Fatty Acid Desaturase 1 Knockdown Promotes Wound Healing and Functional Recovery of the Corneal Epithelium in Diabetes

Abstract

Purpose

Fatty acid desaturase 1 (FADS1) is significantly and specifically upregulated following diabetic corneal injury. However, its role in diabetic keratopathy remains unclear. This study aimed to investigate the impact of FADS1 on wound healing and functional recovery of the diabetic corneal epithelium and explore its potential mechanisms.

Methods

Using high-glucose–induced corneal epithelial cells and a streptozotocin-induced type 1 diabetic mouse model, FADS1 expression was suppressed via FADS1 small interfering RNA (siRNA). Cell migration was assessed using scratch and transwell assays. Wound healing and functional recovery of the corneal epithelium were evaluated using sodium fluorescein staining, anterior segment optical coherence tomography, hematoxylin and eosin staining, and immunofluorescence staining.

Results

FADS1 knockdown promoted wound healing and functional recovery of the diabetic corneal epithelium both in vivo and in vitro. Suppression of FADS1 enhanced high-glucose–induced corneal epithelial cell migration, which was dependent on elevated levels of the upstream metabolite γ-linolenic acid. This effect was mediated through the activation of the mitogen-activated protein kinase signaling pathway and the accumulation of autophagosomes.

Conclusions

After diabetic corneal epithelial injury, FADS1 expression is specifically upregulated. Knockdown of FADS1 promotes wound healing and functional recovery, suggesting a novel therapeutic strategy for diabetic keratopathy.

The International Diabetes Federation estimates that approximately 536.6 million people worldwide have diabetes, making it a leading global health concern.¹ Diabetes mellitus is a metabolic disease that increases the risk of various systemic complications, including neuropathy, nephropathy, cardiovascular disease, and vision impairment.^2–5 Among diabetic eye complications, diabetic keratopathy (DK) is a major cause of vision impairment.^6–8 It is estimated that approximately 47% to 64% of diabetic patients develop DK.⁹ DK manifests in multiple ways, including delayed epithelial wound healing, reduced corneal nerve supply and sensitivity, and corneal ulcers.^10–13 Persistent corneal epithelial defects owing to delayed wound healing can lead to corneal scarring, neovascularization, and permanent vision loss.^14,15 Recent studies suggest that metabolic dysregulation, autophagy signaling pathways, and endoplasmic reticulum (ER) stress play key roles in DK pathogenesis.^16–18 Despite extensive research, an effective treatment remains elusive, and the underlying mechanisms of DK are not understood fully.

Fatty acid desaturase 1 (FADS1) is a rate-limiting enzyme in polyunsaturated fatty acid (PUFA) synthesis. It catalyzes the conversion of eicosatetraenoic acid to eicosapentaenoic acid in the omega-3 (n-3) PUFA pathway and the conversion of dihomo-γ-linolenic acid (DGLA) to arachidonic acid in the omega-6 (n-6) PUFA pathway.¹⁹ Previous studies have reported that FADS1 is highly expressed in various cancers, and its inhibition has been identified as a promising target for cancer treatment.^20–22 However, research on FADS1 in diabetes and its complications is limited. Although FADS1 has been linked to diabetes,^23,24 its role in DK has not been investigated. Through further analysis of genome-wide cDNA arrays conducted by Bettahi et al.,²⁵ we found that FADS1 expression is significantly and specifically upregulated following diabetic corneal injury. However, whether FADS1 inhibition influences DK remains unknown. This study provides evidence that FADS1 knockdown (KD) promotes wound healing and functional recovery of the corneal epithelium in diabetes.

Materials and Methods

Cell Culture

This study used an immortalized human corneal epithelial cell line (SV40-HCEC, Procell, CL-0743) and primary mouse corneal epithelial cells (MCECs, Procell, CP-M120). Cells were cultured in DMEM/F12 (Gibco, Grand Island, NY, USA) medium supplemented with 10% fetal bovine serum (Sigma-Aldrich, St Louis, MO, USA), 100 µg/L penicillin, and 100 µg/L streptomycin. Cultures were maintained at 37°C in a humidified incubator with 5% CO₂. To induce HG conditions, cells were treated with D-glucose (Sigma-Aldrich #G7528) at a final concentration of 25 mmol/L in DMEM/F12 medium (17.5 mmol/L).²⁶ Control cells were treated with 5 mmol/L D-glucose.²⁷

Immunocytochemical Staining

HCECs were fixed with 4% paraformaldehyde for 30 min, permeabilized with 0.3% Triton X-100 (Sigma-Aldrich) in PBS for 20 min, and blocked with 5% BSA (Sigma-Aldrich) for 1 h at room temperature. The cells were incubated overnight at 4°C with primary antibodies against reticulon 4 (RTN4, Santa Cruz Biotechnology, Dallas, TX, USA) or FADS1 (Abcam, Cambridge, UK). After washing, the cells were incubated with Alexa Fluor-conjugated secondary antibodies (Cell Signaling Technology, Danvers, MA, USA; diluted 1:500) for 1 h at room temperature. Nuclei were counterstained with DAPI (Invitrogen, Waltham, MA, USA) for 5 min. Stained cells were examined and imaged using a Zeiss laser confocal microscope.

