Mechanism of fumonisin B1 on growth performance and intestinal structural integrity of juvenile grass carp (Ctenopharyngodon idella)

Abstract

Fumonisin B1 (FB1) is a prevalent mycotoxin found in plant-based feed ingredients, and it negatively impacts the performance of aquatic animals. However, the mechanism of this toxicity remains unclear. This study aims to investigate the effect and underlying mechanism of dietary FB1 on the growth performance of juvenile grass carp (Ctenopharyngodon idella). A total of 720 juvenile grass carp (10.92 ± 0.02 g) were fed with four different levels of FB1 diets (0, 2.06, 3.94, and 8.05 mg/kg) for 30 d and each group had 3 replicates of 60 fish. Our data indicated that when the FB1 concentration in the diet exceeded 3.94 mg/kg, there was a significant decline in growth performance (e.g., final body weight, percent weight gain, and body length) (P < 0.05), as well as reductions in the activities of digestive enzymes (e.g., chymotrypsin and trypsin), alkaline phosphatase, and creatine kinase in juvenile grass carp (P < 0.05). Furthermore, increased levels of intestinal sphinganine (Sa), sphingosine (So), and FB1 residues were observed, along with disruptions in intestinal tissue structure and elevated serum D-lactic acid levels (P < 0.05). Additionally, FB1 inhibited the Kelch-like ECH-associated protein 1a/NF-E2-related factor-2 signaling pathway, resulting in decreased gene expression of intestinal copper-zinc superoxide dismutase, glutathione peroxidase 4b, and glutathione peroxidase 1a (P < 0.05). These alterations were accompanied by a reduction in glutathione levels, total superoxide dismutase activity, and total antioxidant capacity (P < 0.05), as well as an increase in levels of reactive oxygen species and malondialdehyde in the intestine (P < 0.05). FB1 induced intestinal apoptosis by downregulating the gene expression of B-cell lymphoma 2 (P = 0.009), while simultaneously upregulating the expression of Bcl-2-associated X protein, apoptotic protease activating factor-1, caspase-9, and caspase-3 (P < 0.05). Additionally, FB1 decreased the gene expression of apical junction complex-related molecules (e.g., zonula occluden-1, occludin, and nectin) (P < 0.05), while increasing the expression of claudin-15b, myosin light chain kinase, Rho family GTPases, and Rho-associated protein kinase (P < 0.05). These findings indicated that dietary FB1 negatively impacts the growth performance of juvenile grass carp, likely due to reduced digestive and absorptive capacities, elevated intestinal Sa and So levels, and disruption of intestinal structure integrity. This study filled the study gap on the toxicity of FB1 to the intestines of aquatic animals.

1. Introduction

Fumonisins (FUM) are secondary toxic metabolites produced by fungi of the genus Fusarium (Chen et al., 2021a). These compounds are commonly found in plant-based feed ingredients, such as maize, wheat, and rice (Chen et al., 2021b). FUM B1 (FB1) is the most toxic and abundant analog within the group of FUM analogs (Braun and Wink, 2018). FB1 exhibits structural similarity to sphingosine (So) and sphinganine (Sa) (Chen et al., 2021a). Ceramide synthase catalyzes the conversion of Sa and So into ceramide. FB1 competes with Sa and So for binding to ceramide synthase, thereby inhibiting its activity (Chen et al., 2021a). These effects lead to the accumulation of Sa and So, which contributes to disorders in sphingolipid metabolism (Chen et al., 2021a). Previous studies have shown that FB1 induces the accumulation of Sa and So in various animals, including steers (Jennings et al., 2020), turkeys (Guerre et al., 2022), and mice (Yayeh et al., 2021). This accumulation may lead to damage to the organs of aquatic animals. Research has shown that FB1 in the diet led to brain oxidative damage, structural changes in oligodendrocytes, and apoptosis of cerebellar granules in silver catfish (Rhamdia quelen) (Baldissera et al., 2020). Additionally, FB1 in the diet caused atrophy and vacuolation of the hepatopancreas in Pacific white shrimp (Litopenaeus vannamei) (Kracizy et al., 2021). These detrimental effects ultimately lead to a decrease in the growth performance of both silver catfish (Baldissera et al., 2020) and Pacific white shrimp (Kracizy et al., 2021).

The intestine plays a crucial role in the growth and development of animals. The intestine serves as both a digestive and absorptive organ, as well as a protective barrier against harmful substances (Gao et al., 2023). In the intestine, macromolecular nutrients are broken down into smaller molecules by digestive enzymes and then absorbed by intestinal epithelial cells with the assistance of brush border enzymes, ultimately influencing the growth and development of animals (Xue et al., 2023). Previous studies have shown that mycotoxins such as aflatoxin B1 (Feng et al., 2017) and deoxynivalenol (Gonçalves et al., 2018) affected animal growth performance by inhibiting the activities of chymotrypsin and trypsin. However, the effect of FB1 on intestinal digestion and absorption remains unexplored.

An intact intestinal barrier is crucial for the digestion and absorption of nutrients. Both immune response and intestinal structural integrity influence the intestinal barrier (Zhang et al., 2023). Previous studies have primarily explored the effects of FB1 on the intestinal immune response in higher vertebrates. Research in mice has shown that FB1 led to the increased expression of IL-6, IL-1β, and IL-18 in the intestines of mice (Li et al., 2020b). These negative effects may be associated with an elevated risk of necrotic enteritis in chickens (Antonissen et al., 2015). In order to investigate the influence of FB1 on the intestinal barrier, we should collect comprehensive data from multiple animal studies. However, there is a lack of data on the effects of FB1 on the intestines of lower vertebrates such as fish and crustaceans.

The intestinal resistance to harmful substances and maintenance of normal function rely on the integrity of the intestinal structure. However, a study conducted in vitro showed that pig intestinal explants exposed to FB1 decreased antioxidant capacity and increased oxidative stress (Silva et al., 2019). Oxidative stress in intestinal cells causes damage to biological macromolecules, ultimately leading to the destruction of cell structure and function (Vona et al., 2021). These alterations subsequently compromise intestinal integrity (Rao, 2008; Vona et al., 2021). Moreover, oxidative DNA damage triggers apoptotic pathways. Excessive apoptosis results in intestinal epithelial cells being damaged and shed, ultimately compromising the intestinal integrity (Subramanian et al., 2020). Adjacent intestinal cells maintain intestinal structural integrity through the apical junction complex (AJC). However, when porcine intestinal epithelial cells were exposed to FB1, the AJC components (occluding, ZO-1, and claudin) expression decreased, ultimately resulting in intercellular AJC damage (Li et al., 2022). These in-vitro experiment data demonstrate that FB1 poses a potential threat to the intestinal structure integrity. However, there is a lack of relevant in-vivo experiment data to support the hypothesis.

Grass carp (Ctenopharyngodon idella) is the highest productive freshwater-farmed fish in China, with production increasing from 5,069,948 t to 5,941,315 t over the last decade (BFMARA, 2014, 2024). Higher yields in the grass carp breeding industry require more feed protein sources. To address this demand, a higher proportion of plant protein sources is used in grass carp feed, which could potentially increase the risk of FB1 contamination (Wang et al., 2015). Compared to other fish, grass carp is more sensitive to dietary mycotoxins, such as aflatoxin B1 (Zeng et al., 2019) and deoxynivalenol (Huang et al., 2018). However, there are no reports available regarding the impact of FB1 on grass carp.

Based on the above background, this study evaluated the effect of FB1 on the growth performance, digestion capacity, and absorption capacity of grass carp. Additionally, it explored the effects of FB1 on intestinal integrity for the first time through in-vivo experimental methods. This study provides in-vivo experimental data for comprehending the toxicity of FB1 in the intestine of fish.

2. Materials and methods

2.1. Animal ethics statement

The experiment adhered to the experimental protocol approved by the Animal Care Advisory Committee of Sichuan Agricultural (No. YN2020214026). All animal experiments were conducted in strict adherence to the regulations and requirements outlined in the “Animal Research: Reporting of In Vivo Experiments” (ARRIVE) guidelines (https://arriveguidelines.org).

