Protocol for measuring β-arrestin1-phosphorylated peptide interaction and analyzing conformational dynamics of β-arrestin1

Summary

Arrestins associate with phosphorylated G protein-coupled receptors and undergo conformational changes. Here, we present a protocol for measuring β-arrestin1-phosphorylated peptide interaction and analyzing conformational dynamics of β-arrestin1. We describe steps for constructing expression plasmids, expressing and purifying β-arrestin1, and performing hydrogen/deuterium exchange mass spectrometry analysis of V2Rpp-β-arrestin1 complex. We then detail procedures for measuring binding affinity using microscale thermophoresis. This protocol has potential application in analyzing conformational dynamics and measuring binding affinity of arrestins.

For complete details on the use and execution of this protocol, please refer to Kim et al.¹

Graphical abstract

Highlights

• •Guidelines for β-arrestin1 expression and purification
• •Instructions for HDX-MS analysis of V2Rpp-β-arrestin1 complex
• •Steps for MST-based affinity measurement between β-arrestin1 and V2Rpp

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Arrestins associate with phosphorylated G protein-coupled receptors and undergo conformational changes. Here, we present a protocol for measuring β-arrestin1-phosphorylated peptide interaction and analyzing conformational dynamics of β-arrestin1. We describe steps for constructing expression plasmids, expressing and purifying β-arrestin1, and performing hydrogen/deuterium exchange mass spectrometry analysis of V2Rpp-β-arrestin1 complex. We then detail procedures for measuring binding affinity using microscale thermophoresis. This protocol has potential application in analyzing conformational dynamics and measuring binding affinity of arrestins.

