Skip to main content
NCBI home page
microPublication Biology logoLink to microPublication Biology
. 2025 May 19;2025:10.17912/micropub.biology.001608. doi: 10.17912/micropub.biology.001608

Impact of embryo size on apoptosis in C. elegans

Madiha Javeed Ghani 1, Jens Van Eeckhoven 1, Barbara Conradt 1,§
Reviewed by: Anonymous
PMCID: PMC12131072  PMID: 40463483

Abstract

During C. elegans development 131 somatic cells reproducibly undergo programmed cell death. Many of these 131 cells ‘programmed to die' are the smaller daughter of a neuroblast that divides asymmetrically and die through apoptosis. To determine whether cell size impacts the ability of cells programmed to die to undergo apoptosis, we increased or decreased embryo size by RNA interference-mediated knock-down of the genes C27D9.1 or ima-3 , respectively. We found that in apoptosis-compromised genetic backgrounds, C27D9.1 ( RNAi ) enhances and ima-3 ( RNAi ) partially suppresses inappropriate survival of cells programmed to die. This supports the notion that in C. elegans embryos, an increase in cell size compromises and a decrease in cell size promotes the ability of cells programmed to die to undergo apoptosis.

Figure 1. RNAi-mediated embryo size alterations and impact on the apoptotic death of the NSM sister cell .

Figure 1. RNAi-mediated embryo size alterations and impact on the apoptotic death of the NSM sister cell

Open in a new tab

(A) RNAi-mediated embryo size alterations. DIC images of representative embryos following sorb-1 (RNAi) , ima-3 (RNAi) or C27D9.1 (RNAi) are shown. Scale bars: 10μm. All embryos were analysed at a similar stage of embryonic development (about 220-cell stage). (B) Average embryo length after RNAi-mediated embryo size alterations. For statistical comparison, the lengths of ima-3 (RNAi) or C27D9.1 (RNAi) embryos were compared to the lengths of sorb-1 (RNAi) embryos . Statistical significance was determined by least square means method. p <0.001(***). (C) RNAi-mediated NSM neuroblast (NSMnb) size alterations. Fluorescence images of representative NSMnb following sorb-1 (RNAi) , ima-3 (RNAi) or C27D9.1 (RNAi) are shown. The P pie-1 mCherry::ph PLCΔ reporter ( ltIs44 ) was used to visualize cell boundaries. Scale bars: 3μm. (D) Average NSMnb size measurements after RNAi-mediated embryo size alterations. Each dot represents the estimated size of one NSMnb. The average size for each RNAi treatment is shown above the graph. Statistical significance was determined by Mann-Whitney U-tests. p <0.0001(****). (E) Schematics of the NSM lineage and the NSMsc survival assay. In wild type ( +/+ ), the NSMsc dies and its larger sister differentiates into the NSM neuron, which can be visualized in the anterior pharynx of L3/L4 larvae using the P tph-1 his-24 ::gfp reporter ( bcIs66 ). There are two bilaterally symmetric NSM lineages. For this reason, in +/+ there are two GFP-positive cells in the anterior pharynx. If the NSMsc inappropriately survives ('Mutant'), three to four GFP-positive cells are observed. (F) Average NSMsc survival (%) after RNAi-mediated embryo size alterations. NSM survival for each RNAi treatment was scored in a wild-type ( +/+ ) background and in the background of different ced-3 loss-of-function mutations ( n2438 , n2427 , n2436 , n717 ). All strains used were homozygous for the P tph-1 his-24 ::gfp reporter ( bcIs66 ). For statistical comparison, NSMsc survival in ima-3 (RNAi) or C27D9.1 (RNAi) was compared to NSMsc survival in sorb-1 (RNAi) for each genotype. One sided Fisher's exact tests were used to determine statistical significance. p <0.05 (*), p <0.01(**) and p <0.001(***).