2.2. Experimental diets

The basal dietary composition is depicted in Table 1. Fish meal, casein, and gelatin were the main protein sources, while fish oil and soybean oil were the major lipid sources. There were four different concentrations (0, 2, 4, and 8 mg/kg respectively) of the FB1 (Pribolab Pte, Ltd., Singapore, purity >98%) included in the diets. According to AOAC (1990), the Soxhlet exhaustive extraction technique (method 960.39) and the Kjeldahl method (method 955.04) were employed to determine the contents of crude lipid and crude protein, respectively. The actual levels of FB1 in the diets were determined to be 0, 2.08, 3.94, and 8.05 mg/kg respectively, by the FB1 ELISA kit from Pribolab Pte, Ltd. (Singapore). The diets were stored at −20 °C until use.

Table 1.

Composition and nutrient levels of the basal diet of juvenile grass carp (Ctenopharyngodon idella) (air-dried basis, g/kg).

Item	Content
Ingredients1
Fish meal	60.00
Casein	250.00
Gelatin	87.00
α-Starch	290.00
Flour	6.32
Fish oil	14.10
Soybean oil	18.10
Cellulose	110.00
Vitamin premix2	10.00
Mineral premix3	20.00
Choline chloride4	10.00
Ca(H2PO4)2	31.80
Butylated hydroxyanisole	0.15
DL-Methionine (99%)	0.58
L-Tryptophan (98%)	0.25
L-Threonine (98.5%)	1.70
FB1 premix5	90.00
Total	1000.00
Nutrient levels
Crude protein	325.57
Crude lipid	47.70
n-3 PUFAs6	10.40
n-6 PUFAs6	9.60
Available P7	8.40

FB1 = fumonisin B1; PUFAs = polyunsaturated fatty acids.

¹Sources of ingredients are detailed in Table S1.

²Provide the following per kilogram of vitamin premix: retinyl acetate (500,000 IU/g) 0.80 g; VD₃ (500,000 IU/g) 0.32 g; DL-A tocopherol acetate (50%) 40.00 g; VK₃ (50%) 0.38 g; thiamine nitrate (98%) 0.16 g; riboflavin (80%) 0.78 g; VB₆ (98%) 0.62 g; calcium-D-pantothenate (98%) 4.20 g; niacin (99%) 2.58 g; myoinositol (97%) 22.06 g; VB₁₂ (1%) 0.94 g; D-biotin (2%) 1.55 g; folic acid (95%) 0.38 g; VC (95%), 16.32 g. All ingredients were diluted with cellulose to 1 kg.

³Provide the following per kilogram of mineral premix: FeSO₄⋅H₂O (30% Fe) 12.25 g; CuSO₄⋅5H₂O (25.10% Cu) 0.95 g; ZnSO₄⋅H₂O (34.50% Zn) 7.68 g; MnSO₄⋅H₂O (31.8% Mn) 3.07 g; MgSO₄⋅H₂O (15.0% Mg) 237.83 g; CaI₂ (3.2% I) 1.56 g; selenium yeast (0.2% Se) 13.65 g. All ingredients were diluted with cellulose to 1 kg.

⁴Provide the following per kilogram of choline chloride premix: a total of 306.71 g of choline chloride (50%) was diluted with cellulose to 1 kg.

⁵Provide the following per kilogram of FB1 premix: according to the dietary FB1 levels of each treatment group, FB1 (99%) was mixed with flour and fish oil to obtain FB1 premix with FB1 levels of 0, 22.45, 44.89, and 89.79 mg/kg, respectively. The amount of flour and fish oil was calculated as 8% and 1% of the weight of the basal diet, respectively.

⁶The contents of the n-3 PUFAs and n-6 PUFAs were calculated according to NRC (2011).

⁷Available phosphorus content was calculated according to NRC (2011).

2.3. Feeding trial

Healthy juvenile grass carp, obtained from a Sichuan commercial fishery, were temporarily placed in net cages with a length, width and height of 1.40 m. A total of 720 fish (averaging 10.92 g) were distributed evenly between 4 treatment groups. There were three replicates in each group, with 60 fish in each replicate. During the experimentation period, different groups were fed four diets respectively, at 07:00, 11:00, 15:00, and 19:00 every day for 30 d. After the meal, the residue was collected, dried, weighed, and recorded. The experiment was conducted under natural light circulation. The Digital Water Thermometer (Tianjin Kehui Instrument Factory, Tianjin, China) was utilized to measure the water temperature, which was 32.00 ± 2.46 °C. The ProQuatro Multiparameter Meter (Xylem, Inc., Ohio, USA) was utilized to measure the dissolved oxygen level, which was above 6.0 mg/L.

2.4. Samples collection

For the calculation of growth performance after 30 d, fish per cage were counted and weighed. In each group, a total of 70 fish were immersed in a 50.0 mg/L solution of 4-aminobenzoic acid ethyl ester (Sigma Aldrich, Missouri, USA) to anaesthetize them. Fish were measured for weight and length. After collecting blood samples from a tail vein, the serum was separated by centrifugation. The serum was stored at −20 °C. Intestinal weight and length were also measured. Hepatopancreas and intestinal specimens were stored at −20 and −80 °C. Additionally, the intestines were also fixed with 4% paraformaldehyde.

2.5. Growth performance calculation

The growth performance parameters were calculated as:

Percent weight gain (PWG, %) = 100 × (final body weight – initial body weight)/initial body weight;

Feed intake (FI, g/fish) = (feeding amount - residual feed amount)/60;

Feed efficiency (FE, %) = 100 × (final body weight – initial body weight)/FI;

Intestinal length index (ILI, %) = 100 × intestine length/body length;

Intestinal somatic index (ISI, %) = 100 × intestine weight/body weight.

2.6. Histological observation

The fixed intestinal samples were dehydrated in ethanol. These samples were embedded in paraffin and cut into slices with a thickness of 5 μm. Three samples were taken from each group. Hematoxylin and eosin were used to stain the sections. The light microscope (Nikon, TS100, Tokyo, Japan) was used to observe the tissue structure.

2.7. Biochemical analysis

According to the methods of Zhao et al. (2022), the FB1 ELISA assay kit from Pribolab Pte, Ltd. (Singapore) was used to measure the levels of FB1 within the intestine, following the instructions. Briefly, a total of 0.2 mg of intestinal tissue was weighed and transferred into a 2 mL centrifuge tube. Subsequently, a total of 1 mL of 60% methanol was added to create a homogenate. The homogenate was centrifuged at 1323 × g for 5 min, and the supernatant was collected for further analysis. The methods and kits used are shown in Table S2.

The Sa and So levels in the intestine were measured using the Sa ELISA kit and So ELISA kit, following the instructions provided by Shanghai Enzyme Biotechnology Co., Ltd. (Shanghai, China). Briefly, the extraction solution was prepared according to the volume ratio of butanol:methanol:water (5:25:70). The intestinal tissue (0.1 mg) was weighed and transferred into a 2 mL centrifuge tube, and then 0.9 mL of the extraction solution was added to create a homogenate. The methods and kits used are shown in Table S2.

The serum D-lactic acid (D-LA) concentration was analyzed using the D-LA ELISA kit according to the instructions provided by Beijing Qisong Biotechnology Co., Ltd. (Beijing, China). Briefly, the serum was removed from −20 °C, thawed, centrifuged at 745 × g for 10 min, and the supernatant was collected for further analysis. The methods and kits used are shown in Table S2.

The activities of chymotrypsin, trypsin, lipase, and amylase in the hepatopancreas and intestine were analyzed with the chymotrypsin assay kit, trypsin enzyme assay kit, lipase assay kit, and amylase assay kit from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The activities of Na⁺/K⁺-ATPase (NKP), alkaline phosphatase (AKP), creatine kinase (CK), total superoxide dismutase (T-SOD), glutathione peroxidase (GPx) and malondialdehyde (MDA) content, glutathione (GSH) contents, total antioxidant capacity (T-AOC) and reactive oxygen species (ROS) levels in the intestine were analyzed with the assay kit from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). All assays were conducted following the instructions provided by Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Briefly, the intestine (0.1 g) was weighed and placed in a 2 mL centrifuge tube, followed by the addition of 0.9 mL of pre-cooled physiological saline to create a homogenate. The resulting mixture was then centrifuged at 1013 × g for 10 min, and the supernatant was collected for further analysis. The methods and kits used are shown in Table S2.

2.8. Gene expression analysis

Intestinal RNA was isolated using the RNAiso Plus kit (TaKaRa, Dalian, China). We examined RNA concentration and quality using 1% agarose gel electrophoresis as well as nucleic acid detection. cDNA was synthesized using a reverse transcription kit (TaKaRa, Dalian, China). The mRNA levels were normalized using β-actin as an internal reference gene. The quantitative gene expression was analyzed using the 2^−ΔΔCt method (Livak and Schmittgen, 2001). Primers were synthesized based on the primer sequences provided by Zhao et al. (2022), Yao et al. (2023), and Zhang et al. (2024). Primer sequences are provided in Table 2.