Before you begin

Hydrogen/deuterium exchange mass spectrometry (HDX-MS) is a technique to analyze the conformational dynamics of proteins. HDX-MS monitors the exchange between the amide hydrogen in the protein and the deuterium in the solvent. It has the advantage of analyzing the conformational changes or suggesting ligand-binding interfaces in the solution state. Microscale Thermophoresis (MST) is a technique that measures the binding affinity by tracking the movement of molecules in response to a temperature gradient. Here we analyzed the binding affinity between β-arrestin1 and phosphorylated C-tail peptide of vasopressin receptor type 2 (V2Rpp) using MST and the resulting conformational changes and potential binding interfaces using HDX-MS.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Bacterial and virus strains
E.coli DH5α chemically competent	Enzynomics	Cat# CP010
E.coli ROSETTA(DE3)	Novagen	Cat# 70954
Chemicals, peptides, and recombinant proteins
Protease inhibitor cocktail	BioVision	Cat# K272
Deuterium oxide (D2O)	Cambridge Isotope Laboratories	Cat# DLM-11-100
Chelating Sepharose Fast Flow	Cytiva	Cat# 17057501
Nickel(II) sulfate hexahydrate	Sigma-Aldrich	Cat# N4882
Ethanol (EtOH), extra pure	Duksan	Cat# 64-17-5
Dimethyl sulfoxide (DMSO)	Duchefa	Cat# D1370
Leupeptin	GoldBio	Cat# L-010
Lysozyme	GoldBio	Cat# L-040
Tris(2-carboxyethyl)phosphine (TCEP)	GoldBio	Cat# TCEP
Isopropyl-β-D-Thiogalactopyranoside (IPTG)	GoldBio	Cat# I2481C
Kanamycin	GoldBio	Cat# K-120-10N
Chloramphenicol	Duchefa	Cat# C0113.0025
DNase I	Roche	Cat# 11284932001
Benzamidine	Sigma-Aldrich	Cat# 12072
Imidazole	Sigma-Aldrich	Cat# I2399
V2Rpp	Tufts University Core Facility	N/A
Tween 20	Bio-Rad	Cat# BR170-6531
Dpn1	NEB	Cat# R0176S
Terrific broth	Alpha Biosciences	Cat# T20-114
LB broth high salt 2.5 kg	Duchefa	Cat# L1704.2500
TRIS-HCl	GoldBio	Cat# T-400-1
Sodium chloride (NaCl) (99.5%)	DAEJUNG	Cat# 7548-4100
NaH2PO4	Duchefa	Cat# S0522
H3PO4	Sigma-Aldrich	Cat# 49685
MS-grade formic acid	Fluka	Cat# 56302-50ML-GL
HPLC grade acetonitrile	J.T.Baker	Cat# 9017-88
HPLC grade ddH2O	J.T.Baker	Cat# 4218-88
HEPES	GoldBio	Cat# H-400-1
rCutSmart buffer	NEB	Cat# B6004S
Glycerol	Duksan	Cat# 781
Critical commercial assays
FavorPrep Gel/PCR purification mini kit	Favorgen	Cat# FAGCK0011-1
FavorPrep plasmid extraction mini kit	Favorgen	Cat# FAPDE 300
Monolith protein labeling kit RED-MALEIMIDE	NanoTemper	Cat# MO-L014
i-pfu DNA polymerase	Intron	Cat# 25181
Oligonucleotides
Primer: K294A forward: CGGGAAGCTCGCCCATGAAGACACAAATC	Bionics	N/A
Primer: K294R forward: CGGGAAGCTCCGTCATGAAGACACAAATC	Bionics	N/A
Primer: K292A forward: CTTGCCCTCGACGGTGCACTC AAGCATGAAGACACAAATC	Bionics	N/A
Primer: H295A forward: CTCGACGGGAAGCTCAAGG CCGAAGACACAAATCTG	Bionics	N/A
Primer: K292A/K294A forward: CCTCGACGGGGCCCTCGCCCATGAAG	Bionics	N/A
Primer: K294A/H295A forward: GAAGCTCGCCGCCGAAGACACAAATC	Bionics	N/A
Recombinant DNA
pET28a-WT β-arrestin1	This study	N/A
pET28a-β-arrestin1 K294R	This study	N/A
pET28a-β-arrestin1 K294A	This study	N/A
pET28a-β-arrestin1 K292A	This study	N/A
pET28a-β-arrestin1 H295A	This study	N/A
pET28a-β-arrestin1 K292A/K294A	This study	N/A
pET28a-β-arrestin1 K294A/H295A	This study	N/A
Software and algorithms
Prism 6.0	GraphPad	graphpad.com
PyMol 2.3	Schrodinger	pymol.org
ProteinLynx Global Server 2.4	Waters	www.waters.com
DynamX 3.0	Waters	www.waters.com
MO.Control 1.6	NanoTemper	nanotempertech.com
MO.Affinity Analysis 2.3	NanoTemper	nanotempertech.com
Other
T100 thermal cycler for the classroom	Bio-Rad	Cat# 1861096
ÄKTA FPLC (fast protein liquid chromatography)	Cytiva	N/A
NGC chromatography system	Bio-Rad	N/A
Epoch microplate reader	BioTek	N/A
Bio-Spin chromatography columns	Bio-Rad	Cat# BR7326008
Xevo G2-XS QTof	Waters	N/A
Immobilized pepsin column (2.1 × 30 mm)	Life Technologies	Cat# 2313100
C18 VanGuard trap column (1.7 mm, 1.0 × 100 mm)	Waters	Cat# 186003975
Acquity UPLC BEH C18 1.7 μm, 1.0 × 100 mm column	Waters	Cat# 186002346
nanoACQUITY UPLC HDX	Waters	N/A
Monolith NT.115	NanoTemper	N/A
Premium capillaries	NanoTemper	Cat# MO-K025

Materials and equipment

Lysis buffer

Reagent (stock concentration)	Final concentration	Amount
Tris-HCl pH 7.4 (1 M)	20 mM	20 mL
NaCl (5 M)	500 mM	100 mL
Benzamidine (10 mg/mL)	10 μg/mL	1 mL
Leupeptin (2.5 mg/mL)	2.5 μg/mL	1 mL
Protease inhibitor cocktail	N/A	1 mL
TCEP (100 mM)	100 μM	1 mL
ddH2O	N/A	876 mL
Total	N/A	1,000 mL

Store at 4°C for up to one month. Add protease inhibitors and TCEP right before use.

Alternatives: Tris-HCl can be substituted with HEPES, and TCEP can be substituted with dithiothreitol (DTT) or β-mercaptoethanol (βME).

