Establishment of an indirect ELISA antibody detection method based on the stable expression of LSDV P32 protein in CHO-K1 cells

Abstract

Background

Lumpy skin disease (LSD), caused by infection with the lumpy skin disease virus (LSDV), is a highly infectious disease that poses a notable challenge to the cattle industry worldwide. To conduct epidemiological monitoring of LSDV infection in cattle and evaluate the immune efficacy of LSDV vaccines, it is essential to develop a rapid, sensitive, and specific ELISA-based antibody detection method.

Results

We utilized the LSDV P32 protein, stably expressed in a CHO-K1 suspension cell system, as a coating antigen to develop an indirect ELISA for Capripoxvirus (CaPV) antibody detection. This method specifically recognizes CaPV-positive sera without cross-reactivity with sera positive for bovine viral diarrhea virus, bovine rotavirus, infectious bovine rhinotracheitis virus, and Brucella antibodies. The method demonstrated a maximum serum dilution detection capacity of 1:3200, with intra- and inter-assay variation coefficients below 10%. Comparison with a commercially available kit showed an agreement of 95.7%.

Conclusion

The indirect ELISA antibody detection method established exhibited excellent specificity, sensitivity, and reproducibility, providing a reliable tool for clinical detection and epidemiological surveys of LSDV. This method offers significant potential for the prevention and control of LSD outbreaks.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12896-025-00966-6.

Background

Lumpy skin disease (LSD), caused by the lumpy skin disease virus (LSDV), is an infectious disease of cattle characterized by high transmissibility [1]. LSDV is a member of the capripoxvirus (CAPV) genus, which also includes sheeppox virus (SPPV) and goatpox virus (GTPV) [2, 3]. Given that these three viruses exhibit 96% nucleotide identity [4], vaccines for SPPV and GTPV are also widely used for the prevention and control of LSD [5], for example, in China the disease is mainly prevented by a fivefold dose of live GTPV vaccine and there is no LSDV vaccine approved for marketing to prevent this disease. There is significant antigenic cross-reactivity among viruses within the CaPV genus, making it difficult to differentiate them using serological methods [6]. High-immunity serum against GTPV can neutralize both SPPV and LSDV [7].

The primary clinical manifestations of LSD include fever, necrotic skin nodules, generalized lymphadenitis, limb swelling, and damage to the mucous membranes of the eyes, respiratory tract, reproductive organs, and gastrointestinal tract [8, 9]. The World Organization for Animal Health (WOAH) classifies LSD as a notifiable disease due to its significant economic and agricultural impact. First identified in Zambia in 1929, the disease remained confined to sub-Saharan Africa for over five decades before progressively spreading to the Middle East, Asia, and parts of Eastern Europe. More recently, LSD has rapidly expanded its presence across numerous Asian countries, including regions in the Far East, posing a growing threat to previously unaffected areas [10, 11]. Therefore, the development of precise, fast, and reliable diagnostic tools for LSD is critical to achieving effective disease control and eventual eradication.

Currently, several established laboratory diagnostic methods are available for the detection of LSD, including virus isolation and identification [12], polymerase chain reaction (PCR) [13, 14], quantitative real-time PCR [15, 16], Western blot analysis, indirect fluorescent antibody test, and virus neutralization test (VNT) [17]. However, these methods are often associated with drawbacks such as lengthy testing periods, stringent operational requirements, and limited applicability in field settings, making them unsuitable for high-throughput detection of LSDV. Enzyme-linked immunosorbent assay (ELISA) is characterized by its high specificity, strong sensitivity, and simplicity of operation, making it particularly well-suited for large-scale testing in cattle herds [18]. WOAH recommends the use of the ID Screen^® Capripox Double Antigen Multi-species ELISA kit, developed by ID.vet, for the detection of CaPV-specific antibodies in sera, plasma, and milk samples from goats, sheep, and cattle [19]. According to Milovanović M et al. [20], this double-antigen ELISA kit provides more accurate detection results compared to the gold standard VNT, making it one of the most useful serological techniques for high-throughput analysis. However, the commercial kit is expensive and involves significant challenges in producing sufficient whole-virus antigens for serological testing, as well as addressing quality control issues associated with whole-virus antigen production [21]. Therefore, establishing an ELISA method that utilizes immunogenic recombinant proteins as coating antigens holds significant value for clinical diagnostics and large-scale monitoring of vaccine-induced antibodies.