Table 2.

Primer sequences for gene expression analysis of juvenile grass carp (Ctenopharyngodon idella).

Item	Primer sequence forward (5′-3′)	Primer sequence reverse (5′-3′)	Accession number
CuZnSod	CGCACTTCAACCCТTACA	ACTTTCCTCATTGCCTCC	GU901214
Gpx1a	GGGCTGGTTATTCTGGGC	AGGCGATGTCATTCCTGTTC	EU828796
Gpx1b	TTTTGTCCTTGAAGTATGTCCGTC	GGGTCGTTCATAAAGGGCATT	KT757315
Gpx4a	TACGCTGAGAGAGGTTTACACAT	CTTTTCCATTGGGTTGTTCC	KU255598
Gpx4b	CTGGAGAAATACAGGGGTTACG	CTCCTGCTTTCCGAACTGGT	KU255599
Nrf2	CTGGACGAGGAGACTGGA	ATCTGTGGTAGGTGGAAC	KF733814
Keap1a	TTCCACGCCCTCCTCAA	TGTACCCTCCCGCTATG	KF811013
Keap1b	TCTGCTGTATGCGGTGGGC	CTCCTCCATTCATCTTTCTCG	KJ729125
Tnf-a	CGCTGCTGTCTGCTTCAC	CCTGGTCCTGGTTCACTC	HQ696609
Tnfr-1	AGAACCGCACAGCCAGACAG	GACAGACTGGTTTGGGAAGAGC	KX094934.1
Caspase-3	GCTGTGCTTCATTTGTTTG	TCTGAGATGTTATGGCTGTC	JQ793789
Caspase-8	ATCTGGTTGAAATCCGTGAA	TCCATCTGATGCCCATACAC	KM016991
Caspase-9	CTGTGGCGGAGGTGAGAA	GTGCTGGAGGACATGGGAAT	JQ793787
Apaf-1	AAGTTCTGGAGCCTGGACAC	AACTCAAGACCCCACAGCAC	KM279717
Iap	CACAATCCTGGTATGCGTCG	GGGTAATGCCTCTGGTGCTC	FJ593503.1
Bcl-2	AGGAAAATGGAGGTTGGGAT	CTGAGCAAAAAAGGCGATG	JQ713862.1
Mcl-1	TGGAAAGTCTCGTGGTAAAGCA	ATCGCTGAAGATTTCTGTTGCC	KT757307
Bax	CATCTATGAGCGGGTTCGTC	TTTATGGCTGGGGTCACACA	JQ793788.1
Fas-L	AGGAAATGCCCGCACAAATG	AACCGCTTTCATTGACCTGGAG	KT445873
P38Mapk	TGGGAGCAGACCTCAACAAT	TACCATCGGGTGGCAACATA	KM112098
Jnk	ACAGCGTAGATGTGGGTGATT	GCTCAAGGTTGTGGTCATACG	KT757312
ZO-1	CGGTGTCTTCGTAGTCGG	CAGTTGGTTTGGGTTTCAG	KJ000055
Occludin	TATCTGTATCACTACTGCGTCG	CATTCACCCAATCCTCCA	KF193855
Claudin-7a	ACCACTTGCGGAGCCGATGA	ACCACGAGCAGGCGACAACT	KT625604
Claudin-7b	CTAACTGTGGTGGTGATGAC	AACAATGCTACAAAGGGCTG	KT445866
Claudin-c	GAGGGAATCTGGATGAGC	CTGTTATGAAAGCGGCAC	KF193859
Claudin-11	GGTTTGTGGGCAGACTGTGTGA	CGCTACAGCAGGCAATCCAAGA	KT445867
Claudin-15a	TGCTTTATTTCTTGGCTTTC	CTCGTACAGGGTTGAGGTG	KF193857
Claudin-15b	AGTGTTCTAAGATAGGAGGGGAG	AGCCCTTCTCCGATTTCAT	KT757304
Nectin	GCCAGTGACCAAGATGAC	ACAGTGCCATTCGGATTG	MN661350
Afadin	CCTGTGCTCACACTACTG	GTCGTTGCCTGGACTATG	MN661352
a-Catenin	GCAATCTTCTCTCCTTTATCC	ACTTGTGAACTCCAGCAAT	HQ338751
β-Catenin	GTCTGCTTGCCATCTTCA	CAGGTTGTGTAGAGTCGTAA	MN661349
E-Cadherin	GACTGTAACGCTGAAGAGA	CTGTGGAGAGGAGATGTTC	MN661354
Mlck	CCAGGAGGTCAGTCTGCTGTGT	ACTGCTGCTGTCTGTGCCTACT	KM279719
Rhoa	GCAGGACAAGAGGACTATG	GTGTTCATCATTCCGTAGGT	MN661351
Rock	AGTCCAAGTCTGCTGCTA	ССТСТCCТТCТGCTТCAТC	KY780630
NmⅡ	AGCCAACTCGTCAATGTC	CCTTGGAATACTTCTCTGTCT	MN661353
β-Actin	GGCTGTGCTGTCCCTGTA	GGGCATAACCCTCGTAGAT	M25013

2.9. Western blotting analysis

Based on previous laboratory studies, intestinal proteins were extracted and determined (Jiang et al., 2015). The BCA assay kit (Beyotime Biotechnology Inc., Shanghai, China) was used to determine the concentration of protein homogenate in the samples. Target proteins were fractionated via sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Subsequently, a wet transfer system was used to transfer proteins to polyvinylidene fluoride membranes, which were then blocked for 1.5 h. At 4 °C, primary antibodies were incubated overnight. After this, at room temperature, a second antibody was then incubated. The protein bands were detected with the ECL assay kit (Beyotime Biotechnology Inc., Shanghai, China). Exposure imaging was performed using the Bio-Rad high-sensitivity chemiluminescence imaging system (Bio-Rad Laboratories, Munich, Germany). An internal reference was provided by β-actin. Protein bands were analyzed using Image J.

2.10. Immunofluorescence assay

After being fixed in 4% paraformaldehyde and dehydrated in alcohol, the intestines were sequentially embedded in paraffin. Each group contained 3 samples. Subsequently, the samples were sectioned into 5 μm slices. The subsequent steps included deparaffinization and rehydration using xylene and graded alcohol. Endogenous peroxidases were inactivated with 3% H₂O₂. Incubations with primary antibodies, including cleaved-caspase-8, cleaved-caspase-3, ZO-1, and occludin, were conducted overnight at 4 °C after being blocked using 5% bovine serum albumin (Beyotime Biotechnology Inc., Shanghai, China). Fluorescent secondary antibodies (Beyotime Biotechnology Inc., Shanghai, China) were incubated at room temperature, followed by 4′,6-diamidino-2-phenylindole (DAPI) incubation. After phosphate-buffered saline washing, samples were sealed with an anti-fluorescence quencher (Beyotime Biotechnology Inc., Shanghai, China). Finally, the fluorescence intensity of target proteins was observed and captured under an inverted fluorescence microscope (Laika, DMI4000B, Wetzlar, Germany). The fluorescence intensity was analyzed using Image J.

2.11. Statistical analysis

After conducting normal distribution and homogeneity of variance tests, the ANOVA analysis was performed on the data with SPSS 27.0 software using Duncan's multiple range test. Simultaneously, linear and quadratic trend analyses were conducted on the data. Statistical significant differences were defined as P < 0.05. The mathematical model for one-way ANOVA is expressed as:

$$Yij=\mu +\alpha i+ϵij\text{,}$$

where Yij is the j-th observation in the i-th group; μ is the overall mean of all observations; αi is the main effect of the i-th level (group mean minus overall mean); ϵij is the random error associated with the j-th observation in the i-th group, representing the influence of other random factors beyond the independent variable on the dependent variable.

3. Results

3.1. Growth performance

When dietary FB1 levels exceeded 3.94 mg/kg, the final body weight (FBW), PWG, FI, and body length (BL) were decreased (P < 0.05) (Table 3). The FE and ILI were significantly reduced only in the 8.05 mg/kg group (P < 0.05) (Table 3). There was no significant difference in ISI between different treatment groups (P > 0.05).

Table 3.

Growth performance of juvenile grass carp (Ctenopharyngodon idella) fed diets containing different levels of fumonisin B1.

