buffer I. The extracted mtDNA was stored at -80°C for subsequent analysis. For quantitative real-time polymerase chain reaction (qPCR) assay. The primer sequences were as follows: human NADH dehydrogenase 1 gene (mtDNA): forward 5’-ATACCCATGGCCAACCTCCT-3’, reverse 5’-GGG CCTTT

GCGTAGTTGTAT-3’; human b-globin (nuclear DNA): forward 5’-GTGCACCTGA

CTCCTGAGGAGA-3’, reverse 5’-CCTTGATACCAACCTGCCCAG-3’. Mouse NADH dehydrogenase 1 gene (mtDNA) forward primer: 5’-TATCTCAACCCTAGC

AGAAA-3’; reverse primer: 5’-TAACGCGAATGGGCCGGCTG-3’. Then RT-qPCR analysis was performed as descripition above.

Western blot analysis

Protein extraction and Western blot analysis were performed as previously described [27, 28]. Briefly, human and mouse skin tissues as well as cell samples were lysed in RIPA buffer (Cat. No. 89901, Thermo Fisher Scientific) containing 1 mM PMSF (Cat. No. 36978, Thermo Fisher Scientific) and complete protease inhibitor cocktail on ice. The lysates were centrifuged at 12,000 ×g for 15 min at 4 °C, and the supernatant was collected. Total protein concentration was determined using a BCA Protein Assay Kit (Cat. No. 23227, Thermo Fisher Scientific) with absorbance measured at 560 nm. For Western blotting, proteins were denatured by heating at 100 °C for 5 min in​loading buffer containing 2% SDS and 10% β-mercaptoethanol, then separated by 12% SDS-PAGE. After electrophoresis, proteins were transferred to PVDF membranes (Cat. No. 88520, Thermo Fisher Scientific) and blocked with 5% bovine serum albumin (BSA) for 1 h at room temperature. The membranes were incubated overnight at 4 °C with the following primary antibodies: Anti-HDAC3(1:1000, sc-81600, Santa Cruz Biotechnology); Anti-Phospho-TBK1 (Ser616) (1:1000, #5483, Cell Signaling Technology); Anti-TBK1 (1:1000, #3504, Cell Signaling Technology); Anti-SOD1 (1:1000, #37385, Cell Signaling Technology); Anti-SOD2 (1:1000, #13141, Cell Signaling Technology); Anti-GAPDH (1:1000, #2118S, Cell Signaling Technology); After washing three times with TBST (Tris-buffered saline containing 0.1% Tween-20), the membranes were incubated with HRP-conjugated secondary antibodies (goat anti-rabbit/mouse IgG, Cat. No. S0B4004/S0B4006.1:2000, Starter Biotechnology) for 1 h at room temperature. Protein bands were visualized using ECL Detection Kit (Cat. No. 34580, Thermo Fisher Scientific) on a ChemiDoc™ Touch Imaging System (Bio-Rad). Densitometric analysis was performed using Quantity One software (Bio-Rad), with protein expression normalized to GAPDH as an internal control.

Statistical analysis

All experiments were performed three times independently. Data are presented as the mean ± standard deviation (SD). Statistical analysis was performed using GraphPad Prism8.0.2 (GraphPad Software Inc., San Diego, CA, USA). One-way analyses of variance (ANOVAs) followed by Tukey post-hoc tests and unpaired Student’s t-tests were used to analyze the statistical significance among multiple groups and between two groups, respectively. A p-value < 0. 05 was considered statistically significant.