Cell Migration Assay

HCECs and MCECs were grown to 100% confluence in well plates. Linear scratches were created using sterile 200-µL pipette tips. The cells were washed twice with PBS to remove detached cells and then cultured in a medium containing 1% serum. The wound area was imaged at the same position at 0 and 24 h using a microscope. Migration distance was quantified using ImageJ.

Transwell Assay

Cell migration was assessed using a 24-well polycarbonate membrane cell culture insert with an 8-µm pore size (Corning, Corning, NY, USA). HCECs and MCECs were transfected for 48 h before being seeded into the upper chamber at a density of 2 × 10⁴ cells/well in 200 µL serum-free medium. The lower chamber contained 500 µL normal medium with 20% fetal bovine serum as a chemoattractant. After 24 h of incubation, the cells were fixed with 4% paraformaldehyde for 20 min and stained with 0.1% crystal violet (Beyotime, Shanghai, China) for 10 min at room temperature. Images were captured using an inverted microscope, and migrated cells were quantified.

Electron Microscopy

HCECs were collected 48 h after transfection, and the cell pellet was fixed in 2.5% glutaraldehyde for 1 h and then refrigerated overnight. The cells were subsequently embedded in Epon resin. Thin sections (70 nanometers) were obtained using a UC7 ultramicrotome (Leica Microsystems, Vienna, Austria) and stained with uranyl acetate and lead citrate. Finally, the cell sections were analyzed using an 80 kV CM100 transmission electron microscope (FEI, Eindhoven, the Netherlands).

Transfection of Cells With Small Interfering RNA (siRNA)

According to the manufacturer's protocol, HCECs or MCECs were transfected with 20 nM control siRNA or siRNA targeting FADS1, fatty acid desaturase 2 (FADS2), or prostaglandin E synthase (PTGES) (all from Shanghai Genechem Pharmaceutical Technology Co., Ltd., China) for 48 h using 2 µL Lipofectamine RNAiMAX (Thermo Fisher Scientific, Waltham, MA, USA; 13778150) per well in a six-well plate culture.

Quantitative Real-Time PCR (qRT-PCR)

Total cellular RNA was extracted using TRIzol reagent (Invitrogen). cDNA was synthesized using a cDNA synthesis kit (Vazyme, Nanjing, China). PCR reactions were performed on a CFX Connect Real-Time PCR instrument (Bio-Rad, Hercules, CA, USA) using SYBR Green Master Mix (Vazyme) according to the manufacturer's instructions. β-Actin was used as the housekeeping gene. The 2^−ΔΔCT method was used to calculate relative gene expression changes. Primer sequences are listed in Table 1.

Table 1.

Primers Used for qPCR

Gene	Forward Primer	Reverse Primer
h-FADS1	CTACCCCGCGCTACTTCAC	CGGTCGATCACTAGCCACC
m-FADS1	AGCACATGCCATACAACCATC	TTTCCGCTGAACCACAAAATAGA
h-FADS2	TGACCGCAAGGTTTACAACAT	AGGCATCCGTTGCATCTTCTC
h-PTGES	TCCTAACCCTTTTGTCGCCTG	CGCTTCCCAGAGGATCTGC

“h” denotes sequences from humans (Homo sapiens), and “m” denotes sequences from mice (Mus musculus).

Western Blotting

HCECs or MCECs were lysed using RIPA buffer (Beyotime, Shanghai, China), and the protein concentration was measured using a BCA protein assay kit (Thermo Fisher Scientific). Equal amounts of protein were separated by SDS-PAGE and immunoblotted with primary antibodies against FADS1 (Santa Cruz), HSP60 (Santa Cruz), GRP75 (Santa Cruz), PAX6 (Abcam), SDHA (Abcam), p38 mitogen-activated protein kinase (MAPK) (Cell Signaling Technology), phospho-p38 MAPK (Cell Signaling Technology), LC3B (Cell Signaling Technology), VDAC (Cell Signaling Technology), P62 (MBL Life Science, Tokyo, Japan), FADS1 (Proteintech, Rosemont, IL, USA), Lamin A/C (Proteintech), TOMM40 (Proteintech), and GAPDH (Proteintech). Primary antibodies were detected using HRP-conjugated secondary antibodies (Cell Signaling Technology), and band intensities were quantified by densitometry using ImageJ, normalized to GAPDH levels.