Item	Dietary FB1 levels, mg/kg				SEM	P-value
	0	2.06	3.94	8.05		ANOVA	Linear	Quadratic
IBW1, g/fish	10.93	10.91	10.91	10.93	0.005	0.401	0.831	0.108
FBW1, g/fish	109.18a	106.89a	94.20b	79.36c	3.787	<0.001	<0.001	0.061
PWG1, %	898.60a	879.84a	763.34b	626.30c	34.679	<0.001	<0.001	0.055
FI1, g/fish	69.69a	67.82b	62.61c	58.80d	1.523	<0.001	<0.001	<0.001
FE1, %	1.41a	1.42a	1.33ab	1.20b	0.032	0.033	0.008	0.184
BL2, cm	18.33a	18.10a	17.33b	17.00b	0.137	<0.001	<0.001	0.758
ILI2, %	169.83a	173.71a	176.91a	155.78b	2.583	0.009	0.057	0.006
ISI2, %	2.54	2.39	2.44	2.43	0.045	0.726	0.528	0.464

FB1 = fumonisin B1; IBW = initial body weight; FBW = final body weight; PWG = percent weight gain; FI = feed intake; FE = feed efficiency; BL = body length; ILI = intestinal length index; ISI = intestinal somatic index.

Mean values within the same row with different superscript letters indicated significant differences (P < 0.05).

¹A total of 60 samples/replicate.

²A total of 18 samples/group.

3.2. Intestinal tissue structure

The intestinal tissue structure of the 0 and 2.06 mg/kg group was normal (Fig. 1A and B). However, with increasing levels of dietary FB1, there was necrosis and shedding of epithelial cells at the tips of intestinal villi (Fig. 1C and D). Additionally, in the 8.05 mg/kg group, the intestinal villi were partially fused, and the mucosal layer was infiltrated by inflammatory cells (Fig. 1D).

Fig. 1.

Intestinal tissue structure in the juvenile grass carp (Ctenopharyngodon idella) fed diets containing different levels of fumonisin B1: hematoxylin and eosin staining. Scale bar = 100 μm (×400). (A) Fumonisin B1-0 mg/kg group. (B) Fumonisin B1-2.06 mg/kg group. (C) Fumonisin B1-3.94 mg/kg group. (D) Fumonisin B1-8.05 mg/kg group. There were 3 samples in each group. Epithelial cell necrosis (indicated by arrows). Infiltration of inflammatory cells (∗).

3.3. FB1 residues in the intestine

FB1 residues were not detected in the 0 mg/kg group and low-dose group (2.06 mg/kg) (Table 4). However, with an increase in dietary FB1 levels, there was a corresponding increase in intestinal FB1 residual levels (P < 0.001). Specifically, the residual levels of FB1 in the 3.94 mg/kg group and the 8.05 mg/kg group were 39.75 and 53.62 μg/kg tissue, respectively (Table 4).

Table 4.

Levels of intestinal FB1 residual, Sa, and So and serum D-LA in the juvenile grass carp (Ctenopharyngodon idella) fed diets containing different levels of fumonisin B1.

Item	Dietary FB1 levels, mg/kg				SEM	P-value
	0	2.06	3.94	8.05		ANOVA	Linear	Quadratic
FB1 residual1, μg/kg tissue	-2	-2	39.75b	53.62a	4.338	<0.001	<0.001	0.098
Sa3, nmol/g tissue	3.95c	3.92c	5.28b	7.31a	0.307	<0.001	<0.001	<0.001
So3, nmol/g tissue	10.67b	10.52b	11.60a	12.03a	0.161	<0.001	<0.001	0.159
Sa/So	0.37c	0.37c	0.42b	0.61a	0.021	<0.001	<0.001	<0.001
Serum D-LA level4, μmol/L	44.40c	44.29c	63.34b	99.87a	4.934	<0.001	<0.001	<0.001

FB1 = fumonisin B1; Sa = sphinganine; So = sphingosine; D-LA = D-lactic acid.

Mean values within the same row with different superscript letters indicated significant differences (P < 0.05).

¹There were 6 samples in each group.

²Not detected.

³There were 6 samples in each group.

⁴There were 6 samples in each group.

3.4. Sa and So levels in the intestine

There were no significant differences in the Sa and So levels and Sa/So ratios in the intestine between the 0 mg/kg group and the 2.06 mg/kg group (P > 0.05) (Table 4). However, as the level of FB1 exceeded 3.94 mg/kg, the levels of Sa and So and Sa/So ratio significantly increased (P < 0.05) (Table 4).

3.5. Serum D-LA level

The serum D-LA level increased linearly with increasing levels of dietary FB1 (P < 0.001). Specifically, diets containing 3.94 and 8.05 mg/kg FB1 significantly increased the levels of serum D-LA (P < 0.001) (Table 4).

3.6. Activities of digestion enzymes and brush border enzymes

In the hepatopancreas, as the levels of dietary FB1 exceeded 3.94 mg/kg, the activities of chymotrypsin, trypsin, lipase, and amylase decreased significantly (P < 0.05) (Table 5). In the intestine, digestive enzymes (including chymotrypsin, trypsin, and lipase) were decreased by 3.94 and 8.05 mg/kg FB1 in the diets (P < 0.05) (Table 5). The activity of amylase in the intestine was significantly reduced in the 8.05 mg/kg group (P < 0.001) (Table 5). Diet with FB1 (from 3.94 to 8.05 mg/kg) significantly reduced the AKP activity and CK activity (P < 0.05) (Table 5). When the FB1 level reached 8.05 mg/kg, the NKP activity decreased significantly (P = 0.018) (Table 5).

Table 5.

Activities of digestive enzymes and brush border enzymes in the juvenile grass carp (Ctenopharyngodon idella) fed diets containing different levels of fumonisin B1.

Item	Dietary FB1 levels, mg/kg				SEM	P-value
	0	2.06	3.94	8.05		ANOVA	Linear	Quadratic
Hepatopancreas
Chymotrypsin, U/g tissue	73.02a	74.36a	39.32b	35.71b	3.846	<0.001	<0.001	0.327
Trypsin, U/mg protein	810.76a	736.67ab	716.74b	525.67c	25.827	<0.001	0.050	0.100
Lipase, U/g tissue	1625.56a	1328.88b	747.88c	587.179c	91.683	<0.001	0.019	0.010
Amylase, U/g tissue	932.99a	914.88a	763.79b	570.93c	31.495	<0.001	<0.001	0.277
Intestine
Chymotrypsin, U/g tissue	57.24a	56.70a	33.69b	19.87c	3.512	<0.001	0.004	0.011
Trypsin, U/mg protein	2173.38a	2237.31a	1904.95b	1228.54b	96.903	<0.001	0.009	0.913
Lipase, U/g tissue	686.51a	706.12a	284.41b	231.45b	47.876	<0.001	<0.001	0.140
Amylase, U/g tissue	471.79a	457.03a	475.90a	381.54b	9.521	<0.001	0.001	0.008
AKP, King unit/g tissue	43.38a	44.64a	29.49b	28.05b	1.656	<0.001	<0.001	<0.001
NKP, U/g tissue	63.97a	69.99a	63.97a	48.09b	2.694	0.018	0.078	0.917
CK, U/g tissue	70.06a	71.18a	41.01b	19.78c	12.396	<0.001	<0.001	<0.001

FB1 = fumonisin B1; AKP = alkaline phosphatase; NKP = Na⁺/K⁺-ATPase; CK = creatine kinase.

Mean values within the same row with different superscript letters indicated significant differences (P < 0.05). (n = 6).

3.7. Antioxidant capacity in the intestine of juvenile grass carp

Specifically, diets with 3.94 and 8.05 mg/kg FB1 increased intestinal ROS and MDA levels (P < 0.05) (Table 6). As dietary FB1 increased, intestinal GSH levels, T-AOC, GPx activity, and T-SOD activity decreased (P < 0.05). These indicators reached their lowest point when FB1 in the diet reached 8.05 mg/kg (Table 6).

Table 6.

Intestinal antioxidant-related indicators in the juvenile grass carp (Ctenopharyngodon idella) fed diets containing different levels of fumonisin B1.