Results

HDAC3 and cGAS-STING signaling pathway dysregulation in psoriasis

HDAC3 is aberrantly upregulated in psoriasis pathogenesis, with its expression levels significantly elevated in both IMQ-induced psoriasis-like mouse models [26] and human psoriasis lesions. To systematically investigate HDAC3’s role, we analyzed the GSE13355 dataset from GEO, containing 58 psoriasis patients and 64 healthy controls, converting raw data to log2-normalized expression values using the voom transformation [29]. This analysis revealed upregulation of hdac3 mRNA in psoriasis tissues compared to normal skin (Fig. 1A). To validate clinical relevance, we collected 7 psoriasis and 7 control skin samples. Hematoxylin-eosin (HE) staining confirmed epidermal hyperplasia and lymphocyte infiltration in psoriasis patients (Fig. 1B-C). Immunohistochemical (IHC) analysis further demonstrated ​HDAC3 expression in the epidermis of psoriasis patients, particularly in keratinocytes and infiltrating lymphocytes, while minimal expression was observed in normal skin (Fig. 1D). Given the established involvement of cGAS-STING signaling in psoriasis [16], we evaluated the expression of cGAS and STING. Both proteins exhibited strong immunoreactivity in epidermal keratinocytes and lymphocytes of psoriasis patients, contrasting with their low/absent expression in controls (Fig. 1E-F). Western blot analysis confirmed elevated protein levels of HDAC3, cGAS, and STING in psoriatic lesions versus normal skin (Fig. 1G). To explore the functional relationship between HDAC3 and cGAS-STING, we performed network analysis using the STRING database (https://cn.string-db.org/), revealing a profound interaction network between HDAC3 and components of the cGAS-STING pathway (Figure S1). Collectively, these findings establish that HDAC3 and cGAS-STING signaling are co-upregulated in psoriasis, with HDAC3 potentially acting as a regulatory hub in this inflammatory axis.

Fig. 1.

Enhanced expression of HDAC3 and activation of the cGAS-STING signaling pathway in human psoriatic skin A. The hdac3 mRNA expression analysis in GEO Database datasets: healthy skin (n = 64) and psoriatic lesions (n = 58) (accession number: GSE13355). B. Hematoxylin and eosin (H&E) staining of healthy versus psoriatic skin sections (bright-field microscopy). C. Quantification of epidermal thickness in healthy individuals (n = 7) and psoriasis patients (n = 7). D-F. Immunohistochemical detection of HDAC3 (D), cGAS (E), and STING (F) expression in normal and psoriatic lesional skin, representative staining patterns and quantitative integrated optical density (IOD) analysis (scale bar: 100 μm). G. Western blot analysis and quantification of HDAC3, cGAS, and STING protein expression in clinical normal skin samples (N, n = 4) and psoriatic lesional skin samples (P, n = 4). GAPDH served as the loading control. Individual sample values are shown as dots, and bars represent mean ± SD (error bars). Statistical significance was determined using Student’s t-test. *p < 0.05, ​​***p < 0.001 vs. Normal group; ns = not significant. IOD = Integrated Optical Density; SD = Standard Deviation; GEO = Gene Expression Omnibus

Pharmacological Inhibition of HDAC3 ameliorates IMQ-induced psoriasis-like dermatitis in mice

To further confirm the results of clinical findings and investigate the therapeutic potential of HDAC3 inhibition in psoriasis, we established an IMQ-induced psoriasis-like mouse model by topically applying 62.5 mg IMQ cream daily for 6 consecutive days. Mice were randomly divided into four groups: control (0.1% cream), IMQ (IMQ cream alone), IMQ + 3 mg/kg (IMQ cream + 3 mg/kg RGFP966), and IMQ + 10 mg/kg (IMQ cream + 10 mg/kg RGFP966). RGFP966 was administered via subcutaneous injection daily at doses of 3 mg/kg or 10 mg/kg, with corn oil used as a vehicle control in equivalent volumes (Fig. 2A). Clinical assessments included daily body weight monitoring, erythema/scaling scoring (PASI score), and spleen pathology analysis (H&E staining, spleen organ index). On day 7, the IMQ group exhibited severe inflammation, including marked erythema, scaling, splenomegaly, weight loss, and elevated PASI scores and spleen organ indices (Fig. 2B-G). In contrast, IMQ + 10 mg/kg treatment significantly alleviated these symptoms: reduced erythema/scaling (Fig. 2B-G), restored spleen structure (normalized white pulp integrity and reduced red pulp congestion) (Fig. 2H). Histopathological analysis confirmed that IMQ-induced parakeratosis, acanthosis, and epidermal thickening were partially reversed by 10 mg/kg RGFP966, while 3 mg/kg failed to induce notable changes (Fig. 2I-J). These findings collectively demonstrate that high-dose HDAC3 inhibition via RGFP966 effectively ameliorates IMQ-induced psoriasis-like inflammation and tissue damage in a dose-dependent manner.

Fig. 2.