Wash buffer

Reagent (stock concentration)	Final concentration	Amount
Tris-HCl pH 7.4 (1 M)	20 mM	20 mL
NaCl (5 M)	500 mM	100 mL
Imidazole (2 M)	20 mM	10 ml
Benzamidine (10 mg/mL)	10 μg/mL	1 mL
Leupeptin (2.5 mg/mL)	2.5 μg/mL	1 mL
Protease inhibitor cocktail	N/A	1 mL
TCEP (100 mM)	100 μM	1 mL
ddH2O	N/A	866 mL
Total	N/A	1,000 mL

Store at 4°C for up to one month. Add imidazole, protease inhibitors, and TCEP right before use.

Alternatives: Tris-HCl can be substituted with HEPES, and TCEP can be substituted with DTT or βME.

Elution buffer

Reagent (stock concentration)	Final concentration	Amount
HEPES pH 7.4 (1 M)	20 mM	20 mL
NaCl (5 M)	150 mM	30 mL
Imidazole (2 M)	400 mM	200 ml
Benzamidine (10 mg/mL)	10 μg/mL	1 mL
Leupeptin (2.5 mg/mL)	2.5 μg/mL	1 mL
Protease inhibitor cocktail	N/A	1 mL
TCEP (100 mM)	100 μM	1 mL
ddH2O	N/A	746 mL
Total	N/A	1,000 mL

Store at 4°C for up to one month. Add imidazole, protease inhibitors, and TCEP right before use.

Alternatives: TCEP can be substituted with DTT or βME.

Size exclusion chromatography (SEC) buffer

Reagent (stock concentration)	Final concentration	Amount
HEPES pH 7.4 (1 M)	20 mM	20 mL
NaCl (5 M)	150 mM	30 mL
ddH2O	N/A	950 mL
Total	N/A	1,000 mL

Store at 4°C for up to one week. Filter right before use and equilibrate the temperature before start experiment.

HDX H₂O buffer

Reagent (stock concentration)	Final concentration	Amount
HEPES pH 7.4 (1 M)	20 mM	0.2 mL
NaCl (5 M)	150 mM	0.3 mL
Glycerol (100%)	10%	1 mL
ddH2O	N/A	8.5 mL
Total	N/A	10 mL

Make fresh each time, cool to 4°C, and filter right before use.

HDX D₂O buffer

Reagent (stock concentration)	Final concentration	Amount
HEPES pH 7.4 (1 M)	20 mM	0.2 mL
NaCl (5 M)	150 mM	0.3 mL
Glycerol (100%)	10%	1 mL
D2O	N/A	8.5 mL
Total	N/A	10 mL

Make fresh each time, cool to 4°C, and filter right before use.

HDX Quench buffer

Reagent (stock concentration)	Final concentration	Amount
NaH2PO4-H3PO4 pH 2.01 (100 mM)	60 mM	6 mL
Glycerol (100%)	10%	1 mL
ddH2O	N/A	3 mL
Total	N/A	10 mL

Make fresh each time, cool to 4°C, and filter right before use.

MST assay buffer

Reagent	Final concentration	Amount
HEPES pH 7.4 (1 M)	20 mM	0.2 mL
NaCl (5 M)	150 mM	0.3 mL
TCEP (100 mM)	100 μM	0.01 mL
Tween 20 (100%)	0.05%	0.005 mL
ddH2O	N/A	9.485 mL
Total	N/A	10 mL

Make fresh each time.

Binary A buffer

Reagent	Final concentration	Amount
MS-grade formic acid	0.05%	0.3 mL
HPLC grade ddH2O	N/A	199.7 mL
Total	N/A	200 mL

Make fresh each time.

Binary B buffer

Reagent	Final concentration	Amount
MS-grade formic acid	0.05%	0.3 mL
HPLC grade acetonitrile	N/A	199.7 mL
Total	N/A	200 mL

Make fresh each time.

Step-by-step method details

Generation of mutant β-arrestin1 plasmid constructs

Timing: 2 days

This step describes the procedures for the generation of β-arrestin1 mutant constructs.

• 1.
  Perform PCR to generate mutant β-arrestin1 constructs using corresponding primers.

  • a.
    For PCR reactions, use:
    PCR reaction master mix

    Reagent	Amount
    DNA template	1 μL (50 ng)
    DNA Polymerase	1 μL
    Forward primer	1 μL (10 pmol)
    Reverse primer	1 μL (10 pmol)
    10x PCR buffer	5 μL
    dNTP	4 μL
    DMSO	1 μL
    ddH2O	36 μL

    Total reaction volume in each tube should be 50 μL.