The P32 protein, a major structural protein located on the surface of the LSDV envelope, shares more than 97% sequence homology with its P32 protein in SPPV and GTPV [22], contains key antigenic epitopes and exhibits strong immunogenicity. It stimulates the host to produce antibodies early during infection to prevent viral spread; however, these antibodies cannot inhibit viral replication at the infection site [23]. Currently, P32 is one of the most immunogenic proteins identified in CaPV, making it a critical target for developing ELISA methods for serological monitoring of CaPV. Nevertheless, challenges such as the difficulty of P32 protein expression, low yield, or insufficient purity have become technical bottlenecks in the industrialization of ELISA kits [24]. Here, we utilized a CHO-K1 cell line to express the P32 protein and developed an indirect ELISA method utilizing this protein as the coating antigen. This approach is intended to provide a reference for serological detection of CaPV.

Methods

Construction and identification of the expression plasmid

The sequence of the LSDV P32 protein was obtained from NCBI (GeneBank: NC003027.1). Signal peptide and transmembrane regions of the P32 protein were predicted utilizing SignalP-4.1Server (https://services.healthtech.dtu.dk/service.php?SignalP-4.1) and TMHMM Server v.2.0 (http://www.cbs.dtu.dk/services/TMHMM-2.0/) software. Based on these computational analyses, a eukaryotic expression-compatible recombinant plasmid was designed. The P32 gene sequence, codon-optimized for mammalian expression, was synthesized by Shanghai Biological Co., Ltd. Primers were designed to amplify the P32 gene, forward primer P32-F 5’-cccAAGCTTGCCACCATGACTCGACTAACT-3’, and reverse primer P32-R 5’- ccgGAATTCTTATCAGTGGTGGTGGTGAT-3’. These oligonucleotides had added restriction enzyme sites (underlined) for Hind III and EcoRI, respectively, at the 5′ ends and primer tags (small letters). The LSDV/Heilongjiang/2022 strain was used as a template and amplified according to the 25 µL PCR system. The cycling condition was: initial denaturation at 95 ℃for 3 min, followed by 30 cycles of denaturation at 95 ℃ for 1 min, annealing at 60 ℃ for 15 s, extension at 72 ℃ for 1 min, and a final extension at 72 ℃ for 5 min.

The amplified PCR product and pEE12.4 vector were digested with Hind III and EcoRI enzymes and purified with gel. In a standard reaction, the insert was ligated into the PEE12.4 vector (Lozas). The recombinant plasmid was transformed into DH5α competent cells. After antibiotic selection, single colonies were selected and subjected to expanded culture. The recombinant plasmid was extracted and identified by double digestion with Hind III and EcoRI restriction enzymes. Sequencing was done to validate the correct insertion of the target gene sequence and ensure the integrity of the open reading frame. The resulting recombinant plasmid was designated PEE12.4-P32.

Establishment of a stable CHO-K1 cell line expressing recombinant P32 protein

CHO-K1 cells in the logarithmic growth phase (6.25 × 10⁶ cells) were harvested and resuspended in 1 mL of DMEM/F12 medium (Gibco™). A 0.8 mL aliquot of the cell suspension was mixed with 50 µg of plasmid DNA, transferred to a pre-chilled electroporation cuvette, and subjected to electroporation (Voltage 300 V, Capacitance 950 µF, Pulse exponential decay). Post-electroporation, 0.6 mL of the mixture was aspirated and diluted into 8 mL of DMEM/F12 medium supplemented with 10% (v/v) fetal bovine serum (FBS). The cell suspension was then seeded into a T-25 cm² tissue culture flask and incubated statically for 24 h.

After 24 h of culture, cells were seeded into 96-well plates (0.5 × 10⁴ cells/well) with 200 µL of medium per well containing 50 µM methionine sulfoximine (MSX) for selective pressure. When cell confluence reached approximately 80%, cells were passaged at a 1:4 ratio. Concurrently, culture supernatants were collected for preliminary SDS-PAGE analysis to identify positive wells, which were subsequently expanded through stepwise subcultivation. When cell populations reached sufficient density, a stepwise serum reduction strategy was employed to adapt adherent CHO-K1 cells to MetaCell^® CHO-500 medium (Cellplus Bio) serum-free suspension culture.