Mitochondrial Extraction

Cells were collected using a cell scraper, and 2 mL of 0.1 × isolation buffer (diluted with phosphate buffer) and 20 µL of phenylmethane sulfonyl fluoride were added to the cell pellet. The suspension was transferred to a glass homogenizer and homogenized 20 times on ice. After homogenization, 200 µL of 10 × isolation buffer (21.20 mg Tris-HCl, 7.31 mg NaCl, 2.38 mg MgCl₂, and 50 mL ddH₂O) was added. The sample was centrifuged at 1200×g for 3 min at 4°C, and the supernatant was collected. This process was repeated until no precipitate remained. The final supernatant was centrifuged at 15,000×g for 2 min at 4°C, the supernatant was discarded, and the pellet containing mitochondria was retained.

Microarray Analysis

Total RNA was extracted from cells transfected with FADS1 siRNA and negative control (NC) siRNA using TRIzol reagent (Invitrogen) following the manufacturer's instructions. Transcriptome analysis was conducted using whole-genome microarray expression profiling (Agilent Technologies, Santa Clara, CA, USA). Differentially expressed genes (DEGs) were identified using the criteria of fold change of ≥2 and a P value of <0.05. Gene Ontology biological process and Kyoto Encyclopedia of Genes and Genomes pathway analyses were performed for functional annotation of the DEGs. P values of <0.05 were considered statistically significant.

Targeted Metabolite Detection

To each cell sample tube, 200 µL of methanol, 50 µL of 36% phosphoric acid solution, 200 µL of ultrapure water, and 200 µL of methyl tert-butyl ether were added. The mixture was vortexed with steel beads, followed by centrifugation. The supernatant was collected, and the extraction process was repeated twice. The combined extracts were dried under a stream of nitrogen, and the residue was subjected to methylation by adding 14% BF₃-methanol. Subsequently, 200 µL of saturated NaCl solution and 500 µL of n-hexane were added, and the mixture was vortexed for 1 min. After centrifugation at 20,000 r/min for 15 min, the upper layer was transferred to an injection vial for gas chromatography-tandem mass spectrometry analysis.

Lentivirus Production and Cell Transduction

The NC lentiviral vector or FADS1 overexpression lentiviral plasmid (both from Qingke Biotechnology Co., Beijing, China) was cotransfected with pMD2.G (envelope plasmid) and psPAX2 (packaging plasmid) into 293T cells. After 48 h, lentiviral particles in the supernatant were collected. HCECs were cultured overnight at 37°C and then infected with either the NC lentiviral vector or lentiviral FADS1 overexpression supernatant (50%–60% confluence) for 24 h. The virus-containing medium was replaced with fresh complete medium and cells were selected using puromycin (Sigma-Aldrich) for stable transfection.

Cell Viability Assay

HCECs were seeded in 96-well plates and incubated at 37°C for 24 h. After treatment, 10 µL of Cell Counting Kit-8 solution (CCK-8, YOBIBIO) was added to each well, and incubation was continued for 2 h.

Other Reagents

D5D-IN-326 (MedChemExpress, Monmouth Junction, NJ, USA), 3-methyladenine (3-MA, MedChemExpress), GLA (Sigma-Aldrich), and DGLA (Aladdin).

Streptozotocin (STZ)-Induced Diabetic Mouse Model

C57BL/6J mice (8-week-old, male) were injected intraperitoneally with STZ (Sigma-Aldrich) at a dose of 50 mg/kg for 5 consecutive days. Tail vein blood glucose levels and body weight were monitored. Mice with blood glucose levels above 16.7 mmol/L were classified as diabetic.²⁸ All experiments were performed following the guidelines of the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.

Corneal Epithelial Debridement Wound Healing Model

After anesthetizing mice, a 2.5-mm circular wound was created in the central corneal epithelium using an Algerbrush II Corneal Rust Ring Remover.²⁹ The abraded area was stained with 0.25% sodium fluorescein (Sigma-Aldrich) and imaged with a slit lamp. The wound area was quantified using ImageJ.

Histology and Immunohistochemical Staining

After euthanizing the mice, the enucleated eyeballs were embedded in paraffin and sectioned into 6-µm slices. The sections were stained with hematoxylin and eosin following the manufacturer's instructions. For immunohistochemical staining, the sections were incubated at room temperature with 5% donkey serum for 1 h, followed by overnight incubation at 4°C with the primary antibody FADS1 (Abcam). The next day, the sections were incubated with the corresponding secondary antibody (Abcam) at room temperature for 1 h. Stained slides were visualized using a fluorescence microscope and photographed.

Subconjunctival siRNA Injection

After anesthetizing the mice, 2 µL of NC siRNA (1 µg/µL, Shanghai Genechem Pharmaceuticals, Shanghai, China) or 2 µL of FADS1 siRNA (1 µg/µL, Shanghai Genechem Pharmaceuticals) was injected into the subconjunctival space using a 10-µL syringe with a 33G metal needle (Hamilton, Reno, NV, USA).