Description

Many of the 131 cells that die during Caenorhabditis elegans development are the smaller daughter of a neuroblast (referred to as ‘mother' cell) that divides asymmetrically by both fate and size (Sulston and Horvitz, 1977; Sulston et al., 1983). Loss-of-function mutations of pig-1 , which encodes a PAR-1-like kinase orthologous to human MELK (maternal embryonic leucine zipper kinase), cause mother cells to divide symmetrically by size, thereby increasing the physical size of the normally smaller daughter cell i.e. the cell programmed to die (Cordes et al., 2006). In addition, these mutations cause inappropriate survival of cells programmed to die, indicating that they compromise the ability of these cells to undergo apoptosis (Cordes et al., 2006). Conversely, gain-of-function mutations of ect-2 , which encodes the C. elegans ortholog of the human RhoGEF Ect2 (Epithelial Cell Transforming 2), cause mother cells to divide more asymmetrically by size, thereby decreasing the physical size of the already smaller daughter cell i.e. the cell programmed to die (Sethi et al., 2022). In addition, these ect-2 gain-of-function mutations partially suppress the inappropriate survival of cells programmed to die caused by partial loss-of-function mutations of ced-3 (which encodes a caspase required for apoptosis in C. elegans ), indicating that they promote the ability of these cells to undergo apoptosis (Sethi et al., 2022). However, at least in the NSM neuroblast lineage ( Figure 1 ; see below), mutations in both pig-1 and ect-2 also affect the unequal inheritance of cellular components during asymmetric mother cell division (Wei et al., 2020; Sethi et al., 2022). For instance, during asymmetric NSM neuroblast division, the loss of pig-1 disrupts the unequal segregation - into the surviving NSM – of the anti-apoptotic transcription factor CES-1 , an ortholog of human SCRT1 and 2 (scratch family transcriptional repressor). As a result, the NSM sister cell, which is programmed to die, now inherits this anti-apoptotic factor (Wei et al., 2020). For this reason, it has been difficult to discern whether the inappropriate survival of cells programmed to die observed in pig-1 loss-of-function mutants is the result of their increased size, the inappropriate inheritance of anti-apoptotic factors or both. The rationale for the study described below was to change the physical size of cells programmed to die using genetic tools other than mutations that affect the ability of mother cells to divide asymmetrically and to determine the impact of this change on the ability of the resulting cells to undergo apoptosis.

The C. elegans genes ima-3 and C27D9.1 encode an importin alpha protein and a protein predicted to be involved in fucosylation, respectively (Geles and Adams, 2001; WormBase). The knock-down by RNA interference (RNAi) of ima-3 and C27D9.1 decreases or increases embryo size, respectively (Sönnichsen et al., 2005; Hara and Kimura, 2009; Weber and Brangwynne, 2015; Hubatsch et al., 2019). Using sorb-1 (RNAi) as a control (Haeussler et al., 2021), we confirmed this in wild type and in different ced-3 caspase mutant backgrounds, in which apoptosis is compromised with increasing degrees i.e. ced-3 ( n2438 ) , ced-3 ( n2427 ) , ced-3 ( n2436 ) and ced-3 ( n717 ) ( Figure 1A, B ; see below) (Ellis and Horvitz, 1986; Shaham et al., 1999). In addition, by measuring the size of the NSM neuroblast just prior to its division (metaphase; performed in the ced-3 ( n2427 ) background), we found that ima-3 (RNAi) reduces NSM neuroblast size whereas C27D9.1 (RNAi) increases NSM neuroblast size albeit not significantly ( Figure 1C, D ). The two NSM neuroblasts divide and each gives rise to a larger NSM, which survives, and a smaller NSM sister cell (NSMsc), which is programmed to die through apoptosis ( Figure 1E ). Next, using a reporter that visualizes the two NSMs as well as inappropriately surviving NSM sister cells in L4 larvae (P tph-1 his-24 ::gfp ; transgene bcIs66 ) (Yan et al., 2013) ( Figure 1E ), we determined ‘NSM sister cell survival' (% NSMsc survival) in ima-3 (RNAi) and C27D9.1 (RNAi) larvae in a wild-type background (+/+) and in the background of ced-3 ( n2438 ) , ced-3 ( n2427 ) , ced-3 ( n2436 ) or ced-3 ( n717 ) , respectively. In a wild-type background, NSM sister cells always die (0% NSMsc survival), and we found that ima-3 ( RNAi ) has no effect on this ( Figure 1F, sorb-1 (RNAi) vs ima-3 (RNAi) ). In the background of the weak ced-3 loss-of-function mutations ced-3 ( n2438 ) and ced-3 ( n2427 ) , ima-3 (RNAi) suppresses NSM sister cell survival from 10% to 6% and from 12% to 7%, respectively. Therefore, in these mutant backgrounds, ima-3 (RNAi) causes increased NSM sister cell death, which indicates that ima-3 has ‘anti-apoptotic' function. However, ima-3 (RNAi) has no effect on NSM sister cell survival in the background of the stronger ced-3 loss-of-function mutation ced-3 ( n2436 ) or the putative ced-3 null mutation ced-3 ( n717 ) , in which 65% or 100% of the NSM sister cells inappropriately survive ( Figure 1F ). In the wild-type background, C27D9.1 ( RNAi ) also has no effect on NSM sister cell survival ( Figure 1F, sorb-1 ( RNAi ) vs C27D9.1 ( RNAi )). However, we found that C27D9.1 (RNAi) enhances NSM sister cell survival in ced-3 ( n2438 ) , ced-3 ( n2427 ) and ced-3 ( n2436 ) animals but not in ced-3 ( n717 ) animals, in which NSM sister cell survival is already 100% ( Figure 1F ). Therefore, in these mutant backgrounds, C27D9.1 (RNAi) causes decreased NSM sister cell death, which indicates that C27D9.1 has ‘pro-apoptotic' function.