    Note: Adding DMSO reduces the formation of secondary structures in the template and enhances PCR amplification of GC-rich templates, but be sure to add less than 10% of the final volume.

  • b.
    Then initiate PCR reaction with following program:
    PCR cycling conditions

    Steps	Temperature	Time	Cycles
    Initial Denaturation	95°C	2 min	1
    Denaturation	95°C	30 s	20 cycles
    Annealing	58°C	1 min
    Extension	72°C	11 min 40 s
    Final extension	72°C	5 min	1
    Hold	4°C	forever

• 2.Add 5.5 μL of 10x rCutsmart buffer to the PCR products.
• 3.Add 1 μL of Dpn1 and incubate at 37°C for 2 h.
• 4.Purify the PCR products using the FavorPrep Gel/PCR Purification Mini Kit (See the FavorPrep Gel/PCR Purification Mini Kit manual for details).

Pause point: The purified PCR products can be stored at 4°C for one week or at −20°C for several months.

• 5.Transform DH5α competent cells with the PCR products and plate onto LB agar plates with 50 μg/mL kanamycin. Incubate at 37°C for 12–18 h.
• 6.Pick a single colony and inoculate it into 5 mL of LB medium supplemented with 50 μg/mL kanamycin. Incubate at 37°C for 12–18 h.
• 7.Perform plasmid miniprep using the FavorPrep Plasmid Extraction Mini Kit and send plasmids for sequence confirmation (See the FavorPrep Plasmid Extraction Mini Kit manual for details).
• 8.The concentration of the purified DNA was determined by measuring the A260/A280 ratio using an Epoch Microplate Reader.

Pause point: The purified DNA constructs can be stored at −20°C for several years.

Expression of β-arrestin1 in bacterial cells

Timing: 4 days

This step describes the procedures for expression of β-arrestin1 in bacterial cells.

• 9.
  Transform the DNA construct into Escherichia coli ROSETTA (DE3) competent cells for protein expression.

  • a.
    Pre-heat the LB medium to 42°C.
  • b.
    Thaw Escherichia coli ROSETTA (DE3) competent cells on ice.
  • c.
    Add 1 μL (<50 ng) of expression plasmid to 50 μL Escherichia coli ROSETTA(DE3) competent cells.
  • d.
    Incubate the tubes on ice for 5 min.
  • e.
    Heat the tubes for 30 s in a 42°C water bath or heat block. Do not shake.
  • f.
    Place the tubes on ice for 2 min.
  • g.
    Add 80 μL LB medium and incubate at 37°C in a shaking incubator at 200 rpm for 1 h.
  • h.
    Spread the culture onto a pre-warmed LB agar plate containing 50 μg/mL kanamycin and 34 μg/mL chloramphenicol, then incubate at 37°C for 12–18 h.

Note: For the expression of other proteins, optimize the choice of Escherichia coli strains, such as BL21 or LOBSTR, based on the specific purpose.

• 10.Pick a single colony and inoculate it into >20 mL TB medium supplemented with 50 μg/mL kanamycin and 34 μg/mL chloramphenicol at 37°C for 12–18 h (Figure 1A).

Note: Move to the next step after checking that the inoculate is turbid.

• 11.Transfer 4 mL culture into each of five 2 L baffled-bottom flasks containing 400 mL of TB medium supplemented with 50 μg/mL kanamycin and 34 μg/mL chloramphenicol at 37°C and incubate for 3 h.
• 12.When the OD₆₀₀ reaches 0.6–0.8, add 0.03 mM IPTG to induce protein expression and incubate at 16°C for 24 h.
• 13.Harvest cell culture by centrifugation at 3,310 x g for 20 min at 4°C. Discard the supernatant and store the pellet at −80°C until use.

Note: For the expression of other proteins, optimize factors such as the growth medium (e.g., LB, EC, M9, 2XYT), incubation time, temperature, and IPTG concentration.

Figure 1.

Protein expression and purification workflow

(A) Protein expression and purification steps including construct generation, cell growth, cell harvest, cell lysis, Ni-affinity chromatography, and SDS-PAGE analysis.

(B) Further purification using size exclusion chromatography (SEC).