Inhibition of HDAC3 alleviates IMQ-induced psoriasis-like skin inflammation in mice. A. C57BL/6 mice were randomly divided into four groups (n = 6 per group). The model group received topical application of 62.5 mg IMQ on the back skin for 6 consecutive days, the control group was treated with diluted basis cream, and two treatment groups received daily topical administration of RGFP966 (3/10 mg/kg) or corn oil vehicle control (IMQ group). B. After 7 days, representative macroscopic images of skin lesions. C. Splenomegaly evaluation by gross morphology. D. Body weight changes monitored daily from day 1 to day 7 were assessed. E. The Psoriasis Area and Severity Index (PASI) score was calculated daily using a 0–4 scale (0 = None; 1 = Slight; 2 = Moderate; 3 = Marked; 4 = Very marked) based on erythema, scaling, and induration components, with total scores derived from n = 5 mice/group. F-G. Spleen weight and organ coefficient (calculated as spleen weight [mg]/body weight [g] × 1000) were quantified at day 7. H-I. Histopathological analysis revealed spleen hyperplasia in H&E-stained sections (H: scale bars 1 mm [low magnification], 100 μm [high magnification]) and epidermal hyperplasia in skin sections (I: scale bar 100 μm). Epidermal thickness was quantified (J), and statistical significance was determined using one-way ANOVA with Tukey’s multiple comparisons. Data are presented as mean ± SD. **p < 0.01, ​***p < 0.001 vs. control group; ^#p < 0.05, ^##p < 0.01 vs. model group; ns = not significant

Given the established role of ROS-mediated oxidative stress in psoriasis pathogenesis [30], we assessed key biomarkers including SOD, MDA, GSH, and LDH in mouse skin tissues. In the IMQ group, antioxidant markers SOD and GSH were significantly reduced, while oxidative markers MDA and LDH were elevated compared to controls. Conversely, IMQ + 10 mg/kg RGFP966 treatment reversed these changes, restoring SOD/GSH levels and reducing MDA/LDH levels (Fig. 3A). The IMQ + 3 mg/kg group showed no significant differences from the IMQ group. To evaluate systemic inflammation, we quantified serum cytokines via ELISA. The IMQ group exhibited elevated pro-inflammatory cytokines (IL-6, TNF-α, IL-17 A, IL-22) and reduced anti-inflammatory IL-10. IMQ + 10 mg/kg treatment significantly downregulated pro-inflammatory cytokines and upregulated IL-10 compared to IMQ, whereas IMQ + 3 mg/kg failed to alter cytokine profiles (Fig. 3B). These findings collectively demonstrate that RGFP966 effectively alleviates both oxidative stress and inflammatory responses in IMQ-induced psoriasis models.

Fig. 3.

HDAC3 inhibition reduces oxidative stress and inflammatory cytokine secretion in IMQ-induced psoriasis-like skin inflammation. C57BL/6 mice were treated with IMQ (62.5 mg/day for 6 days) to establish psoriasis-like inflammation, followed by daily topical application of RGFP966 or vehicle control for 6 days. (A). Skin tissue levels of ​superoxide dismutase (SOD), ​lactate dehydrogenase (LDH), and ​glutathione (GSH) were quantified as follows, SOD activity in ​U/mg protein, GSH content in ​nmol/mg protein, and LDH activity in ​U/mg protein. (B). Serum concentrations of pro-inflammatory cytokines (IL-6, IL-17 A, ​IL-22, and ​TNF-α) and anti-inflammatory cytokines (IL-10) were measured via ELISA in ​pg/mL. Data are presented as ​mean ± SD (n = 5 mice/group). Statistical significance was determined using one-way ANOVA with Tukey’s multiple comparisons. *p < 0.05, **p < 0.01, ***p < 0.001 vs. control group; ^#p < 0.05, ^##p < 0.01 vs. model group; ns = not significant

HDAC3 Inhibition suppresses cGAS-STING signaling in IMQ-induced psoriasis-like mice

Building on our previous findings in clinical specimens, we investigated the role of ​cGAS-STING signaling in IMQ-induced psoriasis-like mouse models. Using RT-PCR, we quantified mRNA expression levels of hdac3, cgas, sting, sod-1, and sod-2 in skin tissues. Consistent with clinical and in vivo data, hdac3, cgas, and sting mRNA levels were significantly upregulated, while sod-1 and sod-2 were downregulated in the IMQ group compared to controls (Fig. 4A). Notably, high-dose HDAC3 inhibition (10 mg/kg RGFP966) reversed these trends that hdac3, cgas, and sting mRNA levels were reduced, and sod-1/sod-2 mRNA levels were restored (Fig. 4A). To confirm protein-level changes, we performed western blot analysis, revealing that HDAC3, cGAS, STING, SOD-1, and SOD-2 protein expression patterns paralleled their mRNA profiles in IMQ-induced dermatitis. Furthermore, phosphorylated TBK1 (Ser616), a downstream effector of the cGAS-STING pathway, was significantly downregulated in the IMQ + 10 mg/kg group (Fig. 4B-C), indicating suppressed pathway activation. Additionally, immunohistochemical staining confirmed these findings at the tissue level. The HDAC3, cGAS, and STING expression were reduced in the IMQ + 10 mg/kg group, while SOD-1/SOD-2 expression was increased, aligning with mRNA and protein data (Fig. 4D-F). Collectively, these results establish that HDAC3 inhibition suppresses cGAS-STING signaling activation and restores antioxidant defenses, thereby alleviating IMQ-induced psoriasis-like inflammation through modulation of oxidative stress and immune pathways.