Central Corneal Thickness Measurements

After anesthesia, the central corneal thickness of each group was measured using anterior segment optical coherence tomography (TowardPi, Beijing, China).

Immunofluorescence Staining

Eye sections were permeabilized with 0.3% Triton X-100 in PBS for 15 min, and then blocked with 5% donkey serum at room temperature for 1 h. Subsequently, the sections were incubated overnight at 4°C with primary antibodies against PAX6 (Abcam) and E-cadherin (Cell Signaling Technology). The following day, the sections were incubated with Alexa Fluor-conjugated secondary antibodies at room temperature for 1 h. Nuclei were counterstained with DAPI for 10 min. Fluorescence intensity was analyzed using ImageJ.

Statistical Analysis

Statistical analyses were conducted using GraphPad Prism version 9.0 (San Diego, CA, USA). Data are presented as mean ± SEM. An unpaired Student's t test was used for comparisons between two groups, and ANOVA was applied for comparisons among multiple groups. A p value of <0.05 was considered statistically significant.

Results

FADS1 Is Highly Expressed After Diabetic Corneal Epithelial Injury, and FADS1 Is Localized to the ER in Corneal Epithelial Cells

Recent studies have shown that DK is closely related to metabolic processes.¹⁶ Based on a whole-genome cDNA array analysis of corneal epithelium from STZ-induced type 1 diabetic rats by Bettahi et al.,²⁵ we screened metabolism-related genes for further investigation. By comparing DEGs between NL42 vs. NL0 (normal corneas after injury vs. uninjured) and DM42 vs. DM0 (diabetic corneas after injury vs. uninjured), we identified 47 DEGs specifically expressed in DM42 vs. DM0 (Fig. 1A). Further analysis revealed that 10 of these genes were significantly upregulated, and 37 were significantly downregulated (Table 2). Among them, FADS1 expression was significantly elevated after diabetic corneal injury. Immunohistochemical analysis further confirmed that FADS1 expression in the corneal epithelium of diabetic mice was significantly higher than that in the uninjured group post-injury (Fig. 1B). Additionally, we examined the subcellular localization of FADS1. In HCECs, FADS1 protein was absent in mitochondria (Fig. 1C), but it was specifically localized to the ER (Fig. 1D).

Figure 1.

FADS1 is highly expressed after diabetic corneal epithelial injury, and FADS1 is localized to the ER in corneal epithelial cells. (A) Venn diagram illustrating the comparison of metabolism-related DEGs between normal and diabetic rats at 42 h after corneal injury vs. uninjured states, showing the number of unique and overlapping genes. A fold change of >1.5 and P < 0.05. (B) Representative immunohistochemical images of FADS1 in uninjured and injured corneal tissues from DM mice. (C) Western blotting–based analysis of the subcellular localization of FADS1. TOMM40 and VDAC were used as markers for the mitochondrial outer membrane, and GRP75 and HSP60 were used as markers for the mitochondrial matrix, SDHA was used as a marker for the mitochondrial inner membrane, and Lamin A/C was used as a marker for the nucleus. (D) Immunofluorescence images showing the colocalization of FADS1 (green) and the ER marker RTN4 (red) in HCECs.

Table 2.

Identification of 47 DEGs When Comparing Diabetic Corneal Injury and Uninjured Samples