Generation of Ni affinity column

Timing: 1 day

This step describes the procedure for generating a Ni affinity column for the purification of β-arrestin1 from bacterial cells.

Generate the Ni affinity column in advance of purification.

• 14.Secure the Bio-Spin Chromatography Columns on a clamp.
• 15.Load 1 mL of Chelating Sepharose Fast Flow resin into each column.
• 16.Add 2–3 column volumes of 100 mM nickel sulfate and incubate the resin for 12–18 h.
• 17.Wash the resin with at least 10 column volumes of ddH₂O.
• 18.Sequentially wash the resin with 2 column volumes of 20% Ethanol (EtOH), followed by 2 column volumes of 50% EtOH, 2 column volumes of 70% EtOH, 2 column volumes of 50% EtOH, and finally 2 column volumes of 20% EtOH.
• 19.Store the resin in 20% EtOH at 4°C until use.

Purification of β-arrestin1 from bacterial cells

Timing: 1 day

This step describes the procedures for purification of β-arrestin1 from bacterial cells.

The N-terminal His tagged β-arrestin1 constructs are purified using Ni affinity chromatography, followed by size exclusion chromatography (SEC) (Figure 1).

• 20.Thaw the frozen bacterial cell pellets, resuspend them in 3 column volumes of lysis buffer, then freeze at −80°C for 30 min. Thaw at room temperature (20°C–25°C). Repeat this twice (Figure 1A).

Note: Freeze-thaw cycling disrupts the bacterial cell wall, making it more susceptible to lysis by lysozyme. Lysozyme-based lysis is a gentle method; however, for harsher conditions, alternative methods such as sonication or detergent-based lysis are recommended.

• 21.Add 3–5 mg/mL lysozyme and incubate for 30 min at room temperature (20°C–25°C).
• 22.Add 10 μg/mL DNase l and incubate for 30 min at room temperature (20°C–25°C).
• 23.Centrifuge at 18,000 x g for 20 min at 4°C. Gently harvest the supernatant and keep it on ice.
• 24.Add 20 mM Imidazole to the supernatant and load it onto a 1 mL of Ni affinity column pre-washed with lysis buffer (Figure 1A). Keep the supernatant and flow-through for subsequent SDS-PAGE analysis.
• 25.Wash the Ni affinity column with 20 column volumes of wash buffer. Keep the wash fraction for subsequent SDS-PAGE analysis (i.e., lysate, Ni-column flow-through, Ni-column wash, Ni-column elution fractions) (Figure 1A).
• 26.Elute the bound protein using elution buffer.
• 27.Filter the collected elution fractions using a 0.22 μm pore size cellulose acetate filter tube before loading onto the size exclusion chromatography column.
• 28.Mount the size exclusion chromatography column (Superdex-200 Increase 10/300 GL column) onto an ÄKTA FPLC (Fast Protein Liquid Chromatography) system and pre-equilibrated it with SEC buffer.
• 29.Load the filtered protein sample onto the SEC column (Figure 1B). The presence of proteins in the eluted fractions was monitored by measuring the Absorbance at 280 nm.
• 30.Perform SDS-PAGE to evaluate the protein purity (i.e., -column and SEC elution fractions) (Figure 1B).
• 31.The concentration of the purified protein was determined using an Epoch Microplate Reader.

Note: For the purification of other proteins, optimize key factors such as buffer composition (e.g., salt concentration, pH, imidazole concentration, reducing agents, and temperature). Specifically, increasing the salt concentration (100–500 mM) helps reduce non-specific binding to Ni affinity column. Depending on your specific needs, consider using alternative affinity columns such as Streptavidin, FLAG, Glutathione, or Heparin columns. Additionally, to enhance purity and yield, incorporating multiple purification steps may be beneficial.

Note: The buffer was changed from Tris to HEPES due to several advantages of HEPES in protein-related experiments. HEPES has lower temperature sensitivity for pH changes compared to Tris, absorbs less UV light at 260–280 nm, and does not strongly interact with metal ions, whereas Tris can chelate metal ions. However, Tris is often chosen as a buffer because it is more cost-effective.

Hydrogen/deuterium exchange

Timing: 1 day

This step describes the hydrogen/deuterium exchange of prepared protein samples (Figure 2A).