Fig. 4.

HDAC3 inhibition disrupts cGAS-STING signaling and modulates antioxidant gene expression in IMQ-induced psoriasis-like skin inflammation. C57BL/6 mice were treated with IMQ (62.5 mg/day for 6 days) to induce psoriasis-like inflammation, followed by daily topical application of RGFP966 or vehicle control for 6 days. ​A. mRNA expression levels of ​hdac3, ​cgas, ​sting, ​sod1, and ​sod2 were quantified via quantitative PCR. ​B. Protein expression of HDAC3, cGAS, STING, p-TBK (phosphorylated TANK-binding kinase 1), SOD1, and SOD2 was analyzed by Western blot. ​C. Densitometric quantification of protein bands normalized to GAPDH. ​D-F. Immunohistochemical analysis of HDAC3 (D), cGAS (E), and STING (F) expression in skin lesions. Representative IHC images with 50 μm scale bar, quantitative IOD analysis (mean ± SD, n = 5). ​ ***p < 0.001 vs. control group ^#p < 0.05, ^##p < 0.01, ^###p < 0.01 vs. model group, ns = not significant

HDAC3 plays a critical role in keratinocyte proliferation under inflammatory cytokine stimulation

As HDAC3 abundant expression in psoriasis-affected keratinocytes and its role as both a target and driver of disease pathology, we explored its functional significance using HaCaT cells. First, we determined the non-cytotoxic of the HDAC3 inhibitor RGFP966 using a CCK8 assay. At concentrations <10 µM, RGFP966 exhibited no significant cytotoxicity, while concentrations > 20 µM caused crystallization (Fig. 5A). For HDAC3 inhibition studies, we selected 5 µM RGFP966 (non-toxic and effective based on western blot and RT-PCR analysis HDAC3 inhibition at this dose; Figs. 5B-C & S2). Next, we established in vitro psoriatic keratinocyte models by treating HaCaT cells with two cytokine combinations. M1 group: IL-1α + IL-17 A + TNF-α and M2 group: IL-1α + IL-6 + IL-17 A + TNF-α (modified from previous protocols [31, 32]. Cytomorphological analysis revealed that M1/M2 groups exhibited psoriasis-like features with enlarged cell size, irregular boundaries, and reduced cell density compared to controls (Fig. 5D). This was accompanied by upregulation of psoriasis-related genes (k16, k17, s100a7, tnf-α, pi3, ki-67) at both mRNA levels, with the M2 group showing more pronounced effects (Fig. 5E). Subsequently, we focused on the M2 group for mechanistic studies. Under M2 cytokine stimulation, HaCaT cells exhibited enhanced proliferative capacity, which was significantly inhibited by 5 µM RGFP966 (Fig. 5F-G & S3). These findings collectively establish that HDAC3 plays a critical role in sustaining keratinocyte hyperproliferation during psoriatic inflammation through modulation of both epidermal differentiation markers (k16/k17) and cell cycle regulators (ki-67), with its inhibition alleviating pathological proliferation.

Fig. 5.