Expression and purification of recombinant P32 protein

When the cell density reached 10–12 × 10⁶ cells/mL, expression was induced by reducing the temperature to 33 ℃. Cells were cultured in a CO₂ incubator at 130 rpm. During the temperature-reduction phase, 200 g/L glucose concentrate was replenished daily to maintain media glucose levels ≥ 3 g/L. Feed supplements were added every other day: 30% (v/v) MetaCell™Feed-500 A (Cellplus Bio) and 3% (v/v) MetaCell™Feed-500B (Cellplus Bio). Daily cell counts and supernatant collections were performed for monitoring. Supernatants were collected when cell viability dropped below 50%. After centrifugation, the supernatant was filtered using a 0.22 μm membrane and purified employing a Ni-affinity chromatography column (GE Healthcare). Purified proteins were analyzed by SDS-PAGE and Western blotting with primary antibody (positive serum, 1:400 dilution) and enzyme-labeled antibody (rabbit anti-bovine IgG-HRP, CUSABIO, 1:5000 dilution). Protein concentrations were determined using BCA Protein Quantification Kit (Vazyme).

Serum samples collection

A total of forty-six serum samples from cattle vaccinated with an inactivated GTPV vaccine were obtained from the China Institute of Veterinary Drug Control (Beijing, China). Thirty-three bovine serum samples were collected from LSDV-free herds in Inner Mongolia and Beijing, China. Eleven serum samples from cattle clinically infected with LSDV were gathered during an outbreak in Jilin province, China. Furthermore, three serum samples were obtained from cattle experimentally infected in our laboratory with LSDV strains isolated in Heilongjiang province, China. One Standard positive serum each of bovine viral diarrhea virus (BVDV), bovine rotavirus (BRV), infectious bovine rhinotracheitis virus (IBRV) and Brucella were also supplied by the China Institute of Veterinary Drug Control (Beijing, China).

Establishment of an indirect ELISA method based on P32 protein

The original ELISA protocol is as follows: The P32 protein was diluted to 2 µg/mL using carbonate buffer (CBS, pH 9.6), and 100 µL/well was coated onto a 96-well microplate at 37 °C for 2 h. The plate was then blocked with 5% skimmed milk (200 µL/well) at 37 °C for 2 h. Subsequently, LSDV-positive and LSDV-negative sera, diluted at 1:400 (in PBS), were added (100 µL/well) and incubated at 37 °C for 2 h. The enzyme-labeled antibody (rabbit anti-bovine IgG-HRP, CUSABIO) was diluted at 1:5000 (in PBS), added (100 µL/well), and incubated at 37 °C for 1 h. Next, 100 µL of TMB Single-Component Substrate solution (Solarbio) was added, followed by incubation at 37 °C for 15 min in the dark. Finally, the reaction was terminated by adding 50 µL of 2 M sulfuric acid, and the absorbance was measured at 450 nm using a microplate reader. Between each step, plates were washed six times with PBS containing 0.05% Tween 20 (PBST) and patted dry.

One positive and one negative serum sample were selected and ELISA conditions were optimized using the checkerboard titration method. To determine the ideal antigen coating concentration and serum dilution, the P32 protein was diluted to six concentrations (4, 2, 1, 0.5, 0.25, and 0.125 µg/mL) and coated onto 96-well plates (100 µL/Well). Different dilutions (1:50 − 1:400) of LSDV-positive and LSDV-negative sera were incubated (100 µL/well). Antigen coating was conducted using CBS or phosphate-buffered saline (PBS, pH 7.3) under five distinct incubation protocols: 37 ℃ for 1 or 2 h and at 4 ℃ for 12, 16, or 18 h. This systematic evaluation aimed to identify the optimal antigen immobilization conditions. The optimal blocking solutions were selected from OutBlock buffer (CIFTIS), Thermo blocking buffer, 1% gelatin, 5% bovine serum albumin (BSA), 5% skim milk powder, and 10% horse serum, applied at 200 µL/well with three incubation durations: 37 ℃ for 1, 2, or 3 h. Sera and enzyme-labeled antibodies were diluted in PBS, PBST with 5% BSA, PBST with 1% BSA, PBST with 5% skim milk powder, or PBST with 1% skim milk powder. Serum incubation times of 1, 2, and 3 h at 37 ℃ were assessed to identify the optimal conditions. enzyme-labeled antibodies were incubated at the ratios of 1:1000, 1:3000, 1:5000, and 1:8000 at 100 µL/well, and reaction times were 30, 45, 60, and 90 min to obtain the optimal reaction conditions. Finally, color development was initiated by adding 100 µL/well 3,3’,5,5’-tetramethylbenzidine and incubating at 37 ℃ in darkness for 5, 10, 15, or 20 min before the reaction was stopped by adding 50 µL of 2 M sulfuric acid. Absorbance was read at a wavelength of 450 nm by a microplate reader.