At least to our knowledge, ima-3 and C27D9.1 have not been implicated in apoptosis or non-apoptotic forms of cell death. While we cannot rule out that they have not yet described roles in cell death, the simplest explanation for our results is that ima-3 is anti-apoptotic and C27D9.1 pro-apoptotic as a result of their opposing roles in embryo size and NSM neuroblast size and therefore, presumably, the size of the NSM sister cell. Specifically, we propose that – at least in the background of partial loss-of-function mutations of ced-3 caspase - the ima-3 (RNAi) -induced reduction in cell size promotes and the C27D9.1 (RNAi) -induced increase in cell size compromises the ability of the NSM sister cell to undergo apoptosis. Hence, our results support the notion that in C. elegans embryos, cell size and apoptosis inversely correlate. Our results also suggest that the effects of pig-1 and ect-2 mutations on the ability of the NSM sister cell to undergo apoptosis are in part due to their impact on NSM sister cell size. Finally, our finding that in a wild-type background, ima-3 (RNAi) and C27D9.1 (RNAi) do not affect cell death in the NSM neuroblast lineage suggests that the ima-3 (RNAi) -induced reduction in cell size is not sufficient to cause inappropriate apoptosis (of the NSM neuroblast or the NSM) and that the C27D9.1 (RNAi) -induced increase in cell size is not sufficient to cause the NSM to inappropriately survive; however, we cannot exclude that the ima-3 (RNAi) -induced reduction in cell size and the C27D9.1 (RNAi) -induced increase in cell size were not large enough to impact apoptosis.