HDAC3 inhibition suppresses HaCaT cells proliferation in psoriasis-like cell models. A. CCK-8 viability analysis of HaCaT cells treated with RGFP966 at concentrations ranging from 0 to 20 µM. Concentrations exceeding 20 µM caused crystallization and were excluded. B. Quantitative real-time PCR analysis of hdac3 mRNA expression in HaCaT cells after RGFP966 treatment. C. Western blot quantification of HDAC3 protein levels in HaCaT cells treated with increasing concentrations of RGFP966 (0–5 µM), normalized to GAPDH. D. Phase-contrast microscopy images of HaCaT cells treated with proinflammatory cytokines. ​M 1: IL-17 A (10 ng/mL) + IL-1α (10 ng/mL) + TNF-α (5 ng/mL); ​M 2: IL-17 A (10 ng/mL) + IL-1α (10 ng/mL) + TNF-α (5 ng/mL) + IL-6 (5 ng/mL), scale bar: 100 μm. E. Real-time PCR analysis of psoriasis-related genes (k16, k17, s100a7, tnf-α, pi3, ki67) in cells treated with combination cytokines. F. Morphological changes in HaCaT cells pre-treated with combination cytokines followed by RGFP966 or vehicle. Scale bar, 100 μm G. EdU proliferation assay of HaCaT cells treated with combination cytokines with or without RGFP966. Scale bar, 50 μm. One-way ANOVA with Tukey’s multiple comparisons test was used. Data are represented by mean ± SD, *p < 0.05, ***p < 0.001, compared with the control group

HDAC3 Inhibition mitigates mitochondrial oxidative stress and dysfunction in cytokine-induced keratinocytes

Oxidative stress driven by lymphocyte-secreted proinflammatory cytokines (IL-1α, IL-6, IL-17 A, and TNF-α) is a critical pathogenic factor in psoriasis, promoting ROS production in keratinocytes [33]. To investigate HDAC3 role in this context, we evaluated ROS levels, mitochondrial ultrastructure, morphology, and membrane potential (MMP) in HaCaT cells treated with a psoriatic cytokine cocktail (IL-1α, IL-6, IL-17 A, and TNF-α). Using the ROS-sensitive probe DCFH-DA, we observed that cytokine-stimulated cells exhibited significantly elevated ROS levels compared to controls, which were reduced by 5 µM RGFP966 (Figs. 6A-B). Simultaneously, SOD1 and SOD2 protein expression was downregulated in the combination cytokines inducing model group (Figs. 6C-E), while RGFP966 restored their expression, indicating attenuation of oxidative damage. The alteration of total SOD and GSH content was consistent with the protein expression of SOD1 and SOD2 in treatment cells (Figs. 6F-G), At the mitochondrial level, MitoTracker Red staining revealed fragmented mitochondria in cytokine-treated model group cells, whereas RGFP966 preserved mitochondrial integrity and prevented granular fragmentation (Fig. 6H). Transmission electron microscopy confirmed mitochondrial swelling, cristae disruption, and structural collapse in the cytokines inducing model group, which were partially rescued by RGFP966 (Fig. 6I). Furthermore, JC-1 staining demonstrated decreased red/green fluorescence ratios in the combination cytokines inducing model group, reflecting MMP depolarization, while RGFP966 treatment restored MMP stability (Figs. 6J-K). Collectively, these results establish that HDAC3 inhibition of RGFP966 suppresses ROS overproduction, restores antioxidant defenses (SOD1/SOD2), preserves mitochondrial structural integrity, and prevents MMP collapse in combination cytokines-stimulated keratinocytes, thereby alleviating mitochondrial dysfunction associated with psoriasis pathogenesis.

Fig. 6.

HDAC3 inhibition alleviates mitochondrial dysfunction in psoriasis-like cell models. HaCaT cells were treated with RGFP966 (5 µM) for 24 h to evaluate its protective effects on mitochondria in psoriasis-like conditions. ​A. ROS levels were quantified using DCFH-DA staining and Image J analysis DCF fluorescent intensity reflected cellular ROS content, while Hoechst 33,342 staining identified nuclei (scale bar: 50 μm; n = 3). ​B. Flow cytometric analysis confirmed reduced intracellular ROS in RGFP966-treated cells compared to the model group. ​C-E. Western blot and quantitative analysis revealed that RGFP966 treatment significantly upregulated SOD1 and SOD2 protein expression (normalized to GAPDH), which was associated with decreased oxidative stress in the model group. F-G. Cell levels of SOD and GSH were quantified with U/mg protein. H. Confocal microscopy demonstrated preserved mitochondrial structure (Mitotracker Red) and reduced nuclear fragmentation (Hoechst Blue) in RGFP966-treated cells (scale bar: 20 μm). ​I. Transmission electron microscopy (TEM) images showed intact cristae and less vacuolation in treated cells compared to the model group. ​ J. JC-1 staining revealed maintained mitochondrial membrane potential (red aggregates) in RGFP966-treated cells, whereas the model group exhibited depolarization (green monomers) (scale bar: 20 μm). K. Flow cytometric quantification confirmed significantly lower green-to-red fluorescence ratios in treated cells. Data are represented by mean ± SD, ***p < 0.001, compared with the control group; ^#p < 0.5, ^##p < 0.01, ^###p < 0.001, compared with the model group