Gene Symbol	Gene Name	Change
Klk10	Kallikrein related peptidase 10	+4.30246
Hpgds	Hematopoietic prostaglandin D synthase	+3.31263
Fads1	Fatty acid desaturase 1	+2.60509
Siglec5	Sialic acid binding Ig like lectin 5	+2.50869
Csgalnact1	Chondroitin sulfate N-acetylgalactosaminyltransferase 1	+2.04932
Aldh1l2	Aldehyde dehydrogenase 1 family member L2	+1.95494
Zc3h12a	Zinc finger CCCH type containing 12A	+1.82064
Dpyd	Dihydropyrimidine dehydrogenase	+1.78912
Tff1	Trefoil factor 1	+1.58505
Pter	Phosphotriesterase related	+1.54196
Slc31a2	Solute carrier family 31 member 2	−1.50687
Manea	Mannosidase, endo-alpha	−1.5274
Nat1	N-acetyl transferase 1	−1.60543
Cpm	Carboxypeptidase M	−1.63645
B3gnt2	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2	−1.64782
Slc1a1	Solute carrier family 1 member 1	−1.64804
Acbd3	Acyl-CoA binding domain containing 3	−1.679
Abhd5	Abhydrolase domain containing 5	−1.69279
Csnk1e	Csnk1e casein kinase 1, epsilon	−1.70323
Abcb1a	ATP binding cassette subfamily B member 1A	−1.71895
Klhl2	Kelch-like 2, Mayven	−1.75488
Cdadc1	Cytidine and dCMP deaminase domain containing 1	−1.78061
Leprot	Leptin receptor overlapping transcript	−1.83624
Gcat	Glycine C-acetyltransferase	−1.86263
Ryr3	Ryanodine receptor 3	−1.88281
Atp2c1	ATPase secretory pathway Ca2+ transporting 1	−1.90728
Scnn1g	Sodium channel epithelial 1 subunit gamma	−1.90941
Lpin2	Lipin 2	−2.00891
Kctd17	Potassium channel tetramerization domain containing 17	−2.0673
Acsl1	Acyl-CoA synthetase long chain family member 1	−2.0766
Pfkm	Phosphofructokinase, muscle	−2.07977
Edn1	Endothelin 1	−2.13422
Arg1	Arginase 1	−2.14284
Cspg4	Chondroitin sulfate proteoglycan 4	−2.2739
Sik1	Salt-inducible kinase 1	−2.27686
Clca2	Chloride channel accessory 2	−2.30296
Gls	Glutaminase	−2.36234
Rpia	Ribose 5-phosphate isomerase A	−2.38479
Dirc2	Solute carrier family 49 member 4	−2.42397
Csrnp1	Cysteine and serine rich nuclear protein 1	−2.43452
Plcxd2	Phosphatidylinositol-specific phospholipase C, X domain containing 2	−2.5565
Slco2a1	Solute carrier organic anion transporter family, member 2a1	−3.10394
Abhd3	Abhydrolase domain containing 3, phospholipase	−3.30973
Clca4l	Chloride channel calcium activated 4-like	−3.49027
Snca	Synuclein alpha	−3.6194
Clic2	Chloride intracellular channel 2	−3.76831
Akr1c18	Aldo-keto reductase family 1, member C18	−4.27391

The gene data presented in this table were originally sourced from ref. 25.

Microarray Analysis Reveals FADS1-Mediated Aberrant mRNA Profiles in Corneal Epithelial Cells

To investigate the functional role of FADS1 in HCECs, we characterized the transcriptome profile of FADS1 siRNA-transfected cells compared with NC siRNA-transfected cells under HG conditions using gene expression microarrays. The results indicated that FADS1 KD led to the upregulation of 503 genes and the downregulation of 533 genes. Hierarchical cluster analysis and a volcano plot provided an overview of the expression profile (Supplementary Fig. S1A, S1B). Gene Ontology enrichment analysis revealed that downregulated mRNAs were enriched in pathways related to cell migration, cell adhesion, and wound healing (Supplementary Fig. S1C). Kyoto Encyclopedia of Genes and Genomes pathway analysis showed that DEGs were primarily associated with focal adhesion, cell adhesion molecules, and fatty acid metabolism (Supplementary Fig. S1D). Evaluation of four upregulated DEGs in the microarray data suggested that FADS1 may be closely linked to the MAPK signaling pathway, which regulates cell growth and stress response (Supplementary Fig. S1E).

FADS1 KD Promotes Corneal Epithelial Cell Migration Under HG Conditions

To assess the impact of FADS1 KD on diabetic corneal wound healing, we evaluated the migration ability of corneal epithelial cells transfected with FADS1 siRNA under HG conditions. qRT-PCR and Western blot confirmed a significant reduction in FADS1 expression in HCECs transfected with FADS1 siRNA compared with scrambled siRNA controls (Figs. 2A–C). Scratch and transwell assays demonstrated that FADS1 KD significantly enhanced HCEC migration compared with the NC group (Figs. 2D–G). Furthermore, treatment with the FADS1-specific inhibitor D5D-IN-326 significantly reduced FADS1 expression levels (Figs. 2H, 2I). Scratch assay results showed that D5D-IN-326–treated cells migrated significantly faster than controls (Figs. 2J, 2K), although the treatment concentration did not affect HCEC viability (Supplementary Fig. S4A). To further confirm these findings, we used primary MCECs and observed a similar promotion of cell migration upon FADS1 KD (Supplementary Figs. S2A–G). However, FADS1 overexpression did not significantly alter HCEC migration (Supplementary Figs. S3A–D). Under normal glucose conditions, FADS1 KD did not significantly affect HCEC migration (Supplementary Figs. S4B, S4C).

Figure 2.

FADS1 KD promotes corneal epithelial cell migration under HG conditions. (A–C) qRT-PCR and Western blotting analyses of FADS1 in HCECs transfected with NC siRNA or FADS1 siRNA (n = 3). (D, E) Representative scratch assay images and statistical analysis of wound healing rates for HCECs following transfection with NC siRNA or FADS1 siRNA (n = 9). (F, G) Representative transwell migration assay images for HCECs transfected with NC siRNA or FADS1 siRNA, comparing the relative number of migrated cells (n = 4). (H, I) Western blotting analysis of FADS1 in HCECs treated with D5D-IN-326 (2 µM, 48 h), with DMSO as the control (n = 3). (J, K) Representative scratch assay images and statistical analysis of wound healing rates for HCECs treated with D5D-IN-326 (2 µM, 48 h), with DMSO as the control (n = 9). All values are mean ± SEM. **P < 0.01; ***P < 0.001; ****P < 0.0001.