Methods

Strain maintenance and genetics

Strains were maintained at 15°C or 20°C on Nematode Growth Media (NGM) plates and fed with OP50 Escherichia coli bacteria according to standard protocols (Brenner, 1974). Bristol N2 strain was used as wild type. The following transgenes and alleles were used in this study: LGIII bcIs66 ( P tph-1 his-24 ::gfp ) (Yan et al., 2013); LGIV ced-3 ( n2438 ), ced-3 ( n2427 ), ced-3 ( n2436 ), ced-3 ( n717 ) (Ellis and Horvitz, 1986; Shaham et al., 1999); LGV ltIs44 ( P pie-1 mCherry:: ph PLCΔ ) (Audhya et al., 2005). LGII bcIs104 ( P pie1 gfp:: tac-1 ) (Bellanger and Gonczy, 2003). RNAi clones from the Ahringer RNAi library were used for the following genes (Kamath and Ahringer, 2003; Kamath et al., 2003): ima-3 ( F32E10.4 ) (Sönnichsen et al., 2005), C27D9.1 (Sönnichsen et al., 2005), sorb-1 ( Y45F10D.13 ) (Haeussler et al., 2021), and pop-1 ( W10C8.2 ) (Rueyling et al., 1998). Throughout our studies, we used information and tools available on WormBase ( https://wormbase.org/#012-34-5 ) (Fire et al., 1998; Sternberg et al., 2024).

RNA interference ( RNAi) by feeding

All RNAi bacterial clones were picked from the Ahringer library (Kamath and Ahringer, 2003; Kamath et al., 2003). This library is distributed by Source BioScience Ltd. ( https://sourcebioscience.com ). To verify the clones, genomic fragments of the targeted genes cloned into the L4440 vector were amplified by PCR using L4440-F ( TGGATAACCGTATTACCGCC ) and L4440-R ( GTTTTCCCAGTCACGACGTT ) oligos, sequenced and sequences verified using the WormBase BLAST tool ( https://wormbase.org/tools/blast_blat ). Verified RNAi bacterial clones were inoculated in 200 µL of LB broth containing 100 μg/mL carbenicillin and grown overnight at 37°C in a shaking incubator. 100 µL of each bacterial culture was seeded onto NGM plates containing 6 mM IPTG and 100 µg/mL carbenicillin. Plates were kept at room temperature overnight in the dark. RNAi by feeding was performed by transferring L4 larvae onto seeded IPTG plates and kept at 20°C for 24-96 hours depending on the gene (Timmons and Fire, 1998; Burton et al., 2011). F1 embryos and/or L4 larvae were harvested for embryo or cell size analyses and for determining NSM sister cell survival. sorb-1 (RNAi) was used as negative control (Haeussler et al., 2021) and pop-1 (RNAi) as positive control (Rueyling et al., 1998) for RNAi. Loss of pop-1 resulted in nearly 100% dead embryos.

Microscopy

Measurements of embryo length and NSM neuroblast (NSMnb) size

24-48 hours post-RNAi feeding, embryos were harvested for embryo size measurements. Embryos were mounted on a glass slide with 2% agarose pads containing M9 buffer. For measuring the lengths of the embryos, Nomarski Z-stacks were taken. The central Z-stack was used to measure the length of each embryo. Using a line selection tool in ImageJ software, a straight line was drawn in the centre of the embryo from anterior to posterior (egg shell), and the length was measured by using ImageJ software (https://imagej.net/ij/) (Schneider et al., 2012; v1.54m). Average embryo length was calculated for each RNAi condition.

The size of the NSMnb under different RNAi conditions was estimated using the P pie-1 mCherry::ph PLCΔ plasma membrane reporter ( ltIs44 ) (Audhya et al., 2005) essentially as described (Sethi et al., 2022). The NSMnb was identified based on its morphology and position and its size was estimated when it had reached metaphase. A Z-stack (0.5 μm step size) was taken through it, and a region of interest (ROI) was drawn around the plasma membrane of the NSMnb in all Z-slices to determine NSMnb area. To estimate NSMnb size, the sum was taken of all NSMnb areas.

A Zeiss Axio Imager.M2 equipped with Differential Interference Contrast (DIC) and epifluorescence was used for imaging.

Measurement of % NSM sister cell (NSMsc) survival

72-96 hours post-RNAi feeding start, L3/L4 larvae were picked to score inappropriate NSMsc survival using the P tph-1 his-24 ::gfp reporter ( bcIs66 ). Worms were mounted on a glass slide with 2% agarose pads containing sodium azide in M9 buffer (25 mM). NSMsc survival was determined by counting GFP-positive cells in the anterior pharynx as previously described (Thellmann et al., 2003; Yan et al., 2013; Sethi et al., 2022). A Zeiss Axio Imager.M2 equipped with Differential Interference Contrast (DIC) and epifluorescence was used for imaging.