Inhibition of HDAC3 blocked cGAS-STING signaling activation in inflammation cytokines inducing HaCaT cells

Our in vitro studies demonstrated that HDAC3 inhibition suppresses cGAS-STING signaling activation in HaCaT cells exposed to proinflammatory cytokines. To investigate the molecular basis of HDAC3 role in oxidative stress-induced mitochondrial dysfunction mimicking psoriatic pathophysiology, we hypothesized that proinflammatory cytokines might trigger mtDNA leakage via excessive ROS generation. This hypothesis was supported by three key observations. First, cytokines treatment induced mtDNA release exclusively from mitochondria into the cytosol with no nuclear DNA (nDNA) (Figs. 7A-B). Second, immunofluorescence analysis revealed that combined proinflammatory cytokines upregulated cGAS expression, which was effectively suppressed by HDAC3 inhibition (Fig. 7C). Third, western blot analysis showed that proinflammatory stimulation activated the cGAS-STING axis, evident by increased levels of cGAS, STING, and phosphorylated TBK1 (p-TBK), while HDAC3 inhibition attenuated all these protein expressions (Fig. 7D). Collectively, these findings reveal HDAC3 regulatory functions in preventing mtDNA leakage through reducing ROS-induced damage and blocking cGAS-STING activation. This molecular mechanism thereby explains how HDAC3 inhibition alleviates inflammation-driven mitochondrial dysfunction in psoriatic conditions by disrupting cytosolic DNA sensing and downstream signaling pathways.

Fig. 7.

HDAC3 inhibition disrupts cGAS-STING signaling in psoriasis-like cell models. A-B. RT-qPCR analysis of cytosolic DNA content and ​nuclear DNA (nDNA) in HaCaT cells treated with proinflammatory cytokines. ​C. Immunofluorescence co-staining the expression of HDAC3 and cGAS localization in RGFP966-treated cells. ​D. Quantitative analysis of protein expression of ​cGAS, ​STING, ​TBK1, and phosphorylated form (p-TBK1), GAPDH as a loading control. One-way ANOVA with Tukey’s multiple comparisons test was used. Data are represented by mean ± SD, **p < 0.01, ***p < 0.001, compared with the control group; ^#p < 0.5, ^##p < 0.01, ^###p < 0.001, compared with the model group

Discussion

Psoriasis is a chronic inflammatory skin disease involving both innate and adaptive immune responses, whose pathogenic mechanisms remain incompletely understood. Epigenetic studies have globally contributed to elucidating the pathological mechanisms in psoriasis [34]. Among the histone deacetylase family members, HDAC3 has been implicated in various inflammatory disorders, including inflammatory bowel disease [35], chronic kidney disease [36], and psoriasis [26]. A previous investigations revealed that hdac3 mRNA expression was upregulated in lesional skin samples of psoriasis patients compared with healthy controls [25]. Immunofluorescence staining showed that the expression of HDAC3 in psoriasis-like skin inflammation mice was significantly increased [26]. These studies suggested that HDAC3 was played an essential role for progression of psoriasis in mammals, as pro-BNP exhibited clinical relevance in diagnosing cardiovascular dysfunction [37]. Here, our current study provides novel insights into the role of HDAC3 in psoriasis. Using immunohistochemical and western blot analyses, we observed consistent upregulation of HDAC3 expression in lesional skin tissues from psoriasis patients. Moreover, mechanistic investigations revealed that HDAC3 interacts with the cGAS-STING signaling pathway in skin tissues, and pharmacological inhibition of HDAC3 through RGFP966 effectively ameliorates psoriasis-like inflammation via modulation of this signaling pathway. Furthermore, HDAC3 inhibition conferred mitochondrial protection against oxidative stress damage, highlighting an additional layer of pathophysiological relevance. The molecular mechanism by which HDAC3 modulates oxidative stress in vivo remains poorly understood. Hence, we propose that persistent accumulation of proinflammatory cytokines may establish a proinflammatory microenvironment that promotes HDAC3 upregulation and subsequently exacerbates oxidative stress, this hypothesis requires rigorous experimental validation.