• 32.Prepare β-arrestin1 protein samples at a final concentration of 25 μM.
• 33.Add final concentration of 90 μM V2Rpp to the protein solution for peptide binding and incubate at room temperature (20°C–25°C) for 30 min.
• 34.Mix 4 μL of the prepared protein samples with 26 μL of HDX D₂O buffer to initiate hydrogen/deuterium exchange.

Note: For the other proteins, optimize the amount of proteins and labeling conditions as needed.

• 35.Incubate the mixture on ice for 10, 100, 1,000, or 10,000 s.

Note: The hydrogen/deuterium exchange temperature varies depending on the protein samples.

• 36.At each time point, add 30 μL of ice-cold quench buffer to the reaction mixture to slow down the reaction.
• 37.Immediately snap-freeze the samples on dry ice.
• 38.Perform the same procedure for non-deuterated samples as above, substituting HDX H₂O buffer for the HDX D₂O buffer.
• 39.Store the frozen stock at −80°C until mass spectrometry analysis.

Note: Ensure that the pH is maintained at approximately 2.5 after mixing the HDX H₂O buffer and quench buffer to minimize back exchange during HDX-MS analysis.

CRITICAL: Ensure that the speed and frequency of pipetting are consistent throughout all experimental procedures to minimize the deviation of the back exchange.

Figure 2.

HDX-MS workflow

(A) Experimental workflow for HDX sample preparation.

(B) Analytical workflow: Samples are loaded, digested using a pepsin column, desalted with a C18 trap column, separated by ACQUITY UPLC column, and analyzed by Xevo G2 QTof mass spectrometry.

Mass spectrometric analyses of the HDX samples

Timing: 1 day per protein state

This step is for analyzing the mass shift of the hydrogen/deuterium exchanged protein samples (Figure 2B).

• 40.Thaw the frozen protein samples at room temperature (20°C–25°C).
• 41.Inject the protein samples into the nanoACQUITY UPLC System with HDX Technology connected to a Xevo G2 quadrupole time-of-flight (QToF) mass spectrometer.
• 42.Use a pepsin column within the nanoACQUITY UPLC System with HDX Technology to digest protein samples. The peptic peptide fragments are collected on a C18 VanGuard trap column.

Note: Pepsin was used because the samples were kept approximately at pH 2.5.

• 43.Separate peptide fragments using a nanoACQUITY UPLC C18 column at 40 μL/min with an acetonitrile gradient (8% B to 85% B over 8.5 min).

CRITICAL: Maintain the sample, solvents, trap, and column at pH 2.5 and 0.5°C to minimize deuterium back exchange.

• 44.Perform mass spectrometry analyses using a Xevo G2 quadrupole time-of-flight (QToF) mass spectrometer equipped with a standard electrospray ionization (ESI) source. Configure the instrument to acquire mass spectra in the range of m/z 100–2,000 in positive ion mode. Set the acquisition duration to 12 min.
• 45.Identify peptides from non-deuterated samples using ProteinLynx Global Server 2.4 with the following search parameters:

   Mass type: monoisotopic mass.

   Enzyme: nonspecific enzyme specificity.

   Missed cleavage: 1.

   MS/MS ion searches: automatic fragment mass tolerance and automatic peptide mass tolerance.

   Variable modification: methionine oxidation.

   Minimum peptide score: 6.

• 46.Analyze HDX-MS data using DynamX 3.0 (Waters). Determine the amount of deuterium incorporated in each peptide by measuring the centroid of the isotopic distribution.

MST

Timing: 1 day

This step is for measuring binding affinity between β-arrestin1 and V2Rpp (Figure 3).

Note: Follow the instructions provided with the MO-L014 Monolith NT.115 Protein Labeling Kit RED-MALEIMIDE 2^nd generation for protein labeling (Figure 3A).

• 47.Prepare at least 100 μL of a 10 μM purified β-arrestin1.

Note: Choose the appropriate fluorescence label for your protein. (e.g., His-Tag Labeling Kit RED-tris-NTA 2^nd Generation, Protein Labeling Kit RED-MALEIMIDE 2^nd Generation, and Protein Labeling Kit RED-NHS 2^nd Generation). Recommend preparing MST assay buffer containing 0.05% Tween 20 to improve sample homogeneity.

• 48.
  Perform buffer exchange using Labeling buffer MALEIMIDE (Figure 3A).