Statistical analyses

Statistical analyses were performed using the R statistical software package. For comparing the embryo sizes, a linear model containing all genotypes and RNAi conditions was constructed (R Core Team, 2024; v4.4.1), and its residuals were visually inspected for deviations from normality and homoscedasticity of variance. Differences between relevant RNAi treatments ( sorb-1 (RNAi) controls vs respective RNAi treatments) within genotypes were then tested post-hoc using the least square means method in the emmeans package (Lenth, 2024; v1.10.5). To compare statistical significance of NSMnb size under different RNAi conditions, Mann-Whitney U-tests were used. One sided Fisher's exact tests were used to determine statistical significance of % NSMsc survival under all RNAi conditions. All p-values were corrected for multiple testing using false discovery rate. (Benjamini and Hochberg, 1995). Significance level (α) was set at p < 0.05 for all tests.

Reagents

Strain

Genotype

Source

MD2487

bcIs66 III

Yan et al., 2013

MD4972

bcIs66 III; ced-3 ( n2438 ) IV

This study

MD3712

bcIs66 III; ced-3 ( n2427 ) IV; ltIs44 V

Chakraborty et al., 2015

MD3588

bcIs66 III; ced-3 ( n2436 ) IV; ltIs44 V; bcIs104

Chakraborty et al., 2015

MD3203

bcIs66 III; ced-3 ( n717 ) IV

Yan et al., 2013
Open in a new tab

Complete genotypes of strains used in this study.

Acknowledgments

We thank L. McGuinness for excellent technical support and members of the Conradt lab for discussions. Some strains were provided by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).

Funding Statement

This work was supported by UCL (Division of Biosciences, UCL LSM Capital Equipment Fund), by a Wolfson Fellowship from the Royal Society (RSWF\R1\180008) to B.C. and BBSRC Responsive Mode Grants (BB/V007572/1 and BB/V015648/1) to B.C.