KD of FADS1 Activates the MAPK Signaling Pathway In Vitro

To explore whether the MAPK signaling pathway contributes to the enhanced migration observed with FADS1 siRNA treatment, Western blotting was performed. Compared with the NC group, FADS1 KD significantly increased the phosphorylation of p38 MAPK (Figs. 3A, 3B). These findings suggest that FADS1 KD enhances HCEC migration under HG conditions via activation of the MAPK signaling pathway.

Figure 3.

KD of FADS1 activates the MAPK signaling pathway in vitro. (A, B) Western blotting analysis of phospho-p38 MAPK and p38 MAPK in HCECs transfected with NC siRNA or FADS1 siRNA (n = 3). All values are mean ± SEM. **P < 0.01.

FADS1 KD Promotes HG-Induced Corneal Epithelial Cell Migration Through Autophagosome Accumulation

Given the key role of the MAPK signaling pathway in autophagy regulation,^30–33 we examined the expression levels of autophagy-related genes. Western blot analysis revealed that FADS1 KD significantly increased the expression levels of p62 and LC3B II in HG-treated HCECs (Figs. 4A–D), suggesting an accumulation of autophagosomes. Transmission electron microscopy further confirmed a significant increase in autophagosome numbers in FADS1 siRNA-treated cells (Fig. 4E). To assess the role of autophagy in cell migration, we treated cells with the autophagy inhibitor 3-MA. The inhibitory effect of 3-MA on autophagy in HCECs was first verified (Supplementary Fig. S5A), and no cytotoxic effects were observed at the applied concentration (Supplementary Fig. S5B). Western blot analysis showed no significant changes in LC3B II levels in either the NC or FADS1 KD groups following 3-MA treatment (Figs. 4F, 4G). Scratch assays demonstrated that 3-MA treatment abolished the migration promoting effect of FADS1 KD (Figs. 4H, 4I). Furthermore, 3-MA significantly reduced the phosphorylation of p38 MAPK in the FADS1 KD group (Supplementary Figs. S5C, S5D). These results indicate that under HG conditions, FADS1 KD increases autophagosome accumulation in HCECs, and inhibition of autophagy diminishes the enhanced cell migration observed upon FADS1 KD.

Figure 4.

FADS1 KD promotes HG-induced corneal epithelial cell migration through autophagosome accumulation. (A–D) Western blotting analysis of P62 and LC3B in HCECs transfected with NC siRNA or FADS1 siRNA (n = 3). (E) The number of autophagosomes in HECEs was detected by TEM after transfection with NC siRNA or FADS1 siRNA (n = 3). (F, G) Western blotting analysis of LC3B in HCECs treated with 3-MA (5 mM, 6 h) after transfection with NC siRNA or FADS1 siRNA (n = 3). (H, I) Representative scratch assay images and statistical analysis of wound healing rates for HCECs transfected with NC siRNA or FADS1 siRNA, followed by treatment with 3-MA (5 mM, 6 h) (n = 9). All values are mean ± SEM. *P < 0.05; **P < 0.01; ns, nonsignificant.

FADS1 KD Promotes Cell Migration by Increasing the Upstream Metabolite GLA

FADS1 is a rate-limiting enzyme in PUFA metabolism, primarily regulating the conversion of linoleic acid and α-linolenic acid into downstream metabolites (Fig. 5A). We first analyzed the expression levels of genes upstream and downstream of FADS1 using qRT-PCR, revealing elevated levels of FADS2 and PTGES. KD of FADS2 or PTGES in HG-treated HCECs (Supplementary Figs. S6A, S6B) resulted in distinct effects on migration. FADS2 KD had no significant impact (Figs. 5B, 5C), suggesting that FADS1 KD primarily affects the n-6 PUFA pathway rather than the n-3 PUFA pathway. Conversely, PTGES KD significantly enhanced cell migration (Figs. 5D, 5E), supporting its role in the n-6 PUFA pathway. Pathway enrichment analysis of fatty acids detected in FADS1 siRNA and NC siRNA cells (Supplementary Fig. S6C) further supported this conclusion. Given that KD of both FADS1 and PTGES promoted migration, whereas FADS2 KD had no effect, it is likely that the accumulation of metabolites between FADS2 and FADS1, namely, GLA and DGLA, contributes to this phenomenon. Targeted metabolomics analysis confirmed a significant increase in GLA levels in FADS1-KD HCECs (Figs. 5F, 5G). Exogenous GLA supplementation in HG conditions significantly enhanced HCEC migration (Figs. 5H, 5I), whereas exogenous DGLA had no effect (Supplementary Figs. S6F, S6G). Neither compound affected cell viability (Supplementary Figs. S6D, S6E). Notably, GLA supplementation increased p38 MAPK phosphorylation in HCECs (Figs. 5J, 5K). These findings suggest that FADS1 KD promotes corneal epithelial cell migration by increasing GLA levels.