Determination of the cut-off value

The optimized LSDV indirect ELISA method was applied to test 36 positive serum and 36 negative serum samples (the classification of these 72 sera was determined by VNT results). OD_450nm were recorded for each sample, and the sample-to-positive (S/P) ratio was calculated. Receiver operating characteristic (ROC) curve analysis was performed using SPSS software (version 26.9; IBM Corp., Armonk, USA) to establish the diagnostic cut-off value for this antibody detection method.

Sensitivity assessment

LSDV-positive serum (n = 1) was serially diluted from 1:10 to 1:6400. The optimized LSDV indirect ELISA method was utilized to measure S/P values at each dilution. Changes in S/P values with increasing serum dilution were observed to determine the sensitivity of the method.

Specificity assessment

The specificity of the indirect ELISA method was evaluated by testing positive sera for BVDV, BRV, IBRV, and Brucella (one reference serum for each disease). LSDV-negative (n = 1) and positive sera (n = 1) were included as controls. The results were analyzed to assess the specificity of the developed ELISA method.

Reproducibility assessment

The intra-assay and inter-assay reproducibility of the method were evaluated using five known negative sera and five known positive sera. For intra-assay reproducibility, each serum sample was tested five times on the same ELISA plate coated with the same batch of P32 protein. For inter-assay reproducibility, each serum sample was tested five times on ELISA plates coated with different batches of P32 protein. The S/P values were recorded, and the coefficient of variation (CV) was calculated as the ratio of SD to x̅ for each group of sera.

Concordance rate assessment

The optimized LSDV indirect ELISA method was compared with the commercially available ELISA kit from ID.vet (ID Screen^® Capripox Double Antigen Multi-species) by testing 93 serum samples. The concordance rate between the two methods was calculated.

Results

Construction and identification of the expression plasmid

Based on bioinformatics analysis of the P32 protein, an expression strategy was designed for the P32 protein. The full-length fusion protein consisted of a Kozak sequence (GCCACC), azurocidin preproprotein (AZ) signal peptide (ATGACTCGACTAACTGTGCTAGCACTACTAGCTGGCCTGCTGGCCTCTTCCAGAGCT), a truncated extracellular region of the P32 protein (amino acid positions 2-288), a (GGGS) linker, a His-tag (CACCATCACCATCACCACCACCAC), and a stop codon (TGATAA), sequentially linked together (Fig. 1). Following transformation of the recombinant plasmid into DH5α competent cells. After antibiotic selection, three monoclonal colonies were selected for verification via Hind III/EcoRI double digestion. Agarose gel electrophoresis revealed two distinct fragments measuring approximately 978 bp and 7579 bp (Fig. 2A), consistent with theoretical values. This confirmed the correct ligation of the P32 gene fragment into the vector. The plasmid PEE12.4-P32-2 was selected for sequencing, and the results revealed no nucleotide mutations compared to the target sequence.

Fig. 1.

Schematic diagram of the recombinant plasmid

Fig. 2.