To advance understanding of the molecular mechanisms underlying psoriasis pathogenesis and identify potential drug targets, the development of in vitro models of psoriasis has become indispensable. Over the years, various experimental approaches have been established to recapitulate psoriatic skin pathology using human keratinocytes. Previous studies have employed HaCaT cells treated with cocktails of proinflammatory cytokines, including IL-17 A, IL-22, oncostatin M, IL-1α, and TNF-α, to induce psoriasis-like phenotypes [38–40]. Notably, alternative strategies have also been explored, such as LPS/IL-22 co-stimulation to model hyperproliferation [41], LPS/TNF-α for inflammatory responses [42], TNF-α/IL-17 A combination [43] IL-22/TNF-α co-treatment [44], or IMQ application [45]. These studies collectively highlight the lack of consensus regarding optimal cytokine combinations for inducing reliable psoriasis-like phenotypes in vitro. In our study, we adapted a well-established protocol using a combination of TNF-α, IL-1α, IL-6, and IL-17 A to treat HaCaT cells, with minor modifications [46]. Morphological analysis revealed that cytokines treatment induced characteristic psoriatic features, including enlarged cell size, irregular boundaries, and reduced cell density—phenomena consistent with hyperproliferation and inflammation. Quantitative RT-PCR confirmed upregulation of psoriasis-associated markers (Ki-67, K16, K17, PI3, and S100A7) and proinflammatory mediators (TNF-α), validating the model fidelity. Notably, HDAC3 expression was significantly elevated in treated cells, aligning with previous findings that inflammatory environments promote HDAC3 upregulation in macrophages [47].

Recently, HDAC3 has attracted particular attention due to its ability to regulate inflammation and oxidative stress. Extensive studies have established its dual role in modulating inflammatory responses and oxidative stress pathways [48, 49]. Notably, HDAC3 promotes inflammatory gene expression in rheumatoid arthritis fibroblast-like synoviocytes [50, 51] and contributes to the pathogenesis of systemic lupus erythematosus [52]. Pharmacological inhibition of HDAC3 has demonstrated therapeutic potential in alleviating inflammatory disease [53–55]. Our current study not only confirmed the HDAC3 role in pathogenic contribution to psoriasis but also elucidated its molecular mechanisms of action. We observed consistent upregulation of HDAC3 expression in two distinct in vitro and in vivo models of psoriasis. In the cytokine cocktail-induced HaCaT cell model (TNF-α, IL-1α, IL-6, and IL-17 A), HDAC3 levels were significantly elevated compared to control cells. Similarly, in the IMQ-induced mouse model of psoriasis-like skin inflammation, aligning with previous findings that LPS-induced inflammatory environments promote HDAC3 nuclear/cytoplasmic translocation and upregulation in type II alveolar epithelial cells [55]. In addition, our comprehensive analysis revealed a profound imbalance in redox homeostasis in both in vitro and in vivo psoriasis models, with HDAC3 overexpression directly contributing to oxidative stress-mediated pathogenesis. In the cytokine-stimulated HaCaT cell model and IMQ-induced mouse model, we observed a marked elevation in pro-oxidant markers MDA and LDH alongside a significant decline in antioxidant defenses SOD activity and GSH content. Mechanistically, HDAC3 upregulation led to increased ROS production, which compromised mitochondrial integrity through the mitochondrial dysfunction and impaired MMP resulted in cytosolic leakage of mtDNA.

The cGAS-STING pathway represents a critical DNA-sensing mechanism that plays a dual role in host defense and pathological inflammation. While traditionally activated by pathogen-derived DNA or endogenous DNA damage [56], recent studies have revealed its activation by self-DNA species, including mtDNA and genomic DNA (gDNA), particularly in autoimmune disorders and cancer contexts [57, 58]. Mitochondria, as central hubs for ATP production and primary ROS sources, are highly susceptible to oxidative damage under stress conditions [59]. Our study uncovered a novel mechanism linking HDAC3 to psoriasis pathogenesis through the cGAS-STING pathway. Pharmacological HDAC3 inhibition suppressed ROS generation, preserved mitochondrial integrity, and blocked cGAS-STING pathway activation in both in vitro and in vivo. Under oxidative stress, mtDNA leakage into the cytosol triggered cGAS-STING activation, with no contribution from nDNA. This finding aligns with prior studies demonstrating HDAC3 role in cGAS-STING regulation across diverse diseases, including cerebral ischemia/reperfusion [54], acute pancreatitis [60], and acute lung injury [61]. Notably, our work establishes HDAC3 as a pivotal regulator of cGAS-STING signaling in psoriasis pathogenesis. Initial inflammatory stimuli trigger HDAC3 overexpression, which epigenetically suppresses antioxidant defenses and disrupts mitochondrial function. This leads to increased ROS production, causing oxidative damage to mitochondrial membrane integrity and subsequent mtDNA leakage into the cytosol. The released mtDNA activates the cGAS-STING pathway, thereby promoting inflammation upregulation of HDAC3. This creates a self-reinforcing loop, exacerbating chronic inflammation and epidermal hyperproliferation in psoriasis.