Figure 5.

FADS1 KD promotes cell migration by increasing the upstream metabolite GLA. (A) n-6 PUFA and n-3 PUFA metabolic pathways involving FADS1. (B, C) Representative scratch assay images and statistical analysis of wound healing rates for HCECs after transfection with NC siRNA or FADS2 siRNA (n = 9). (D, E) Representative scratch assay images and statistical analysis of wound healing rates for HCECs after transfection with NC siRNA or PTGES siRNA2 (n = 9). (F) Measurement of various fatty acid levels in HCECs transfected with NC siRNA or FADS1 siRNA. (G) Quantitative analysis of GLA content (n = 8). (H, I) Representative scratch assay images and statistical analysis of wound healing rates for HCECs treated with GLA (20 µg/mL, 48 h), with DMSO as the control (n = 9). (J, K) Western blotting analysis of phospho-p38 MAPK and p38 MAPK in HCECs after treatment with GLA (20 µg/mL, 48 h), with DMSO as the control (n = 3). All values are mean ± SEM. **P < 0.01; ****P < 0.0001; ns, nonsignificant.

Hyperglycemia Impairs Corneal Epithelial Wound Healing in Diabetic Mice

Numerous studies have shown that in corneal epithelial wound healing is significantly delayed in diabetic animal models.^34–36 To assess the impact of hyperglycemia on corneal epithelial wound healing, we used STZ-induced diabetic mice. Two weeks after STZ injection, diabetic mice exhibited significantly elevated blood glucose levels (22.3 ± 1.3 mmol/L) compared with normal controls (10.2 ± 0.3 mmol/L) (Fig. 6A). STZ-treated mice also experienced significant weight loss over the study period (Fig. 6B). Corneal epithelial debridement was performed using an Alger Brush II, and wound healing was assessed via sodium fluorescein staining. The results demonstrated that corneal epithelial defects were significantly larger in diabetic mice compared with controls (Figs. 6C, 6D).

Figure 6.

Hyperglycemia impairs corneal epithelial wound healing in diabetic mice. (A, B) Blood glucose and body weight of control (Ctrl) and DM mice (n = 6). (C) After scraping of the corneal epithelium in Ctrl and DM mice, sodium fluorescein staining was performed at D0, D1, and D2. (D) Histogram illustrating the percentage of the defect area relative to the original wound (n = 6). All values are mean ± SEM. **P < 0.01; ***P < 0.001; ****P < 0.0001.

FADS1-Specific siRNA Treatment Promotes Corneal Epithelial Wound Healing in Diabetic Mice

Given that FADS1 is upregulated after diabetic corneal epithelial injury, we further explored the role of FADS1 siRNA treatment in corneal epithelial wound healing in diabetic mice. A mechanical injury model was established, and mice were randomized to receive subconjunctival injections of either NC siRNA or FADS1 siRNA (Fig. 7A). FADS1 siRNA treatment significantly downregulated FADS1 expression in diabetic corneas (Fig. 7B). Fluorescein sodium staining revealed that FADS1 siRNA accelerated corneal epithelial wound healing compared with NC siRNA (Figs. 7C, 7D). Anterior segment optical coherence tomography demonstrated that FADS1 siRNA treatment facilitated corneal tissue repair and restored corneal thickness to near-normal levels (Figs. 7E, 7F, dotted line). Hematoxylin and eosin staining further confirmed that corneal epithelial thickness in the FADS1 siRNA group was closer to normal, with a more organized stromal fiber arrangement compared with the NC siRNA group (Fig. 7G).

Figure 7.

FADS1-specific siRNA treatment promotes corneal epithelial wound healing in diabetic mice. (A) Schematic illustrating the establishment and treatment of a diabetic corneal injury model: subconjunctival injection of NC siRNA or FADS1 siRNA was performed at 0 h and 24 h after corneal epithelial debridement, respectively. (B) Representative immunohistochemical images of FADS1 in corneal tissue after the injection of NC siRNA or FADS1 siRNA in DM mice with corneal injury (n = 3). (C) After corneal injury in DM mice, NC siRNA or FADS1 siRNA was injected, and sodium fluorescein staining was performed at days (D)0, D1, and D2. (D) Histogram illustrating the percentage of the defect area relative to the original wound (n = 6). (E) Representative optical coherence tomography images of diabetic corneal injury following the injection of NC siRNA or FADS1 siRNA compared with normal corneas. (F) Central corneal thickness was analyzed in three groups (n = 3). (G) Representative hematoxylin and eosin (HE)–stained images of diabetic corneal injury after the injection of NC siRNA or FADS1 siRNA compared with normal corneas (n = 3). All values are mean ± SEM. *P < 0.05; **P < 0.01.