Expression and purification of LSDV P32 protein using CHO-K1 cells. (A) Double digestion results of the recombinant plasmid. (B) SDS-PAGE analysis of recombinant P32 protein expression during low-temperature induction. (C) Western blot analysis of recombinant P32 protein expression during low-temperature induction. (D) SDS-PAGE analysis of purified recombinant P32 protein. (E) Western blot analysis of purified recombinant P32 protein

Expression and purification of recombinant P32 protein

The CHO-K1 cell line stably expressing LSDV P32 protein was subjected to low-temperature induction under MSX selection. Daily samples were collected and analyzed by SDS-PAGE and Western blot (Fig. 2C and B). The results showed a gradual increase in expression levels with prolonged low-temperature induction, reaching a peak on day 7, at which point cell viability dropped below 50%. After purification using a nickel-affinity column, 3 mL of protein was obtained from 100 mL of cell suspension. The protein concentration was determined to be 2.5 mg/mL using a BCA protein Quantification kit. The SDS-PAGE analysis revealed a predominant band corresponding to the expected molecular size of P32 (38 kDa), along with two minor bands migrating at approximately 76 kDa and 17 kDa. The higher molecular weight species (76 kDa) presumably represents a P32 homodimer, whereas the lower molecular weight band (17 kDa) may correspond to proteolytic degradation products (Fig. 2C). The protein purity was analyzed using ImageJ software and was found to be approximately 80%. Western blot analysis demonstrated that the P32 protein was specifically recognized by LSDV-positive sera (Fig. 2D).

Optimization of the indirect ELISA method

Through a checkerboard titration assay, the ideal antigen coating concentration and serum dilution were identified. An antigen concentration of 4 µg/mL paired with a serum dilution of 1:200 resulted in the highest differentiation between positive (P) and negative (N) sera, yielding a P/N ratio of 7.768 (Table 1). Based on these results, the optimal parameters for the indirect ELISA were established as an antigen coating concentration of 4 µg/mL and a serum dilution of 1:200.

Table 1.

Determination of the optimal antigen coating concentration and serum Dilution

Dilution of sera		Antigen at different concentrations (µg/mL)
		4	2	1	0.5	0.25	0.125
1:50	P	1.564	1.275	0.750	0.459	0.304	0.277
	N	0.386	0.390	0.361	0.306	0.345	0.383
	P/N	4.052	3.269	2.078	1.500	0.881	0.723
1:100	P	1.546	1.222	0.677	0.358	0.233	0.196
	N	0.260	0.238	0.241	0.230	0.220	0.238
	P/N	5.946	5.134	2.809	1.557	1.059	0.824
1:200	P	1.375	0.981	0.536	0.281	0.169	0.146
	N	0.177	0.173	0.167	0.164	0.156	0.171
	P/N	7.768	5.671	3.210	1.713	1.083	0.854
1:400	P	1.085	0.728	0.368	0.172	0.143	0.122
	N	0.152	0.140	0.138	0.140	0.129	0.126
	P/N	7.138	5.200	2.667	1.229	1.109	0.968

Under the determined optimal antigen coating concentration and serum dilution, further optimization was performed for the following parameters: coating buffer, coating conditions, blocking solution, blocking conditions, dilution buffers for serum and enzyme-labeled antibody, serum incubation time, enzyme-labeled antibody incubation time, dilution ratio of enzyme-labeled antibody, and color development time. The final optimal conditions for the indirect ELISA were established as follows: the P32 protein was coated at 4 ℃ for 12 h utilizing carbonate buffer solution (CBS) and blocked at 37 ℃ with 5% skim milk powder for 2 h. The optimal serum incubation time was 2 h at 37 ℃, and the enzyme-labeled antibody incubation time was 1 h at 37 ℃. The optimal dilution buffer for both serum and enzyme-labeled antibodies was PBST with 1% skim milk powder. The optimal dilution ratio for the enzyme-labeled antibody was 1:3000. The best color development time was 20 min at 37 ℃ in the dark (Fig. 3).

Fig. 3.

Optimization of the indirect ELISA method. (A) Determination of the optimal coating buffer. (B) Determination of the optimal coating conditions. (C) Determination of the optimal blocking solution. (D) Determination of the optimal blocking conditions. (E) Determination of the optimal dilution buffer for serum and enzyme-labeled antibody. (F) Determination of the optimal serum incubation time. (G) Determination of the optimal enzyme-labeled antibody incubation time. (H) Determination of the optimal enzyme-labeled antibody dilution ratio. (I) Determination of the optimal color development time

Determination of the cut-off value

The established indirect ELISA method was applied to 36 negative and 36 positive serum samples. The S/P ratio was calculated for distribution analysis and ROC curve analysis (Fig. 4). The results demonstrated that when the sensitivity and specificity were 94.44% and 100%, respectively, Youden’s index (J) was 0.9444, and the optimal cut-off value was determined as 0.262. Based on these findings, samples can be classified as follows: when the S/P ratio of a sample is greater than 0.262, it is considered positive; when the S/P ratio is less than 0.262, it is considered negative.