References

  1. Audhya Anjon, Hyndman Francie, McLeod Ian X., Maddox Amy S., Yates John R., Desai Arshad, Oegema Karen. A complex containing the Sm protein CAR-1 and the RNA helicase CGH-1 is required for embryonic cytokinesis in Caenorhabditis elegans . The Journal of Cell Biology. 2005 Oct 24;171(2):267–279. doi: 10.1083/jcb.200506124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bellanger Jean-Michel, Gönczy Pierre. TAC-1 and ZYG-9 Form a Complex that Promotes Microtubule Assembly in C. elegans Embryos. Current Biology. 2003 Sep 1;13(17):1488–1498. doi: 10.1016/s0960-9822(03)00582-7. [DOI] [PubMed] [Google Scholar]
  3. Benjamini Yoav, Hochberg Yosef. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. Journal of the Royal Statistical Society Series B: Statistical Methodology. 1995 Jan 1;57(1):289–300. doi: 10.1111/j.2517-6161.1995.tb02031.x. [DOI] [Google Scholar]
  4. Brenner S. THE GENETICS OF CAENORHABDITIS ELEGANS . Genetics. 1974 May 1;77(1):71–94. doi: 10.1093/genetics/77.1.71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Burton Nick O., Burkhart Kirk B., Kennedy Scott. Nuclear RNAi maintains heritable gene silencing in Caenorhabditis elegans . Proceedings of the National Academy of Sciences. 2011 Nov 21;108(49):19683–19688. doi: 10.1073/pnas.1113310108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chakraborty Sayantan, Lambie Eric J., Bindu Samik, Mikeladze-Dvali Tamara, Conradt Barbara. Engulfment pathways promote programmed cell death by enhancing the unequal segregation of apoptotic potential. Nature Communications. 2015 Dec 10;6(1) doi: 10.1038/ncomms10126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cordes Shaun, Frank C. Andrew, Garriga Gian. The C. elegans MELK ortholog PIG-1 regulates cell size asymmetry and daughter cell fate in asymmetric neuroblast divisions . Development. 2006 Jul 15;133(14):2747–2756. doi: 10.1242/dev.02447. [DOI] [PubMed] [Google Scholar]
  8. Ellis H. Genetic control of programmed cell death in the nematode C. elegans. Cell. 1986 Mar 28;44(6):817–829. doi: 10.1016/0092-8674(86)90004-8. [DOI] [PubMed] [Google Scholar]
  9. Fire Andrew, Xu SiQun, Montgomery Mary K., Kostas Steven A., Driver Samuel E., Mello Craig C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 1998 Feb 1;391(6669):806–811. doi: 10.1038/35888. [DOI] [PubMed] [Google Scholar]
  10. Geles Kenneth G., Adam Stephen A. Germline and developmental roles of the nuclear transport factor importin α3 in C. elegans . Development. 2001 May 15;128(10):1817–1830. doi: 10.1242/dev.128.10.1817. [DOI] [PubMed] [Google Scholar]
  11. Haeussler Simon, Yeroslaviz Assa, Rolland Stéphane G, Luehr Sebastian, Lambie Eric J, Conradt Barbara. Genome-wide RNAi screen for regulators of UPRmt in Caenorhabditis elegans mutants with defects in mitochondrial fusion . G3 Genes|Genomes|Genetics. 2021 Mar 30;11(7) doi: 10.1093/g3journal/jkab095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hara Yuki, Kimura Akatsuki. Cell-Size-Dependent Spindle Elongation in the Caenorhabditis elegans Early Embryo. Current Biology. 2009 Sep 1;19(18):1549–1554. doi: 10.1016/j.cub.2009.07.050. [DOI] [PubMed] [Google Scholar]
  13. Hubatsch Lars, Peglion Florent, Reich Jacob D., Rodrigues Nelio T. L., Hirani Nisha, Illukkumbura Rukshala, Goehring Nathan W. A cell-size threshold limits cell polarity and asymmetric division potential. Nature Physics. 2019 Aug 12;15(10):1078–1085. doi: 10.1038/s41567-019-0601-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kamath R. Genome-wide RNAi screening in Caenorhabditis elegans. Methods. 2003 Aug 1;30(4):313–321. doi: 10.1016/s1046-2023(03)00050-1. [DOI] [PubMed] [Google Scholar]
  15. Kamath Ravi S., Fraser Andrew G., Dong Yan, Poulin Gino, Durbin Richard, Gotta Monica, Kanapin Alexander, Le Bot Nathalie, Moreno Sergio, Sohrmann Marc, Welchman David P., Zipperlen Peder, Ahringer Julie. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature. 2003 Jan 1;421(6920):231–237. doi: 10.1038/nature01278. [DOI] [PubMed] [Google Scholar]
  16. Lenth R. 2024. emmeans: Estimated Marginal Means, aka Least-Squares Means.
  17. R Core Team. 2024. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing.