FADS1-Specific siRNA Treatment Promotes Diabetic Corneal Epithelial Homeostasis and Functional Recovery

PAX6, a key transcription factor for corneal homeostasis, plays a crucial role in corneal epithelial cell fate determination.^37,38 Whole cornea immunofluorescence staining showed a significant increase in PAX6-positive cells after subconjunctival injection of FADS1 siRNA, indicating improved corneal repair in diabetic mice (Figs. 8A, 8C). Western blot analysis further demonstrated that FADS1 KD in HG-treated HCECs upregulated PAX6 expression (Supplementary Figs. S7A, S7B). Additionally, corneal epithelial barrier function, an essential indicator of corneal integrity, was assessed via E-cadherin expression. E-cadherin is a key adhesion molecule that maintains epithelial barrier stability.^39,40 Immunofluorescence staining showed that FADS1 siRNA significantly increased E-cadherin expression, suggesting effective restoration of corneal epithelial barrier function (Figs. 8B, 8D).

Figure 8.

FADS1-specific siRNA treatment promotes diabetic corneal epithelial homeostasis and functional recovery. (A, B) Representative images of whole cornea immunofluorescence staining revealing the expression and distribution of PAX6 and E-cadherin in each group. (C, D) The relative fluorescence intensity of PAX6 and E-cadherin in each group was analyzed based on the immunofluorescence staining results (n = 3). All values are mean ± SEM. **P < 0.01.

Discussion

Normal corneal wounds typically heal rapidly; however, in diabetic corneas, even minor injuries can lead to significantly prolonged healing times and persistent epithelial defects.^41–43 Therefore, promoting rapid epithelialization is essential for maintaining the structural integrity and normal function of diabetic corneas. Despite this, no truly effective treatments are currently available, and the underlying pathogenesis remains incompletely understood. In our study, we observed a significant and specific upregulation of FADS1 gene expression after diabetic corneal injury. Subcellular localization experiments revealed that FADS1 is primarily localized in the ER of corneal epithelial cells. Several recent studies have suggested that ER stress plays a key role in the pathological mechanisms of DK.^18,44–46 Whether ER stress is involved in the upregulation of FADS1 expression in diabetic corneas remains to be investigated further. In an in vitro model of HG-treated corneal epithelial cells, FADS1 KD significantly promoted cell migration. Additionally, in a corneal epithelial wound healing model of STZ-induced type 1 diabetic mice, subconjunctival injection of FADS1 siRNA accelerated corneal epithelial wound healing and improved epithelial homeostasis and barrier function. These findings suggest that FADS1 downregulation plays an important regulatory role in the wound healing and functional recovery of the diabetic corneal epithelium (Fig. 9). To date, no similar studies have been reported in the literature.

Figure 9.

Summary of the role of FADS1 in wound healing and functional recovery of the diabetic corneal epithelium.

The MAPK signaling pathway is critical for regulating cell growth and stress responses.⁴⁷ Our study demonstrated that under HG stress, FADS1 KD significantly activated the MAPK signaling pathway, thereby enhancing the migratory ability of corneal epithelial cells. However, the specific mechanism by which FADS1 KD activates this pathway requires further investigation.

Given the pivotal role of the MAPK signaling pathway in the regulation of autophagy,^30–33 and the significant impact of autophagy dysregulation on DK,^17,48 our findings indicate that FADS1 KD in HG-treated corneal epithelial cells leads to increased autophagosome accumulation. Furthermore, treatment with the autophagy inhibitor 3-MA resulted in no significant changes in cell migration while simultaneously suppressing the MAPK signaling pathway. These results suggest that the beneficial effects of FADS1 KD on DK may be mediated through autophagy regulation.

FADS1 belongs to the fatty acid desaturase gene family, and it is involved in the synthesis of highly unsaturated fatty acids in both the n-3 PUFA and n-6 PUFA pathways.⁴⁹ Although previous studies have demonstrated a close association between n-3 PUFAs and corneal function,^50–52 the role of n-6 PUFAs in the cornea remains unclear. Our study revealed that FADS1 KD specifically increased GLA levels in the n-6 PUFA pathway, thereby promoting corneal epithelial cell migration. These findings suggest that GLA supplementation may have potential therapeutic applications for DK.

In summary, we have demonstrated that FADS1 is highly expressed after diabetic corneal epithelial injury and that its KD promotes wound healing and functional recovery of the diabetic corneal epithelium. FADS1 represents a promising therapeutic target, offering novel insights and potential directions for future drug development and mechanistic studies in DK.