Fig. 4.

Determination of the cut-off value. (A) Samples distribution. (B) analysis results of the ROC

Sensitivity assessment

The sensitivity test results highlighted that the S/P value remained above 0.262 when the positive serum was diluted up to 1:3200, demonstrating that the method has excellent sensitivity (Fig. 5A).

Fig. 5.

Validation of the indirect ELISA method. (A) Sensitivity assessment. (B) Specificity assessment

Specificity assessment

The specificity test results showed that the S/P values of LSDV-positive sera were higher than the cut-off value, whereas the S/P values of all other serum samples were below the cut-off value (Fig. 5B). These findings validate that the method exhibits excellent specificity.

Reproducibility assessment

The reproducibility results demonstrated that the CV for five replicate measurements within the same batch of coated plates ranged from 2.91 to 6.48%, while the CV across five different batches ranged from 4.55 to 9.94% (Table 2). These findings indicate that the indirect ELISA method exhibits excellent intra-assay and inter-assay reproducibility.

Table 2.

Reproducibility analysis of the indirect ELISA method

Batch no.		Intra-assay CV (%)		Inter-assay CV (%)
		X ± SD	CV(%)	X ± SD	CV(%)
Positive samples (n = 5)	1	0.416 ± 0.021	5.05	0.630 ± 0.041	6.51
	2	1.228 ± 0.066	5.37	1.165 ± 0.097	8.33
	3	1.000 ± 0.058	5.80	0.917 ± 0.052	5.67
	4	0.319 ± 0.012	3.76	0.571 ± 0.026	4.55
	5	0.341 ± 0.018	5.28	0.418 ± 0.021	5.03
Negative samples (n = 5)	1	0.075 ± 0.004	5.34	0.183 ± 0.011	6.02
	2	0.077 ± 0.005	6.48	0.115 ± 0.011	9.54
	3	0.101 ± 0.005	4.96	0.102 ± 0.007	6.89
	4	0.070 ± 0.004	5.69	0.121 ± 0.012	9.94
	5	0.069 ± 0.002	2.91	0.095 ± 0.005	5.28

Concordance rate assessment

The established indirect ELISA method and the ID Screen^® Capripox Double Antigen Multi-species ELISA kit were used to analyze 93 serum samples. Among these, 89 samples yielded consistent results, resulting in a concordance rate of 95.7%. Four samples were identified as positive by the established indirect ELISA method but negative by the ID Screen^® Capripox Double Antigen Multi-species ELISA kit. Among these four serum samples, two serum samples from experimentally infected cattle were prepared in our laboratory, one serum sample from cow clinically infected with LSDV was gathered during an outbreak in Jilin province, and one serum sample from cow vaccinated with an inactivated GTPV vaccine. Verification by VNT showed that two of the serum samples were positive, while the other two were negative. These findings indicate that the established indirect ELISA method exhibits high accuracy.

Discussion

LSD was first detected in China in 2019, where it quickly spread across several provinces, leading to substantial economic losses [25]. Currently, no specific antiviral treatments are available for managing LSD, and vaccination remains the primary approach to preventing LSDV infections [26]. Therefore, the development of a reliable and rapid antibody detection method is critical for shaping effective immunization strategies and curbing the disease’s transmission.

The P32 protein is a major structural protein located on the surface of the CaPV envelope. It contains multiple antigenic determinants and B-cell epitopes [27]. The presence of glycosylation sites leads to complex post-translational modification processes, which also pose challenges and requirements for prokaryotic expression systems. Previous studies have utilized P32 protein as a target in indirect ELISA assays to detect CaPV-specific antibodies in sheep and cattle sera [28] and in immunocapture ELISA kits for detecting SPPV antigens [29]. However, Ebrahimi-Jam et al. [30] found that the full-length P32 protein was difficult to express in the Escherichia coli expression system. As a result, many researchers have attempted to express truncated versions of the P32 protein. Unfortunately, most recombinant truncated P32 proteins are expressed as inclusion bodies with low yields. These truncated proteins often fail to efficiently recognize and bind neutralizing antibodies in animals, leading to poor detection sensitivity or increased false-positive results due to nonspecific reactions [31, 32].