Item	Dietary FB1 levels, mg/kg				SEM	P-value
	0	2.06	3.94	8.05		ANOVA	Linear	Quadratic
ROS, %	100.00c	102.43c	155.68b	202.19a	8.916	<0.001	<0.001	<0.001
MDA, nmol/mg prot	5.77b	5.50b	9.78a	10.05a	0.452	<0.001	<0.001	0.074
GPx, U/mg prot	104.39a	96.97a	96.74a	47.26b	5.376	<0.001	<0.001	0.001
GSH, μmol/mg prot	23.82a	24.10a	16.16b	10.86c	1.166	<0.001	<0.001	<0.001
T-SOD, U/mg prot	18.82a	19.21a	16.05b	12.94c	0.538	<0.001	<0.001	<0.001
T-AOC, U/g tissue	127.67a	129.38a	81.54b	51.14c	18.997	<0.001	<0.001	<0.001

FB1 = fumonisin B1; ROS = reactive oxygen species; MDA = malondialdehyde; GPx = glutathione peroxidase; GSH = glutathione; T-SOD = total superoxide dismutase; T-AOC = total antioxidant capacity.

Mean values within the same row with different superscript letters indicated significant differences (P < 0.05). (n = 6).

According to gene expression level detection results, dietary FB1 levels exceeding 2.06 mg/kg significantly reduced the CuZnSod expression (P < 0.001) (Table 7). Additionally, Gpx4b, Gpx1a, and Nrf2 expression levels were significantly reduced by diets containing 3.94 and 8.05 mg/kg FB1 (P < 0.05) (Table 7). Moreover, as the dietary FB1 level exceeded 3.94 mg/kg, there was an increase in the expression level of Keap1a (P < 0.001) (Table 7).

Table 7.

Gene expression of intestinal antioxidant-related molecules in the juvenile grass carp (Ctenopharyngodon idella) fed diets containing different levels of fumonisin B1.

Item	Dietary FB1 levels, mg/kg				SEM	P-value
	0	2.06	3.94	8.05		ANOVA	Linear	Quadratic
CuZnSod	1.00a	0.75b	0.78b	0.38c	0.058	<0.001	<0.001	0.309
Gpx4a	1.00	0.91	1.09	0.96	0.039	0.408	0.857	0.748
Gpx4b	1.00a	0.87a	0.62b	0.53b	0.047	<0.001	0.547	0.317
Gpx1b	1.00	0.90	1.01	0.94	0.051	0.869	0.713	0.422
Gpx1a	1.00a	0.98a	0.68b	0.32c	0.062	<0.001	0.004	0.309
Nrf2	1.00a	0.80ab	0.65bc	0.54c	0.049	0.001	<0.001	0.494
Keap1a	1.00c	0.79c	2.12b	3.02a	0.216	<0.001	<0.001	0.015
Keap1b	1.00	1.00	1.35	1.03	0.077	0.301	0.199	0.141

FB1 = fumonisin B1.

Mean values within the same row with different superscript letters indicated significant differences (P < 0.05). (n = 6).

3.8. Apoptosis in the intestine of juvenile grass carp

The FB1 (8.05 mg/kg) increased the protein levels and mRNA level of caspase-8 (P < 0.001) (Fig. 2A and B) (Table 8). In addition, as the levels of dietary FB1 increased, caspase-9 and caspase-3 protein levels and gene expression levels increased (P < 0.05) (Fig. 2A and B) (Table 8). Moreover, as the levels of dietary FB1 increased, there was an increase in intestinal Tnf-a, Tnfr-1, p38Mapk, Jnk, Bax, and Apaf-1 gene expression (P < 0.05) (Table 8). Conversely, the Mcl-1 and Bcl-2 gene expression downregulated (P < 0.05) (Table 8). Further, FB1 did not affect the Fas-L and Iap gene expression (P > 0.05) (Table 8). Cleaved-caspase-8 and cleaved-caspase-3 fluorescence intensities increased significantly when dietary FB1 levels exceeded 3.94 mg/kg (P < 0.05) (Fig. 2C and D).

Fig. 2.

Intestinal apoptosis-related parameters in the juvenile grass carp (Ctenopharyngodon idella) fed diets containing different levels of fumonisin B1. (A, B) Protein expression levels of caspase-8, caspase-9, and caspase-3. (C) Fluorescence intensity of cleaved-caspase-8. (D) Fluorescence intensity of cleaved-caspase-3. FB1 = fumonisin B1; DAPI = 4′,6-diamidino-2-phenylindole. Different letters indicated significant differences (P < 0.05). (n = 3).

Table 8.

Gene expression of intestinal apoptosis-related signaling molecules in the juvenile grass carp (Ctenopharyngodon idella) fed diets containing different levels of fumonisin B1.

Item	Dietary FB1 levels, mg/kg				SEM	P-value
	0	2.06	3.94	8.05		ANOVA	Linear	Quadratic
Bax	1.00b	1.17b	2.29a	2.28a	0.143	<0.001	<0.001	0.547
Mcl-1	1.00a	0.91a	0.84a	0.53b	0.046	<0.001	<0.001	0.073
Bcl-2	1.00a	0.88ab	0.77bc	0.62c	0.044	0.009	0.001	0.881
Iap	1.00	0.91	1.03	0.83	0.038	0.289	0.270	0.500
Apaf-1	1.00c	0.91c	1.95b	3.71a	0.254	<0.001	<0.001	<0.001
Caspase-9	1.00b	0.94b	1.99a	2.96a	0.193	<0.001	<0.001	0.011
Caspase-3	1.00c	0.86c	2.45b	4.73a	0.346	<0.001	<0.001	<0.001
Tnf-α	1.00b	1.02b	3.85a	3.04a	0.286	<0.001	<0.001	0.119
Tnfr-1	1.00b	0.85b	1.13b	2.14a	0.117	<0.001	<0.001	<0.001
Fas-L	1.00	0.95	1.01	0.83	0.041	0.404	0.234	0.404
Caspase-8	1.00b	0.95b	1.22b	2.91a	0.187	<0.001	<0.001	<0.001
p38Mapk	1.00b	0.85b	1.75a	2.75a	0.177	<0.001	<0.001	0.003
Jnk	1.00b	0.96b	1.98a	2.73a	0.170	<0.001	<0.001	0.020

FB1 = fumonisin B1.

Mean values within the same row with different superscript letters indicated significant differences (P < 0.05). (n = 6).

3.9. AJC-related parameters in the intestine of juvenile grass carp

With increasing levels of dietary FB1, ZO-1, occludin, claudin-7a, claudin-7a, and claudin-f gene expression significantly decreased, particularly in the 8.05 mg/kg group (P < 0.05) (Table 9). Additionally, the claudin-15a, claudin-15b, and claudin-12 gene expression increased significantly (P < 0.05) (Table 9). ZO-1 and occludin fluorescence intensity in the intestine of the 8.05 mg/kg group decreased significantly (P < 0.05) (Fig. 3C and D). Moreover, the analysis of adhesion junctions (AJs) proteins demonstrated that FB1 (from 2.06 to 8.05 mg/kg) in the diet caused a reduction in the α-catenin gene expression (P < 0.001) (Table 9). As the dietary FB1 concentration increased to 8.05 mg/kg, the gene expressions of nectin, afadin, and β-catenin also significantly decreased (P < 0.05) (Table 9). In addition, our results also showed that with the increase of dietary FB1 levels (especially in the 8.05 mg/kg group), the gene expression levels of Mlck, NmⅡ, Rhoa and Rock were increased in the intestine (P < 0.05) (Table 9). At the same time, the Mlck protein level also increased (P = 0.034) (Fig. 3A and B).

Table 9.

Gene expression of intestinal apical junction complex-related signaling molecules in the juvenile grass carp (Ctenopharyngodon idella) fed diets containing different levels of fumonisin B1.