  • a.
    Reconstitute Labeling buffer MALEIMIDE with 3 mL ddH₂O.
  • b.
    Prepare A-column and remove the storage solution by centrifuging at 1,500 x g for 1 min, then discard the flow-through.
  • c.
    Equilibrate the A-column with Labeling buffer MALEIMIDE by loading 300 μL Labeling buffer MALEIMIDE, centrifuging 1500 x g for 1 min, and discarding the flow-through. Repeat this step three times.
  • d.
    Add 100 μL of 10 μM protein sample to the A-column, then centrifuge at 1,500 x g for 2 min.
  • e.
    Collect the flow-through.
• 49.
  Label the protein with the dye RED-MALEIMIDE 2^nd Generation (Figure 3A).

  • a.
    Reconstitute the RED-MALEIMIDE 2^nd Generation dye with 25 μL of DMSO.
  • b.
    Mix 7 μL of RED-MALEIMIDE 2^nd Generation dye with 7 μL of Labeling buffer MALEIMIDE.
  • c.
    Add 10 μL of the mixed dye-solution to 90 μL of the protein.
  • d.
    Incubate at room temperature (20°C–25°C) for 30 min in the dark.
• 50.
  Purify the protein with B-column (Figure 3A).

  • a.
    Pour off the storage solution.
  • b.
    Fill the B-column with 8–10 mL of MST assay buffer.
  • c.
    After the dye labeling reaction, transfer 100 μL of dye-protein solution to B-column.

    CRITICAL: Ensure the dye-protein solution is completely soaked into the resin bed.

  • d.
    Add 550 μL of MST assay buffer to the B-column.
  • e.
    To elute the protein, place a clean microcentrifuge tube under the column. Add 450 μL of MST assay buffer onto the B-column, then collect the flow-through.
• 51.Dilute the labeled proteins (e.g., 100 nM or 200 nM) and optimize the following conditions (Figure 3B).

Figure 3.

MST workflow and Data Analysis

(A) Protein sample preparation for MST by labeling with fluorescent dye.

(B) MST sample preparation including sample loading on MST capillaries and MST measurement.

(C) Data analysis workflow, including capillary scan, MST curve, and dose-response curve representing the binding affinity between β-arrestin1 and V2Rpp. The binding affinity curve is represented as mean ± SD. C is reproduced and adapted from Kim et al.¹

   Fluorescence intensity.

   Excitation power: 5, 20, 40, 60, or 80%

   Capillary: regular capillaries vs. premium capillaries.

   MST power: low, medium, or high.

   Buffer composition.

• 52.Prepare 16 PCR tubes. Load 10 μL of MST assay buffer into each tube, except the 1^st PCR tube (Figure 3B).
• 53.Load 20 μL of a 600 μM ligand into the 1^st PCR tube, then perform a 1:1 serial dilution across to the 16 PCR tubes.
• 54.Add 10 μL of the protein sample to each PCR tube. Incubate at room temperature (20°C–25°C) for 15 min to equilibrate.
• 55.Load the sample into each capillary (Figure 3B). Measure MST using Monolith NT.115 at optimized excitation power and MST power at 21°C (MO. Control).

CRITICAL: Do not introduce any bubbles in the middle of the capillaries and analyze the fluorescence peaks uniform in shape and equal in height (Figure 3C).

• 56.Analyze the data using the MST instrument software (MO. Affinity analysis) (Figure 3C).

Expected outcomes

The principle of HDX-MS is to monitor the exchange rate between amide backbone hydrogens and deuterium in a solvent.^2,3 More dynamic regions, such as loops, exhibit higher deuterium uptake, whereas less dynamic regions, such as binding interfaces or core regions, show lower uptake. HDX-MS is a valuable technique for identifying binding interfaces and conformational changes induced by ligand binding, as demonstrated by differences in HDX profiles between unbound and ligand-bound states. Notably, the exchange kinetics profiles (e.g., EX1 vs. EX2 mechanisms) provide insights into protein dynamics. Optimizing peptide coverage and length is crucial for reliable results. Peptides consisting of 3-23 amino acids are recommended to maximize HDX-MS resolution (Figure 4A). Using DynamX 3.0 software, we analyze the centroid shifts from the obtained mass spectra (Figure 4B). Subsequently, we compare the HDX-MS profiles of apo and V2Rpp-bound β-arrestin1 by subtracting the HDX levels of the apo state from those of the V2Rpp-bound state. The differences in HDX levels are visualized as color-coded regions on the apo state structure of β-arrestin1 (PDB: 1G4R) (Figure 4C).