With the development and refinement of eukaryotic expression systems, recombinant proteins can now undergo post-translational modifications such as methylation, glycosylation, phosphorylation, and translational folding [33]. These modifications enable the expressed proteins to closely resemble the native structural proteins of viruses in both structure and biological activity, thereby preserving their antigenicity in indirect ELISA and facilitating specific interactions with antibodies. However, insect cell lines carry the risk of host DNA and protein contamination, necessitating additional purification steps for control. Meanwhile, HEK293 cells tend to aggregate in suspension cultures, particularly at higher densities, which may compromise large-scale production efficiency. In recent years, the CHO-K1 cell expression system has emerged as a prominent technological focus [34]. This system offers several advantages, including relatively high protein expression yields, low secretion of endogenous proteins, the ability to perform post-translational processing, and simplified purification of the resulting products. Therefore, this study employed the CHO-K1 expression system for the recombinant expression of the P32 protein. The LSDV P32 protein was obtained with a concentration of approximately 2.5 mg/mL. Analysis using ImageJ software revealed a protein purity of 80%, while protein degradation was still observed. To enhance protein stability, subsequent studies will focus on optimizing storage conditions through supplementation of stabilizers, modification of buffer composition, or implementation of cryoprotectants.

In a previous study conducted in our laboratory, the GTPV P32 protein was successfully expressed using an E.coli expression system [28], and an indirect ELISA antibody detection method was established (unpublished data). The prokaryotically expressed P32 protein could detect positive serum at a maximum dilution of 1:800. It exhibited no cross-reactivity with BRV, IBRV, Brucella, or BVDV-positive sera. The intra-assay CV ranged from 4.14 to 8.67%, while the inter-assay CV ranged from 6.87 to 10.45%. The concordance rate with the ID Screen^® Capripox Double Antigen Multi-species ELISA kit was 90.32% (84/93). In comparison, the indirect ELISA method established using P32 protein expressed in the CHO-K1 expression system demonstrated superior sensitivity, detecting positive serum at a maximum dilution of 1:3200. It also showed improved reproducibility, with intra-assay CVs ranging from 2.91 to 6.48% and inter-assay CVs ranging from 4.55 to 9.94%. Additionally, the CHO-K1-based ELISA performed better in detecting serum from cattle vaccinated with the inactivated GTPV vaccine and those naturally infected with LSDV, achieving a concordance rate of 95.7% (89/93) with the ID Screen^® Capripox Double Antigen Multi-species ELISA kit. The enhanced sensitivity and reproducibility of our established ELISA method may be attributed to the use of the CHO-K1 expression system for P32 protein production.

Based on the background of the tested sera and the results of VNT, our established ELISA method demonstrated higher accuracy for CaPV detection compared to the ID Screen^® Capripox Double Antigen Multi-species ELISA kit. This newly developed ELISA method provides an alternative and technical advancement for the clinical detection and epidemiological investigation of LSDV. It holds significant potential for the prevention and control of LSD outbreaks in cattle. However, this study only tested a limited number of serum samples. To evaluate the reliability of the results, a large number of clinical samples need to be assessed.

Conclusions

In this study, an indirect ELISA method was established for the detection of CaPV antibody by eukaryotic expression of LSDV P32 protein, and the established method had good specificity, sensitivity and reproducibility. The assay provides an alternative, inexpensive, and rapid serological detection method suitable for CaPV antibody detection on a large scale.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Author contributions

RX, ZZ and XC conceived and designed the study. RX, JZ, DS and ML conducted the experiments. YZ (Yinghui Zhang), DL, RW and JZ analyzed the data. RX, YZ (Yuanyuan Zhu), YL and YW wrote the original draft. All authors reviewed and approved the final manuscript.

Funding

This work was supported by the grants from the National Key Research and Development Plan of China (2022YFD1800704).

Data availability

The datasets used and analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

The animal study protocol was approved by the Ethics Committee of China Institute of Veterinary Drug Control for the preparation of Lumpy Skin Disease Virus (LSDV) positive serum, virulence determination, and animal infection experiments. (protocol code IVDC(F) 202400122, IVDC(F) 202400057 and date of 2024-04-07,2024-02-29)

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.