Item	Dietary FB1 levels, mg/kg				SEM	P-value
	0	2.06	3.94	8.05		ANOVA	Linear	Quadratic
ZO-1	1.00a	0.77a	0.51b	0.48b	0.057	<0.001	<0.001	0.228
Occludin	1.00a	1.09a	0.50b	0.19c	0.081	<0.001	<0.001	0.003
Claudin-7a	1.00a	0.92a	0.76ab	0.48b	0.064	0.012	0.002	0.347
Claudin-7b	1.00a	0.90a	0.23b	0.30b	0.075	<0.001	<0.001	0.089
Claudin-f	1.00a	0.77ab	0.96a	0.51b	0.063	0.014	0.013	0.319
Claudin-c	1.00	0.92	1.16	0.95	0.043	0.209	0.791	0.466
Claudin-11	1.00	0.81	1.14	0.93	0.055	0.178	0.802	0.944
Claudin-12	1.00b	0.89b	1.27b	2.45a	0.144	<0.001	<0.001	<0.001
Claudin-15a	1.00c	0.86c	1.60b	2.76a	0.170	<0.001	<0.001	<0.001
Claudin-15b	1.00c	0.89c	1.72b	3.45a	0.233	<0.001	<0.001	<0.001
Nectin	1.00a	0.85a	1.01a	0.28b	0.071	<0.001	<0.001	0.001
Afadin	1.00a	0.88a	1.01a	0.53b	0.053	<0.001	0.001	0.024
α-Catenin	1.00a	0.80b	0.61c	0.24d	0.069	<0.001	<0.001	0.163
β-Catenin	1.00a	0.89a	1.10a	0.63b	0.053	0.003	0.019	0.036
E-Cadherin	1.00	0.87	1.12	0.94	0.045	0.260	0.884	0.772
Mlck	1.00b	0.85b	3.01a	4.61a	0.366	<0.001	<0.001	0.028
NmII	1.00b	1.03b	1.46ab	2.37a	0.157	<0.001	<0.001	0.048
Rhoa	1.00b	0.92b	2.53a	3.73a	0.270	<0.001	<0.001	0.021
Rock	1.00b	0.89	2.35a	2.91a	0.209	<0.001	<0.001	0.162

FB1 = fumonisin B1.

Mean values within the same row with different superscript letters indicated significant differences (P < 0.05). (n = 6).

Fig. 3.

Intestinal apical junction complex-related parameters in the juvenile grass carp (Ctenopharyngodon idella) fed diets containing different levels of fumonisin B1. (A, B) Protein expression levels of myosin light chain kinase. (C) Fluorescence intensity of ZO-1. (D) Fluorescence intensity of occludin. FB1 = fumonisin B1; DAPI = 4′,6-diamidino-2-phenylindole. Different letters indicated significant differences (P < 0.05). (n =3).

4. Discussion

FB1 is a common mycotoxin found in plant-based feed (Chen et al., 2021a, Chen et al., 2021b). It disrupts sphingolipid metabolism in the cell and negatively impacts the growth performance of fish (Chen et al., 2021a). The intestine is the organ responsible for the ingestion and absorption of nutrients in fish. However, the impact of FB1 on the intestines of fish has not been reported. To fill this gap, we conducted a study to investigate the effects of FB1 on the growth performance, digestion and absorption capacity, intestinal antioxidant capacity, intestinal apoptosis and intestinal AJC of juvenile grass carp.

4.1. FB1 reduced growth performance, digestion and absorption of juvenile grass carp

Previous studies have demonstrated that dietary FB1 can negatively impact the growth performance of aquatic animals such as Silver catfish (Baldissera et al., 2020), African catfish (Clarias gariepinus) (Gbore et al., 2010), and Pacific white shrimp (Kracizy et al., 2021). Similarly, our study also observed a decrease in the FBW, PWG, FI, FE, and BL of juvenile grass carp as the level of FB1 in the diet increased. The production performance during fish farming has a direct effect on economic benefits. The findings of this study indicated that to maximize the economic gains from grass carp farming, it is important to consider the detrimental effects of FB1 on the growth of grass carp. Animal feed intake is regulated by the gastrointestinal tract, where enteroendocrine cells are distributed (Cummings and Overduin, 2007). These cells secrete peptides and hormones to transmit signals to the vague nerve, enteric nerves, and spinal afferent nerves, ultimately reaching the brain and triggering feeding behavior (Cummings and Overduin, 2007; Monteiro and Batterham, 2017). In addition, enteroendocrine cells can also directly interact with neurons through synapse-like structures (Monteiro and Batterham, 2017). These cells can also sense the changes in intestinal microbiota and alterations in the intestinal lamina propria environment, which can subsequently influence their functions (Monteiro and Batterham, 2017). Studies have found that FUM induced a decrease in body weight and FI of broilers, which is accompanied by changes in the abundance of Firmicutes and Proteobacteria in the intestine (Paraskeuas et al., 2021; Yu et al., 2022). Based on these data, we speculated that the reduction in FI of juvenile grass carp due to dietary FB1 may be associated with alterations in the intestinal environment. In addition, we also found that the ILI of juvenile grass carp decreased when the level of FB1 in their diet reached 8.05 mg/kg. The decrease in intestinal length resulted in a smaller surface area for the absorption of nutrients, a shorter retention time of chyme in the intestine, and a lower rate of digestion and absorption of nutrients (Zandonà et al., 2015). Our results are consistent with another study that showed a decrease in the FBW, PWG, FI, and FE of grass carp with a shorter intestine (Li et al., 2020a). Based on the above data, it is hypothesized that the decrease in growth performance of juvenile grass carp due to dietary FB1 may be associated with alterations in the intestinal environment, reduced FI, and shortened intestinal length.

Protein and fat are crucial nutrients for promoting fish growth. The breakdown of these nutrients in the body requires the involvement of digestive enzymes, including chymotrypsin, trypsin, and lipases. FB1 reduced chymotrypsin, trypsin, and lipase activities in the hepatopancreas and intestine of juvenile grass carp. The protein digestibility of Nile Tilapia (Oreochromis niloticus) also decreased with lower chymotrypsin activity (Montoya-Mejía et al., 2017). Similarly, chickens showed decreased protein utilization with lower trypsin activity (Aderibigbe et al., 2020). Chymotrypsin and trypsin are synthesized and secreted by the pancreas. Patients with pancreatitis exhibit decreased chymotrypsin (Rosendahl et al., 2008) and trypsin (Lebenthal et al., 1976) activities. It is worth noting that dietary FB1 induced inflammatory infiltration in the hepatopancreas of juvenile grass carp in our separate study (data not yet published). These findings imply that the decreased chymotrypsin and trypsin activities in juvenile grass carp could be linked to the negative impacts of FB1 on the hepatopancreas. Lipase activity is influenced by bile salts (Gottlieb and Canbay, 2019). Bile-salt export pump (BSEP) is the key enzyme regulating bile salt secretion in the liver (Gottlieb and Canbay, 2019). The expression of BSEP is decreased in the liver with steatosis (Gottlieb and Canbay, 2019). The presence of 3.94 mg/kg of FB1 in the diet was found to induce hepatopancreatic steatosis in juvenile grass carp (data not yet published). These findings highlighted the importance of investigating the impact of FB1 on the hepatopancreas of juvenile grass carp in upcoming studies. Moreover, grass carp exhibit a higher capacity for carbohydrate utilization compared to other fish species (Cai et al., 2018). Amylase catalyzes the breakdown of carbohydrates into more readily absorbable forms. However, this study revealed that dietary FB1 decreased the amylase activity in the hepatopancreas and intestine. Another experiment has indicated that the decrease in growth performance of juvenile grass carp was accompanied by a decrease in amylase activity, which was consistent with the result of our study (Jiang et al., 2016). Therefore, our study data suggested that a decrease in digestive enzyme activity caused by FB1 may result in decreased nutrient digestion, ultimately leading to reduced growth performance of juvenile grass carp. These negative impacts may diminish the economic advantages of grass carp farming.

Digested nutrients are absorbed into the body through intestinal epithelial cells with the assistance of brush border enzymes such as AKP, NKP, and CK. AKP catalyzes the dephosphorylation of phospholipids, nucleotides, and basic amino acids, facilitating their absorption by intestinal epithelial cells (Santos et al., 2022). NKP regulates Na⁺ and K⁺ concentrations inside and outside intestinal epithelial cells to maintain the electrochemical gradient (Saha et al., 2015). CK regulates ATP levels to provide energy for intestinal epithelial cells to absorb nutrients (Brosnan and Brosnan, 2016). After juvenile grass carp ingested the diets containing FB1, there was a reduction in the activities of intestinal AKP, NKP, and CK. Consistent with previous studies, the reduction in growth performance observed in grass carp (Yao et al., 2023) and chicken (Wu et al., 2021) was correlated with a decrease in the activity of AKP and NKP. Therefore, we concluded that the decrease in growth performance of juvenile grass carp caused by FB1 may also be related to the decrease in the activities of AKP, NKP and CK. In combination, dietary FB1 may reduce the digestive and absorption capacity of juvenile grass carp, resulting in decreased growth performance.