Previous studies have highlighted the role of HDAC3 in modulating inflammatory pathways, including its interaction with the p65 NF-κB signaling axis in psoriasis-like skin inflammation [26] and its regulation of the PI3K-AKT pathway in inflammatory processes [62]. Furthermore, research on brain tumors has revealed interconnected roles for cGAS-STING, NF-κB, and PI3K/AKT signaling in mediating tumor cell apoptosis [63]. These findings collectively raise an important question: to what extent do cGAS-STING, NF-κB, and PI3K/AKT signaling pathways interact and contribute to psoriasis pathogenesis? Our study demonstrates a significant increase in cytosolic mtDNA levels in psoriasis, which activates cGAS-STING signaling a mechanism similarly implicated in inflammatory arthritis, systemic lupus erythematosus, neurodegenerative diseases, and diabetic kidney disease through mtDNA-mediated cGAS-STING activation [64–66]. This observation suggests that mtDNA-driven cGAS-STING activation may represent a shared pathological feature across these conditions. However, further investigations are required to clarify whether mtDNA is the primary trigger of cGAS-STING signaling in disease progression, as well as to define the interplay between cGAS-STING, NF-κB, and PI3K/AKT pathways in psoriasis.

Taken together, our findings establish that HDAC3 plays a pivotal role in mediating psoriasis through activation of the cGAS-STING pathway, both in vitro and in vivo. Mechanistically, the inflammatory microenvironment induces HDAC3 overexpression. This elevation in HDAC3 expression leads to increased ROS generation, mitochondrial structural and functional damage, mtDNA released, and enhanced activation of the cGAS-STING signaling pathway (Fig. 8). Consequently, these changes exacerbate inflammatory responses in psoriasis-like skin lesion models. These findings position HDAC3 as a promising therapeutic target for psoriasis, offering new avenues for interventions targeting epigenetic regulation, mitochondrial function, and innate immune pathways.

Fig. 8.

Proposed mechanistic pathway for HDAC3 in mediating psoriasis. The mechanism model proposes that an ​inflammatory microenvironment induces ​HDAC3 overexpression in keratinocytes, which promotes ​ROS generation and mitochondrial structural/functional damage. This damage releases mtDNA into the cytosol, triggering ​cGAS-STING pathway activation

Electronic supplementary material

Below is the link to the electronic supplementary material.

Abbreviations

HDAC3

Histone deacetylase 3

mtDNA

mitochondrion DNA

MMP

mitochondrial membrane potential

ROS

reactive oxygen species

cGAS

cyclic GMP-AMP synthase

STING

stimulator of interferon genes

IMQ

Imiquimod

GEO

Gene Expression Omnibus

EdU

5-ethynyl-2’-deoxyuridine

DCFH-DA

2’,7’- dichlorofluorescin diacetate

IOD

integrated optical density

ELISA

enzyme-linked immunosorbent assay

MDA

malondialdehyde

​GSH

glutathione

​LDH

lactate dehydrogenase

​SOD

superoxide dismutase

Author contributions

CZ designed and drafted the manuscript. XW and ZW performed the experiments, XD reviewed and revised the manuscript. All authors read and approved the final manuscript.

Data availability

The data used to support the findings of this study are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

Approval of the research protocol by an Institutional Reviewer Board: The study protocol was approved by the Investigation Ethical Committee of Shunde Hospital of Southern Medical University. Informed Consent: All patients or their guardians were given and accepted informed consent. Registry and the Registration No. of the study/trial: The study protocol was approved by the Investigation Ethical Committee of Shunde Hospital of Southern Medical University (registration no. KYLS20231055).

Consent for publication

All authors consent this manuscript for publication.

Competing interests

The authors declare no potential conflicts of interest.