  18. Lin Rueyling, Hill Russell J, Priess James R. POP-1 and Anterior–Posterior Fate Decisions in C. elegans Embryos. Cell. 1998 Jan 1;92(2):229–239. doi: 10.1016/s0092-8674(00)80917-4. [DOI] [PubMed] [Google Scholar]
  19. Schneider Caroline A, Rasband Wayne S, Eliceiri Kevin W. NIH Image to ImageJ: 25 years of image analysis. Nature Methods. 2012 Jun 28;9(7):671–675. doi: 10.1038/nmeth.2089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Sethi Aditya, Wei Hai, Mishra Nikhil, Segos Ioannis, Lambie Eric J., Zanin Esther, Conradt Barbara. A caspase–RhoGEF axis contributes to the cell size threshold for apoptotic death in developing Caenorhabditis elegans. PLOS Biology. 2022 Oct 6;20(10):e3001786–e3001786. doi: 10.1371/journal.pbio.3001786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Shaham Shai, Reddien Peter W, Davies Brian, Horvitz H Robert. Mutational Analysis of the Caenorhabditis elegans Cell-Death Gene ced-3. Genetics. 1999 Dec 1;153(4):1655–1671. doi: 10.1093/genetics/153.4.1655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Sönnichsen B., Koski L. B., Walsh A., Marschall P., Neumann B., Brehm M., Alleaume A.-M., Artelt J., Bettencourt P., Cassin E., Hewitson M., Holz C., Khan M., Lazik S., Martin C., Nitzsche B., Ruer M., Stamford J., Winzi M., Heinkel R., Röder M., Finell J., Häntsch H., Jones S. J. M., Jones M., Piano F., Gunsalus K. C., Oegema K., Gönczy P., Coulson A., Hyman A. A., Echeverri C. J. Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans. Nature. 2005 Mar 1;434(7032):462–469. doi: 10.1038/nature03353. [DOI] [PubMed] [Google Scholar]
  23. Sternberg Paul W, Van Auken Kimberly, Wang Qinghua, Wright Adam, Yook Karen, Zarowiecki Magdalena, Arnaboldi Valerio, Becerra Andrés, Brown Stephanie, Cain Scott, Chan Juancarlos, Chen Wen J, Cho Jaehyoung, Davis Paul, Diamantakis Stavros, Dyer Sarah, Grigoriadis Dionysis, Grove Christian A, Harris Todd, Howe Kevin, Kishore Ranjana, Lee Raymond, Longden Ian, Luypaert Manuel, Müller Hans-Michael, Nuin Paulo, Quinton-Tulloch Mark, Raciti Daniela, Schedl Tim, Schindelman Gary, Stein Lincoln. WormBase 2024: status and transitioning to Alliance infrastructure. GENETICS. 2024 Apr 4;227(1) doi: 10.1093/genetics/iyae050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Sulston J.E., Horvitz H.R. Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Developmental Biology. 1977 Mar 1;56(1):110–156. doi: 10.1016/0012-1606(77)90158-0. [DOI] [PubMed] [Google Scholar]
  25. Sulston J.E., Schierenberg E., White J.G., Thomson J.N. The embryonic cell lineage of the nematode Caenorhabditis elegans. Developmental Biology. 1983 Nov 1;100(1):64–119. doi: 10.1016/0012-1606(83)90201-4. [DOI] [PubMed] [Google Scholar]
  26. Thellmann Marion, Hatzold Julia, Conradt Barbara. The Snail-like CES-1 protein of C. elegans can block the expression of the BH3-only cell-death activator gene egl-1 by antagonizing the function of bHLH proteins . Development. 2003 Sep 1;130(17):4057–4071. doi: 10.1242/dev.00597. [DOI] [PubMed] [Google Scholar]
  27. Timmons Lisa, Fire Andrew. Specific interference by ingested dsRNA. Nature. 1998 Oct 1;395(6705):854–854. doi: 10.1038/27579. [DOI] [PubMed] [Google Scholar]
  28. Weber Stephanie C., Brangwynne Clifford P. Inverse Size Scaling of the Nucleolus by a Concentration-Dependent Phase Transition. Current Biology. 2015 Mar 1;25(5):641–646. doi: 10.1016/j.cub.2015.01.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Wei Hai, Lambie Eric J., Osório Daniel S., Carvalho Ana X., Conradt Barbara. PIG-1 MELK-dependent phosphorylation of nonmuscle myosin II promotes apoptosis through CES-1 Snail partitioning. PLOS Genetics. 2020 Sep 18;16(9):e1008912–e1008912. doi: 10.1371/journal.pgen.1008912. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Yan Bo, Memar Nadin, Gallinger Julia, Conradt Barbara. Coordination of Cell Proliferation and Cell Fate Determination by CES-1 Snail. PLoS Genetics. 2013 Oct 31;9(10):e1003884–e1003884. doi: 10.1371/journal.pgen.1003884. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from microPublication Biology are provided here courtesy of California Institute of Technology

RESOURCES