4.2. FB1 disrupted the sphingolipid metabolism in the intestine of juvenile grass carp

The metabolites and intermediates (such as Sa, So and ceramide) in sphingolipids metabolism are essential for cell death, differentiation, proliferation, and inflammation (Hannun and Obeid, 2018). FB1 disrupts sphingolipid metabolism, resulting in the accumulation of Sa and So. Therefore, the levels of Sa, So, and the Sa/So ratio are important biological markers for assessing the toxicity of FB1 (Riley and Merrill, 2019). A study showed that dietary FB1 (5 mg/kg) improved the Sa levels, So levels and Sa/So ratio in the cecum and colon of mice (Li et al., 2020b). Similarly, FB1 (from 3.94 to 8.05 mg/kg) in diet also improved the Sa levels, So levels and Sa/So ratio in the intestine of juvenile grass carp. These results suggested that dietary FB1 disrupted the intestinal sphingolipid metabolism of juvenile grass carp. Sa and So inhibit the activity of mitochondrial respiratory chain complex Ⅳ, leading to an increase in ROS levels (Bobba et al., 2013; Novgorodov et al., 2014). These data prompted us to pay attention to the oxidative stress state of the intestine.

4.3. FB1 induced oxidative stress in the intestine of juvenile grass carp

Oxidative stress occurs when there is an overabundance of ROS like O₂⁻, H₂O₂, and ·OH, coupled with a lack of antioxidants. This study found that intestinal ROS levels increased when dietary FB1 levels surpassed 3.94 mg/kg. Previous experiment demonstrated that exposing Caco-2 cells to FB1 resulted in an increase in intracellular ROS levels over time (Chen et al., 2022). ROS play a crucial role in causing damage to intestinal epithelial cells when exposed to mycotoxins like deoxynivalenol (Adesso et al., 2017) and ochratoxin (Wang et al., 2017). Under normal physiological conditions, ROS are eliminated by the antioxidant defense system to uphold cellular redox balance. The SOD plays a crucial role as the initial defense mechanism against ROS by catalyzing the disproportionation reaction of O₂⁻ to produce H₂O₂ and oxygen (Wang et al., 2018). The GPx utilizes GSH as a reducing agent to convert H₂O₂ into H₂O (Pandey and Rizvi, 2010). However, FB1 in the diet reduced liver GSH levels in rats (Cao et al., 2022). Furthermore, our research revealed that higher dietary levels of FB1, particularly at 8.05 mg/kg, led to decreased GPx and T-SOD activities in the intestine of juvenile grass carp, along with reductions in GSH and T-AOC levels. Our results demonstrated that dietary FB1 not only increased intestinal ROS levels but also reduced intestinal antioxidant capacity, ultimately hindering the maintenance of redox balance. ROS play a role in the oxidation of polyunsaturated fatty acids within cell membranes, leading to the formation of lipid hydroperoxides (Cordiano et al., 2023). These hydroperoxides then degrade into different aldehydes, such as MDA, which is commonly utilized as a marker for oxidative stress (Cordiano et al., 2023). In this study, the accumulation of intestinal ROS of juvenile grass carp is accompanied by an increase in MDA levels. This result indicated that dietary FB1 induced oxidative stress in the intestine. Oxidative stress negatively impacts the maintenance of intestinal structural integrity.

The Nrf2/Keap1 signaling pathway plays a critical role in regulating cellular antioxidant responses. Keap1 acts as a negative regulator of Nrf2 by binding to it, leading Nrf2 to interact with the ubiquitin ligase complex and subsequently undergo degradation (Ngo and Duennwald, 2022). During oxidative stress, the structure of Keap1 changes, leading to the release of Nrf2 from the Keap1 complex. Subsequently, Nrf2 is translocated from the cytoplasm to the nucleus (Ngo and Duennwald, 2022). Upon entering the nucleus, Nrf2 combines with the antioxidant response element to activate the expression of antioxidant genes, including Sod and Gpx (Ngo and Duennwald, 2022). However, this study discovered that the intestinal Nrf2 gene expression in juvenile grass carp decreased as the level of FB1 in the diet increased, along with a decrease in the gene expression of CuZnSod, Gpx4b, and Gpx1a. Another study also demonstrated that FB1 induced hepatopancreas oxidative damage by downregulating the gene expression of Nrf2 in the hepatopancreas of common carp (Cyprinus carpio L.) (Kövesi et al., 2020). FB1 reduced the expression of intestinal antioxidant enzyme genes of juvenile grass carp, possibly due to the downregulation of Nrf2. Moreover, it is worth noting that chickens treated with dietary FUM for 39 d showed an up-regulation of Keapl gene expression in the intestine (Paraskeuas et al., 2021). Similarly, our study observed that FB1 treatment increased the Keap1a gene expression in the intestine. Moreover, the gene expression of Gpx1a and Keap1a were negatively correlated (Fig. 4A). These data suggested that FB1 disrupted the Nrf2/Keap1 signaling pathway, decreasing antioxidant enzyme gene expression. This may explain the mechanism of decreased intestinal antioxidant capacity of juvenile grass carp exposed to FB1.

Fig. 4.

Correlation analysis of parameters in the intestine of juvenile grass carp (Ctenopharyngodon idella) fed diets containing different levels of fumonisin B1. (A) Correlation analysis of antioxidant-related parameters. (B) Correlation analysis of apoptosis-related parameters. (C) Correlation analysis of apical junction complex-related parameters. T-SOD-a = total superoxide dismutase-activity; Gpx-a = glutathione peroxidase-activity; Caspase-3-P = caspase-3-protein expression level; Caspase-9-P = caspase-9-protein expression level; Caspase-8-P = caspase-8-protein expression level; Mlck-P = myosin light chain kinase-protein expression level. CuZnSod, Gpx, Nrf2, Keap1, Fas-L, Iap, Mcl-1, Bcl-2, Tnf-a, Bax, Tnfr-1, caspase-3, caspase-8, caspase-9, Jnk p38Mapk, Apaf-1, NmⅡ, Rock, Mlck, Rhoa, ZO-1, claudin-15a, claudin-15b, claudin-7b, occluding, claudin-7a, α-catenin, β-catenin, claudin-f, nectin, afadin, claudin-c, claudin-11, and E-cadherin represented the gene expression levels. Significantly correlation (∗).

4.4. FB1 exacerbated the apoptosis in the intestine of juvenile grass carp

Accumulation of ROS in cells initiates apoptosis through the intrinsic apoptosis pathway (Orrenius et al., 2007). In the intrinsic apoptosis pathway, Bax promotes an increase in mitochondrial permeability, ultimately causing cell apoptosis. Bcl-1 and Mcl-2 inhibit Bax, reducing mitochondrial permeability and apoptosis (Negi and Murphy, 2021). In the current study, FB1 in the diet (8.04 mg/kg) increased the Bax gene expression and decreased the Bcl-1 and Mcl-2 gene expression in the intestine of juvenile grass carp. The alteration described may lead to an increase in mitochondrial permeability, resulting in the release of cytochrome C. Subsequently, Apaf-1 interacts with cytochrome C to form an apoptosome, which then activates caspase-9. This activation initiates the cleavage of caspase-3, leading to the further cleavage of cellular nucleic acids and proteins, ultimately culminating in cell death (Araya et al., 2021). This study revealed that dietary FB1 led to an upregulation of intestinal Apaf-1 gene expression in juvenile grass carp. Moreover, the activation of caspase-3 was also increased. Previous experiments have also demonstrated that FB1 activated caspase-3 and caspase-9 in the porcine epithelial cells via the intrinsic apoptotic pathway (Wang et al., 2022). Therefore, our findings suggested that FB1 may exacerbate intestinal apoptosis in juvenile grass carp through the intrinsic apoptotic pathway.

In addition to being regulated by the intrinsic apoptosis pathway, apoptosis is also influenced by external signals such as Tnf-α and Fas-L (Ruiz et al., 2021). The elevated level of Tnf-α is considered an indicator of FB1 toxicity (Gao et al., 2023). Mice were exposed to FB1, and the gene expression of Tnf-α in the heart, lungs, and liver increased (He et al., 2002, He et al., 2005). The gene expression level of Tnf-α was also increased in porcine jejunal epithelial cell lines when exposed to FB1 (Li et al., 2022). Similarly, in our study, we observed that 8.05 mg/kg of dietary FB1 increased intestinal Tnf-α gene expression, which was accompanied by an upregulation of Tnfr-1 gene expression. Tnf-α binds to Tnfr-1, activating caspase-8 and triggering caspase-3 activation (Stennicke et al., 1998). As we expected, the study found that the protein expression of intestinal caspase-8 and cleaved-caspase-8 fluorescence intensity increased in juvenile grass carp when exposed to FB1 (8.05 mg/kg). These results indicated that FB1 may exacerbate intestinal apoptosis in juvenile grass carp through the exogenous apoptosis pathway.