Figure 4.

Expected outcome of HDX-MS analysis

(A) Sequence coverage of β-arrestin1.

(B) Representative mass spectra of a specific peptide, showing isotopic distribution shifts at various deuterium exchange times (10, 100, 1,000, 10,000 s).

(C) HDX-MS profile comparison between the apo and V2Rpp-bound β-arrestin1.¹ The HDX level differences are color-coded on the basal state structure of β-arrestin1 (PDB: 1G4R). Data are represented as mean ± SEM. C is reproduced and adapted from Kim et al.¹

The principle of MST is tracking the movement of fluorophore-bound target molecules in response to the laser-induced temperature increases.^4,5 MST measures the binding affinity between fluorophore-bound target protein and a ligand. It offers the advantage of requiring a small amount of protein (10 μM, 100 μL) compared to the other biophysical tools, such as isothermal titration calorimetry. Additionally, MST does not require protein immobilization, unlike surface plasmon resonance. To ensure reliable results, it is essential to optimize conditions to achieve uniform fluorescence intensity (Figure 3C). Repeating the experiment three times in independent tests for reproducibility. Using the MST O. analysis software, we select the appropriate binding affinity data based on the normalized fluorescence (F_norm), calculated as the unbound/bound ratio of F₀ (fluorescence before heating) to F₁ (fluorescence after heating) (Figure 3C).

Limitations

In HDX-MS, back exchange during sample preparation and analysis can disrupt the accuracy of results. While it cannot be completely eliminated, minimizing the back exchange is crucial for obtaining reliable data. Additionally, HDX-MS provides information at the peptide level rather than at the single amino acid resolution, limiting the precision of structural insights.

In MST, fluorophore labeling is required but can sometimes change the natural binding properties of the ligand molecule. MST is highly sensitive to experimental conditions such as buffer composition, pH, salt concentration, and viscosity.

Troubleshooting

Problem 1

The eluted protein concentration is lower than expected after Ni-affinity chromatography (Purification of β-arrestin1 constructs, step 10).

Potential solution

Increase the amount of Ni affinity column and/or the concentration of imidazole concentration in the elution buffer.

Problem 2

During HDX-MS data analysis, the deuterium uptake levels from three independent experiments are inconsistent (HDX-MS, step 6).

Potential solution

Ensure that all pipetting steps and temperature conditions remain consistent during the hydrogen/deuterium exchange step. This minimizes variability in back exchange and ensures uniform results across the three independent experiments.

Problem 3

For the HDX-MS analysis, the percentage of deuterium uptake is too low to compare apo- and bound- states (HDX-MS, step 6).

Potential solution

Increase the temperature during hydrogen/deuterium exchange step or increase the final volume of deuterium buffer.

Problem 4

The initial fluorescence peaks in MST are inconsistent (MST, step 10).

Potential solution

Add a detergent, such as 0.05% Tween-20, or adjust buffer conditions, including pH and salt concentration.

Problem 5

The binding curve is not generated from the MST trace (MST, step 10).

Potential solution

If cysteine labeling interferes with the interaction between the protein and ligand, consider labeling lysine residues instead. Alternatively, use GFP tagging to facilitate binding analysis.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Prof. Ka Young Chung (kychung2@skku.edu).

Technical contact

Technical questions on executing this protocol should be directed to and will be answered by the technical contact, Prof. Ka Young Chung (kychung2@skku.edu).

Materials availability

This study did not generate new unique reagents.

Data and code availability

This study did not generate/analyze datasets and codes.

Acknowledgments

This work was supported by grants from the National Research Foundation of Korea funded by the Korean government (NRF-2021R1A2C3003518 and NRF-2019R1A5A2027340).

Author contributions

K.K. generated the mutant constructs, prepared the protein samples, and analyzed them for HDX-MS and MST. K.Y.C. initiated the project, supervised the research, and analyzed the data. K.K. and K.Y.C. wrote the manuscript.

Declaration of interests

The authors declare no competing interests.