In addition, this study also discovered a positive correlation between caspase-3 activation and Jnk and p38Mapk gene expression (Fig. 4B). Other studies have shown that the p38Mapk activation facilitates the activation of extrinsic and intrinsic apoptosis pathways in NCIH460 cells (Choi et al., 2015). Phosphorylation of Jnk initiates the intrinsic apoptosis pathway in kidney cells (Lei and Davis, 2003). In this study, juvenile grass carp were fed a diet contaminated with FB1, resulting in the activation of intestinal extrinsic and intrinsic apoptosis pathways. This activation was accompanied by a higher p38Mapk and Jnk gene expression. The data suggested that dietary FB1 exposure led to the activation of extrinsic and intrinsic apoptosis pathways through the upregulation of p38Mapk and Jnk. Taken together, FB1 increased intestinal apoptosis in juvenile grass carp by activating both intrinsic and extrinsic pathways. Excessive apoptosis is detrimental to the maintenance of the intestinal structure in juvenile grass carp.

4.5. FB1 damaged the AJC in the intestine of juvenile grass carp

The AJC of intestinal epithelial cells includes tight junctions (TJs) and AJs. Intestinal epithelial cells establish a barrier using AJC to regulate intestinal permeability and prevent the entry of harmful substances (Paradis et al., 2021). Intestinal epithelial cells contain TJs primarily composed of ZO-1, occludin, and claudin. Occludin and claudin are involved in forming TJs at the cell junctions, ultimately maintaining the integrity and permeability of the intestine (Paradis et al., 2021). The reduced gene expression of occludin and claudin-1 in IPEC-J2 cells have been linked to increased cell permeability (Chen et al., 2019). This study discovered that dietary FB1 decreased the intestinal occludin and barrier proteins (claudin-7a, claudin-7b, and claudin-f) gene expression, along with a reduction in the fluorescence intensity of occludin. TJ stability is facilitated by ZO-1, a cytoplasmic scaffolding protein that links transmembrane proteins (such as claudin and occludin) to the actin cytoskeleton. The absence of ZO-1 delayed the assembly of TJ in the epithelial cells, leading to compromised intestinal mucosal integrity and heightened intestinal permeability (Umeda et al., 2004; Kuo et al., 2021). These changes ultimately resulted in structural damage to intestinal tissue and elevated levels of the indicator of intestinal permeability, such as serum D-LA (Xu et al., 2018). There was a significant decrease in gene expression and fluorescence of the intestinal ZO-1 as the diet level of FB1 exceeded 3.94 mg/kg, accompanied by intestinal tissue damage and higher levels of serum D-LA. The above data demonstrated that dietary FB1 disrupted TJs and increased permeability in the intestines of juvenile grass carp. Furthermore, as the dietary FB1 level surpassed 8.05 mg/kg, there was an up-regulation in the gene expression of intestinal ion channel proteins (claudin-12, claudin-15a, and claudin-15b). Previous studies have indicated that elevated expression of claudin-12 and claudin-15 resulted in heightened intestinal permeability in juvenile grass carp (Liu et al., 2020; Yao et al., 2023). These results suggested that dietary FB1 could enhance intestinal permeability through the increase in ion channel permeability.

Cadherin and catenin form a complex that binds to the actin cytoskeleton to promote intercellular adhesion (Harris and Tepass, 2010). When α-catenin was depleted, the transportation of β-catenin to cell adhesion sites was diminished, causing a failure in the assembly of AJs (Lee et al., 2011). In our study, when dietary FB1 levels reached 8.05 mg/kg, the α-catenin and β-catenin gene expression decreased. The changes may impact the assembly of intestinal AJs in juvenile grass carp. In addition to the interaction between the nectin-afadin complex, actin also contributes to maintaining intercellular adhesion (Takai and Nakanishi, 2003; Chelakkot et al., 2018). As nectin and afadin levels were decreased in MDCK cells, AJs formation was inhibited (Sato et al., 2006). In this study, the dietary FB1 (8.05 mg/kg) significantly downregulated the gene expression of nectin and afadin. The above data indicated that FB1 in the diet disrupted the formation of the cadherin-catenin complex and nectin-afadin complex, leading to damage in the intestinal AJs of juvenile grass carp.

In intestinal epithelial cells, the AJC is regulated by RhoA/Rock, Mlck, and NmⅡ (Sahai and Marshall, 2002; Ivanov et al., 2007). In intestinal diseases, Mlck induces actin ring contraction and disrupts the AJC by promoting phosphorylation of myosin light chain-2 (Jin and Blikslager, 2020). The RhoA/Rock signaling pathway triggers the activation of NmⅡ, leading to the contraction of actin rings and subsequently enhancing cell permeability (Amerongen et al., 2000; Kreutzman et al., 2017). In this study, it was observed that RhoA, Mlck, and Rock gene expression was up-regulated when the FB1 level in the diet exceeded 3.94 mg/kg. Furthermore, the protein level of Mlck also showed an increase. Based on our data, we speculated that the upregulation of RhoA, Rock, NmII, and Mlck gene expression may be responsible for the increased intestinal permeability of juvenile grass carp caused by FB1. Taken together, our findings suggested that FB1 disrupts the intestinal AJC of juvenile grass carp, leading to a decrease in intestinal structural integrity and an increase in permeability.

Increased intestinal permeability may lead to the passage of endotoxins and bacteria from the intestine into the bloodstream (Albillos et al., 2020). A study by Mouries et al. (2019) demonstrated that as the intestinal permeability of mice increased, there was a corresponding rise in endotoxin levels in their serum, along with bacterial translocation into the liver. The intestine serves as the initial barrier for juvenile grass carp to interact with the external environment. The findings indicated that FB1 could potentially facilitate the passage of endotoxins and bacteria into the bloodstream by compromising the structural integrity of the intestine. The detrimental effects of FB1 on juvenile grass carp could potentially have severe repercussions on the grass carp, surpassing the biological toxicity of FB1 on the intestine. These severe repercussions include liver damage, inflammation, and increased susceptibility to bacterial diseases.

5. Conclusions

Our study found that dietary FB1 led to decreased growth performance in juvenile grass carp, possibly due to reduced digestion and absorption capacities, as well as damage to the integrity of the intestinal structure (Fig. 5). The integrity of the intestinal structure is compromised by dietary FB1, which induced intestinal oxidative stress by disrupting intestinal sphingolipid metabolism and the Nrf2/Keap1 signaling pathway in juvenile grass carp. Moreover, FB1 exacerbated intestinal apoptosis through both the intrinsic and extrinsic apoptotic pathways. Additionally, FB1 disrupted the integrity of the AJC by decreasing the expression of AJC-related molecules and increasing the gene expression of RhoA/Rock, Mlck, and NmII. This study emphasized the risks associated with dietary FB1 on intestinal integrity in juvenile grass carp. A compromised intestinal barrier could facilitate the invasion of bacteria, endotoxins, and harmful substances. However, relevant data was not examined in this study. Therefore, future studies should focus on investigating the potential harm of FB1 post-intestinal barrier damage.

Fig. 5.

Effects of dietary fumonisin B1 on growth, digestion and absorption function, integrity of the intestinal structure in juvenile grass carp. FB1 = fumonisin B1; Sa = sphinganine; So = sphingosine; SOD = superoxide dismutase; GSH = glutathione; GPx = glutathione peroxidase; ROS = reactive oxygen species; TJs = tight junctions; AJs = adhesion junctions; AJC = apical junction complex.

Credit Author Statement

Daiyu Chen: Writing – original draft, Methodology, Investigation. Weidan Jiang: Supervision, Methodology, Data curation. Pei Wu: Supervision, Methodology, Data curation. Yang Liu: Supervision, Methodology, Data curation. Hongmei Ren: Project administration. Xiaowan Jin: Project administration. Xiaoqiu Zhou: Supervision, Project administration, Methodology, Funding acquisition, Conceptualization. Lin Feng: Writing – review & editing, Project administration, Methodology, Funding acquisition, Conceptualization.

Declaration of competing interest

As we declare, we have no financial or personal relationships with other people or organizations that could negatively influence our work, and we have no personal or professional interests in any product, service, or organization.

Appendix A. Supplementary data

The following is the Supplementary data to this article: