Effect of photodynamic therapy with imipenem and gentamicin-derived carbon dots on the expression of quorum sensing and virulence genes in Pseudomonas aeruginosa

Abstract

Background

The capability of Pseudomonas aeruginosa to cause various severe infections is linked to the production of various virulence factors, regulated by quorum sensing. The objective of this study was to assess the effect of sub-lethal doses of antimicrobial photodynamic inactivation (sAPDI), employing carbon dots (CDs) derived from gentamicin and imipenem, on the expression of genes in two key quorum sensing systems (the rhl and las systems) and on the genes responsible for producing elastase (lasB), protease (lasA), rhamnolipid (rhlA), and pyocyanin (phzM) in P. aeruginosa.

Methods

CDsGEN-NH₂, and CDsIMP-NH₂ were synthesized from gentamicin and imipenem precursors through the hydrothermal method. The Conjugation of imipenem to CDsGEN-NH₂ (CDsGEN-IMP) and gentamicin to CDsIMP-NH₂ (CDsIMP-GEN) was done. The study evaluated the effect of sAPDI at sub-minimum biofilm inhibitory concentrations (sub-MBIC) of CDs, combined with a sub-lethal dose of UVA light, on the expression of QS and virulence encoding genes using real-time quantitative polymerase chain reaction (RT-qPCR).

Results

Following treatment with sAPDI, there was a notable decline in the expression levels of QS and virulence genes compared to the control (P < 0.05). Conversely, treatment with sub-MBIC concentrations of CDs and a sub-lethal dose of UVA light irradiation alone did not significantly alter the expression of these genes relative to the control group (P > 0.05).

Conclusion

The findings indicate that sAPDI, employing CDs sourced from imipenem and gentamicin combined with UVA light exposure, leads to a decrease in the expression of genes related to quorum sensing and virulence in P. aeruginosa.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12866-025-04083-4.

Introduction

Pseudomonas aeruginosa, an opportunistic bacterium, is responsible for various infections such as those affecting the urinary and respiratory tracts, skin, soft tissues, and bloodstream, along with numerous systemic infections, primarily in individuals with compromised immune systems and those receiving hospital care [1]. Research indicates that the process by which bacterial cells communicate, referred to as quorum sensing (QS), is crucial in controlling the gene expression for virulence factors in P. aeruginosa. This includes the production of biofilm, elastase, protease, exotoxin A, rhamnolipids, pyocyanin, and other virulence factors [2]. This microorganism possess two main QS systems, known as rhl and las, that rely on Acyl-homoserine-lactone, while a third system (Pqs) also plays a regulatory role in virulence, as highlighted in recent studies [3, 4]. The las system includes the transcription regulator lasR and the specific AHL signal N-(3-oxododecanoyl)-L-homoserine lactone (3-oxo-C12-HSL), produced by the AHL synthase LasI. In a similar vein, the rhl system features rhlR and its associated AHL, N-butyryl-L-homoserine lactone (C4-HSL), created by the RhlI AHL synthase [5, 6]. On the other hand, the cell wall of P. aeruginosa exhibits low permeability to antimicrobial agents, and possesses a significant genetic ability to acquire resistance to medications. The emergence of multidrug-resistant (MDR) strains presents a grave threat, occasionally leading to untreatable infections [7, 8].

Therefore, identifying novel strategies and discovering new antimicrobial substances are crucial steps in addressing the challenges associated with treating infections caused by P. aeruginosa. The scholars highlight the significance of exploring different treatment methods, including antimicrobial photodynamic inactivation (APDI), as a means to address P. aeruginosa infections, owing to its distinct action mechanism from traditional antibiotics. Studies indicate that the potential for bacteria to develop resistance to APDI is minimal, thereby presenting it as an effective alternative [9, 10]. APDI employs light with the appropriate wavelength to trigger a photosensitizer (PS) alongside oxygen, leading to the production of reactive oxygen species that result in cellular death through apoptosis or necrosis [11, 12]. Research is exploring carbon dots (CDs) as promising nanoparticles for their capacity to act as photosensitizers in combating pathogens [12–14]. CDs, recognized for their extensive optical abilities, possess unique characteristics that render them ideal as nanomaterials for photosensitization over a broad spectrum of light, encompassing UV-visible, Xe lamp, blue, and NIR light. Various carbon sources have been utilized for the production of CDs [15–19].

Few studies have explored the antibacterial properties of CDs derived from antibiotics [20–23]. When treating infections with APDI, applying sub-lethal doses of APDI (sAPDI) might not eliminate microorganisms but can significantly impact their virulence. Gentamicin and imipenem were selected due to their broad-spectrum antimicrobial activity against P. aeruginosa and their potential to provide unique photophysical and structural properties when utilized as precursors in the synthesis of carbon dots. This research aimed to investigate the impact of sAPDI using CDs sourced from gentamicin and imipenem on the gene expression within two quorum sensing operons (rhl and las systems) and virulence genes for elastase (lasB), protease (lasA), rhamnolipid (rhlA), and pyocyanin (phzM) in P. aeruginosa.

Materials and methods

Bacterial strain

The standard strain of P. aeruginosa ATCC 27,853 (purchased from the Institute Pasteur, Iran) was used in the study. This strain was selected due to its well-characterized genome, stable phenotype, and extensive use in quorum sensing and antimicrobial activity research, facilitating reproducibility and inter-study comparisons.

Photosensitizer and light source

In this research, the photosensitizers employed were CDs previously developed by Shiralizadeh et al. [21]. The synthesis and characterization of these CDs, along with UVA light source specifications, have been described in detail in a separate manuscript [21]. Through a hydrothermal process, CDs functionalized with amine groups were produced using gentamicin (CDsGEN-NH₂) and imipenem (CDsIMP-NH₂) as starting materials [24]. Following this, CDsGEN-NH₂ and CDsIMP-NH₂ underwent conjugation with imipenem and gentamicin, respectively, to form CDsGEN-IMP and CDsIMP-GEN [25]. The conjugation procedures of CDs with imipenem and gentamicin, including the reaction conditions and parameters, have been fully described in a separate manuscript currently under revision. Consistent with the methodologies of Shiralizadeh et al., the study utilized the TUV6 WE (Cathdeon, UK), a low-pressure mercury vapor lamp, which mainly emits UV light at a wavelength of 320 nm [21].

Determination of minimum biofilm inhibitory concentration (MBIC) and sub-MBIC of used photosynthesizers

Since the aim of this study was to evaluate the impact of sAPDI on quorum sensing and virulence gene expression, MBIC was determined instead of MIC, as the inhibition of biofilm formation is more directly relevant to these virulence mechanisms. Following the guidelines set by the Clinical and Laboratory Standards Institute (CLSI), the MBIC is defined as the lowest concentration of an antibacterial agent necessary to inhibit biofilm formation [26]. The sub-MBIC represents the maximum concentration of CDs at which the formation of bacterial biofilm is still observed in the wells of a microtiter plate. To assess the MBIC, a bacterial suspension with a density of 1.5 × 10⁶ CFU/mL, in a volume of 100 µL, was introduced into the wells of a microtiter plate. The initial bacterial density was adjusted by spectrophotometric measurement at 625 nm (OD₆₂₅ = 0.08), corresponding approximately to 0.5 McFarland standard. The suspension was then diluted in PBS to obtain the required final concentrations. Then, 100 µL of various concentrations of CDsGEN-NH₂, CDsIMP-NH₂, and CDsGEN-IMP (resulting in final concentrations of 48, 24, 12, 6, 3, 1.5, 0.75, and 0.37 mg/mL) were added. For CDsIMP-GEN, 100 µL of CDs at different concentrations were added, achieving final concentrations of 4, 2, 1, 0.5, 0.25, 0.12, 0.06, and 0.03 mg/mL. These plates were incubated at 37 °C for 24 h. After incubation, the wells were washed three times with 200 µL of sterile PBS to remove non-adherent cells and excess compounds. The subsequent steps, including fixation, staining with 0.1% crystal violet, and solubilization of bound dye, were conducted according to the methodologies described in a previous study, which are standard procedures for quantifying biofilm biomass [27].

Establishing the sub-lethal exposure time for UVA light irradiation

The sub-lethal exposure duration to UVA light for P. aeruginosa was assessed based on prior research [28]. Specifically, 200 µL of a P. aeruginosa culture with a concentration of 1.5 × 10⁵ CFU/mL underwent UVA irradiation at 320 nm for varying times (10, 20, 30, 40, 50, and 60 s at energy levels of 3.12, 6.25, 9.37, 12.5, 15.62, and 18.75 J/cm², respectively). A control group was maintained under identical conditions but was not exposed to UVA irradiation. Following the irradiation process, the samples were incubated at 37 °C for 24 h, and CFU/mL counts were conducted using the Miles and Misra method, which involves spotting 10 µL of serially diluted bacterial suspension onto agar plates, followed by incubation and colony counting [29]. The bacterial density was initially adjusted by spectrophotometric measurement at 625 nm (OD₆₂₅ = 0.08), corresponding approximately to 0.5 McFarland standard, and then diluted to 1.5 × 10⁵ CFU/mL prior to UVA exposure.

Determining gene expression levels through quantitative real-time PCR (qRT-PCR)

The study aimed to assess the impact of sAPDI (sub-MBIC levels of CDsGEN-NH₂, CDsIMP-NH₂, CDsGEN-IMP, and CDsIMP-GEN combined with a sub-lethal dose of UVA light exposure) on the gene expression related to quorum sensing (lasI, lasR, rhlI, and rhlR) and virulence factors (lasB, lasA, rhlA, and phzM) in P. aeruginosa ATCC 27,853. Total RNA was extracted from bacterial pellets using 1 mL of ice-cold RNX-Plus reagent (SinaClon, Iran), followed by vortexing for 5–10 s and a 5 min incubation at room temperature. Subsequently, 200 µL of chloroform was added, and the mixture was gently shaken, incubated on ice for 5 min, and centrifuged at 12,000 rpm at 4 °C for 15 min. The upper aqueous phase was transferred to a new RNase-free microtube and mixed with an equal volume of isopropanol. After incubation on ice for 15 min, the mixture was centrifuged again under the same conditions. The RNA pellet was washed with 1 mL of 75% ethanol and centrifuged at 7,500 rpm at 4 °C for 8 min. Finally, the supernatant was discarded, and the pellet was briefly air-dried before being dissolved in 50 µL of DEPC-treated water with incubation at 55–60 °C for 10 min. Total RNA was extracted from four groups: sAPDI-treated, treated with CDs only, treated with light only, and a control group, using RNX-Plus solution. The control group received no treatment and was kept under the same incubation conditions without exposure to CDs or UVA light. cDNA synthesis was performed using 1 µg of RNA template in a 20 µL reaction mixture composed of 10 µL Buffer Mix, 2 µL Enzyme Mix, and DEPC-treated water, according to the manufacturer’s instructions (Parstous Co, Iran). The thermal protocol involved incubation at 25 °C for 10 min (primer annealing), 47 °C for 60 min (reverse transcription), and 85 °C for 5 min (enzyme inactivation), followed by holding at 4 °C. The primers utilized are listed in Table 1. RT-PCR analysis was conducted on a LightCycler 96 system (Roche, Germany) employing RealQ Plus 2x Master Mix Green Without ROX (Ampliqon, Denmark), with the cycle conditions set to an initial denaturation at 95 °C for 15 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 20 s, and extension at 72 °C for 20 s. The analysis of relative gene expression for quorum sensing and virulence-related genes was done using the 2^−ΔΔCt method, with rpoD serving as the internal standard for normalization [30]. The rpoD gene, encoding the sigma-70 (σ⁷⁰) factor of RNA polymerase, was selected as the internal reference due to its stable and constitutive expression in P. aeruginosa under various conditions, as reported previously [31].

Table 1.

Sequence of primers

Genes	Sequence (5′−3′)	Amplicon size	References
lasB	F GGTAGAACGCACGGTTGT R GGCAAGAACGACTTCCTGAT	165	[32]
lasA	F: TGCATTTCTCGCTGCTCTAC R: GCGACAGTCGTTGTCGTAG	107	[33]
rhlA	F GGCGATCGGCCATCT R AGCGAAGCCATGTGC	87	[34]
phzM	F AGACTTCTACAGCTACCTGAAGC R GATGGCCTTGGTCAATTCGC	166	[34]
lasR	F AGCGACCTTGGATTCTCGAAG R CGAAGAACTCGTGCTGCTTT	226	[35]
lasI	F: GGCTGGGACGTTAGTGTCAT R: AAAACCTGGGCTTCAGGAGT	104	[36]
rhlR	F CATCCGATGCTGATGTCCAACC R ATGATGGCGATTTCCCCGGA	101	[36]
rhlI	F AAGGACGTCTTCGCCTACCT R GCAGGCTGGACCAGAATATC	130	[36]
rpoD	F GGGCGAAGAAGGAAATGGTC R CAGGTGGCGTAGGTGGAGAA	178	[37]

Statistical analysis

Experiments were conducted in three replicates, with outcomes shown as means ± standard error of the mean (SEM). Statistical analyses were performed using GraphPad Prism version 9 (GraphPad Software, San Diego, CA, USA). The comparison of mean values among groups was carried out using two-way ANOVA and Dunnett’s test. A P < 0.05 was considered statistically significant.

Results

Characterization of synthesized CDs

The successful synthesis of CDsGEN-NH₂, CDsIMP-NH₂, CDsGEN-IMP, and CDsIMP-GEN was confirmed in a previous study [21]. Characterization techniques, including ultraviolet–visible (UV–Vis) and fluorescence spectroscopy, Fourier-transform infrared spectroscopy (FTIR), and transmission electron microscopy (TEM), provided detailed information on their optical properties, surface functional groups, and morphology. The results are reported in detail in that manuscript [21].

Determination of sub-MBIC of CDs, and determination of sub-lethal dose of UVA light irradiation time

This research aimed to assess the effects of sAPDI by using CDs derived from imipenem and gentamicin on the regulation of gene expression in two QS operons (rhl and las systems), as well as on the genes responsible for virulence such as elastase (lasB), protease (lasA), rhamnolipid (rhlA), and pyocyanin (phzM), which are influenced by quorum sensing within P. aeruginosa ATCC 27,853. To accomplish this, the study utilized the sub-MBIC values for CDsGEN-NH₂, CDsIMP-NH₂, CDsGEN-IMP, and CDsIMP-GEN, along with the sub-lethal dose of UVA light irradiation time on P. aeruginosa ATCC 27,853, building on the research previously conducted by Shiralizadeh et al. [20]. The MBIC for CDsGEN-NH₂, CDsIMP-NH₂, and CDsGEN-IMP in relation to the P. aeruginosa ATCC 27,853 was found to be 12, 24, and 24 mg/mL, respectively. Furthermore, the sub-MBIC for these entities against the P. aeruginosa ATCC 27,853 registered at 6, 12, and 12 mg/mL, respectively. For CDsIMP-GEN, the MBIC and sub-MBIC were recorded at 2 and 1 mg/mL, respectively, against the P. aeruginosa ATCC 27,853. Additionally, the sub-lethal dose of UVA light irradiation time for P. aeruginosa ATCC 27,853 was established at 40 s, equivalent to 12.5 J/cm² [20].

The expression of the biofilm and QS-related genes

RT-PCR analysis of P. aeruginosa ATCC 27,853 revealed a significant reduction in the expression of quorum sensing and virulence-related genes in samples treated with sAPDI, compared to the control group (without UVA or CDs exposure). As shown in Figs. 1 and 2, treatment with sAPDI at sub-MBIC levels of CDsGEN-NH₂, CDsIMP-NH₂, CDsIMP-GEN, and CDsGEN-IMP, combined with a sub-lethal UVA dose (40 s, 12.5 J/cm²), led to a marked decline in the expression of rhlR, rhlI, lasR, lasI, lasB, lasA, rhlA, and phzM. Further quantitative analysis confirmed statistically significant reductions in all investigated genes following sAPDI exposure, as indicated by both fold change and percentage reduction values (Tables 2 and 3). For instance, lasR and rhlI exhibited expression reductions of 98.9% and 92.1%, respectively, after sAPDI-CDsGEN-IMP treatment. Likewise, virulence genes such as lasB and phzM were suppressed by 99.7% and 100%, with corresponding fold change values of 0.0034 and 0.0004. In contrast, although some downregulation was observed in other treatment groups (e.g., UVA or CDs alone), these changes were generally not statistically significant; the corresponding data are presented in Supplementary Tables 4 and 5. These findings underscore the enhanced inhibitory efficacy of sAPDI compared to either UVA or CDs alone. These results suggest that sAPDI treatment, rather than either component alone (UVA or CDs), is required for the effective suppression of quorum sensing and virulence gene expression in P. aeruginosa.

Fig. 1.

The expression levels of the quorum sensing genes in P. aeruginosa ATCC 27,853. The expression levels of the quorum sensing genes in P. aeruginosa ATCC 27,853 treated with sAPDI-CDsGEN-NH₂, sAPDI-CDsIMP-NH₂, sAPDI-CDsGEN-IMP, and sAPDI-CDsIMP-GEN using sub-MBIC of CDs alongside a sub-lethal dose of UVA light irradiation time, sub-MBIC from CDsGEN-NH₂, CDsIMP-NH₂, CDsIMP-GEN, CDsGEN-IMP, and sub-lethal doses of UVA light irradiation alone. The expression of (a) rhlI, brhlR, clasI, dlasR. The data are presented as mean ± SEM, with significance levels indicated by * P < 0.05, ** P < 0.01, and *** P < 0.001 compared to the control group (without UVA or CDs exposure)

Fig. 2.

The expression levels of the virulence-related genes in P. aeruginosa ATCC 27,853. The expression levels of the virulence-related genes in P. aeruginosa ATCC 27,853 treated with sAPDI-CDsGEN-NH₂, sAPDI-CDsIMP-NH₂, sAPDI-CDsGEN-IMP, and sAPDI-CDsIMP-GEN using sub-MBIC of CDs alongside a sub-lethal dose of UVA light irradiation time, sub-MBIC from CDsGEN-NH₂, CDsIMP-NH₂, CDsIMP-GEN, CDsGEN-IMP, and sub-lethal doses of UVA light irradiation alone. The expression of (a) lasB, blasA, crhlA, dphzM. The data are presented as mean ± SEM, with significance levels indicated by * P < 0.05, ** P < 0.01, and *** P < 0.001 compared to the control group (without UVA or CDs exposure)

Table 2.

Relative expression levels of quorum sensing genes in P. aeruginosa under sAPDI treatments

Gene	Treatment vs. Control	Fold Change	Reduction (%)a	Significance
rhl I	sAPDI-CDsGEN-NH2 vs. Control	0.0003	99.9725	*
rhl I	sAPDI-CDsIMP-NH2 vs. Control	0.0075	99.2506	*
rhl I	sAPDI-CDsIMP-GEN vs. Control	0.0	99.9977	**
rhl I	sAPDI-CDsGEN-IMP vs. Control	0.0011	99.8857	*
rhl R	sAPDI-CDsGEN-NH2 vs. Control	0.0001	99.9867	***
rhl R	sAPDI-CDsIMP-NH2 vs. Control	0.0216	97.8403	***
rhl R	sAPDI-CDsIMP-GEN vs. Control	0.0	99.9964	***
rhl R	sAPDI-CDsGEN-IMP vs. Control	0.0004	99.963	*
las I	sAPDI-CDsGEN-NH2 vs. Control	0.0071	99.2876	***
las I	sAPDI-CDsIMP-NH2 vs. Control	0.0366	96.3425	**
las I	sAPDI-CDsIMP-GEN vs. Control	0.0029	99.7146	***
las I	sAPDI-CDsGEN-IMP vs. Control	0.0188	98.1198	***
las R	sAPDI-CDsGEN-NH2 vs. Control	0.0003	99.9655	**
las R	sAPDI-CDsIMP-NH2 vs. Control	0.0043	99.5696	*
las R	sAPDI-CDsIMP-GEN vs. Control	0.0	99.9977	**
las R	sAPDI-CDsGEN-IMP vs. Control	0.0004	99.9578	**

sAPDI sub-lethal doses of APDI

^a Reduction (%) = (1 − Fold Change) × 100

Significance levels: ^*P < 0.05, ^**P < 0.01, ^***P < 0.001 vs. control group (without UVA or CDs exposure)

Table 3.

Relative expression levels of virulence-related genes in P. aeruginosa under sAPDI treatments

Gene	Treatment vs. Control	Fold Change	Reduction (%)	Significance
las B	sAPDI-CDsGEN-NH2 vs. Control	0.0002	99.9838	**
las B	sAPDI-CDsIMP-NH2 vs. Control	0.0006	99.9365	**
las B	sAPDI-CDsIMP-GEN vs. Control	0.0	99.9987	***
las B	sAPDI-CDsGEN-IMP vs. Control	0.0034	99.6569	**
phz M	sAPDI-CDsGEN-NH2 vs. Control	0.0004	99.9643	***
phz M	sAPDI-CDsIMP-NH2 vs. Control	0.0023	99.7698	**
phz M	sAPDI-CDsIMP-GEN vs. Control	0.0	99.9971	**
phz M	sAPDI-CDsGEN-IMP vs. Control	0.0013	99.8684	*
las A	sAPDI-CDsGEN-NH2 vs. Control	0.0015	99.8547	**
las A	sAPDI-CDsIMP-NH2 vs. Control	0.0118	98.8158	*
las A	sAPDI-CDsIMP-GEN vs. Control	0.0	99.996	***
las A	sAPDI-CDsGEN-IMP vs. Control	0.0087	99.1253	*
rhl A	sAPDI-CDsGEN-NH2 vs. Control	0.008	99.1985	**
rhl A	sAPDI-CDsIMP-NH2 vs. Control	0.0541	94.5854	*
rhl A	sAPDI-CDsIMP-GEN vs. Control	0.0015	99.8517	**
rhl A	sAPDI-CDsGEN-IMP vs. Control	0.0052	99.481	*

sAPDI sub-lethal doses of APDI

^aReduction (%) = (1 − Fold Change) × 100

Significance levels: ^*P < 0.05, ^**P < 0.01, ^***P < 0.001 vs. control group (without UVA or CDs exposure)

Discussion

QS represents a mechanism of intercellular communication that enables bacteria to adjust gene expression based on population density through the release and detection of signaling compounds known as autoinducers. This process allows bacteria to detect the presence of other bacteria within confined spaces and to initiate gene activation, leading to the production of virulence factors. P. aeruginosa utilizes QS to regulate the synthesis of critical virulence factors. Targeting the QS pathway represents a promising strategy for controlling P. aeruginosa infections, as this communication system plays a central role in regulating virulence gene expression and biofilm formation. The use of aPDT, especially in its sAPDI form, offers a novel and potentially effective means to disrupt QS-regulated pathogenic mechanisms [34, 38, 39]. A variety of therapies exist for managing P. aeruginosa infections, yet none offer a perfect blend of effectiveness, safety, and ideal application. Furthermore, many QS inhibitors and biological treatments are still being studied and have not yet demonstrated confirmed effectiveness and safety in clinical settings. Consequently, persistent infections caused by P. aeruginosa continue to pose significant challenges in medical treatment. This underscores the critical demand for innovative treatment options that surpass the efficacy and safety of existing methods [40]. PDT represents an innovative approach capable of diagnosing and treating illnesses through photodynamic reactions triggered by light in combination with photosensitizers. Currently, antimicrobial photodynamic therapy (aPDT) is viewed as a highly promising method for combating pathogens. The mechanism of action of PDT, which differs from that of antibiotics, offers numerous benefits. These include a broad spectrum of antibacterial activity, effectiveness against resistant strains, high selectivity, minimal harm and low toxicity to non-targeted tissues, no promotion of resistance development, and the feasibility of multiple applications [18, 19]. Compared to traditional antibiotics and small-molecule quorum sensing inhibitors, aPDT—particularly in its sAPDI form—offers distinct advantages, including broad-spectrum activity, low propensity for resistance development, and localized activation through light [14]. However, certain limitations remain, such as the requirement for targeted light delivery and challenges in treating deep-seated or systemic infections. Addressing these limitations will be critical for expanding the clinical applicability of aPDT.In the current study, sAPDI, utilizing sub-MBIC concentrations of CDsGEN-NH₂, CDsIMP-NH₂, CDsIMP-GEN, and CDsGEN-IMP in combination with a sub-lethal dose of UVA light, led to a reduction in the expression of QS-related genes (lasI, lasR, rhlI, and rhlR) and virulence-associated genes (lasA, lasB, phzA, and rhlA) in P. aeruginosa ATCC 27,853. Biofilm cells treated with sub-MBIC CDs and a sub-lethal dose of UVA light, alone, demonstrated a decrease in the expression of QS and virulence-related genes; however, the observed reduction was not statistically significant. The pigment pyocyanin (1-hydroxy-5-methyl phenazine) plays a crucial role as a virulence factor in the pathogenicity of P. aeruginosa. Researches show that the microorganisms’ capability to synthesize this pigment aids in resisting antibiotics. In bacteria, the pigment functions as a shield, preventing antibiotics from breaching the cell wall and cytoplasmic membrane. Additionally, it acts as an antioxidant, safeguarding the bacteria from the damaging effects of oxygen free radicals. Strains of P. aeruginosa lacking pyocyanin are less pathogenic and more prone to attack by the immune system [41]. Substances that inhibit the production of pyocyanin may also act as inhibitors of the QS mechanism, critically involved in the bacterium’s ability to cause disease. Targeting pyocyanin synthesis is recognized as a valuable strategy for managing infections attributed to P. aeruginosa [42]. The majority of P. aeruginosa strains secrete proteolytic enzymes, with at least three distinct types of proteases identified: general protease, alkaline protease, and elastase. There’s significant evidence highlighting the pivotal role of these proteases in the pathology of burn wounds. Strains lacking protease tend to be less virulent than protease-producing strains. Additionally, these enzymes play a role in breaking down burn-damaged tissues, leading to the liberation of amino acids and peptides that are crucial for nutrition [43]. Elastase and protease enzymes significantly contribute to the pathogenicity of P. aeruginosa by breaking down connective tissue in human cells [44]. The synthesis of these enzymes, along with the production of the pyocyanin pigment, is overseen by the quorum sensing mechanism [45–47]. Additionally, it has been shown that the rhl system specifically regulates the production of rhamnolipids through the transcription factor RhlR and its autoinducer, C4-HSL. The interaction between C4-HSL and RhlR triggers the transcription of the rhlAB genes, leading to the production of rhamnolipids in the stationary growth phase [48–50]. El-Shaer et al. explored the impact of a specific efflux pump inhibitor, phenylalanine arginyl β-naphthylamide, on the virulence factors of P. aeruginosa. The findings revealed a notable decrease in the relative expression levels of the lasB and toxA genes in the group receiving treatment in contrast to the control group [32]. Earlier research indicates that disrupting QS pathways can inhibit the virulence factors of P. aeruginosa, such as protease, elastase, and pyocyanin. This phenomenon has been observed with compounds like furanone derivatives and established medications like ascorbate [51–53]. Vandeputte et al. examined the effects of flavanones on the synthesis of virulence factors regulated by QS in P. aeruginosa. Their research revealed that flavanones, including naringenin, eriodictyol, and taxifolin, notably decreased the levels of pyocyanin and elastase without impacting the growth of the bacteria. Furthermore, their studies demonstrated that naringenin and taxifolin led to a reduction in the expression of multiple genes (lasI, lasR, rhlI, rhlR, lasA, lasB, phzA, and rhlA) in P. aeruginosa [2]. Galdino et al. revealed that at concentrations of 1/2 MIC, both phendione compounds and their associated metal complexes notably decreased lasB gene expression in the treatment group when compared with the control group [54]. Hendiani et al. revealed a decrease in the expression levels of the lasI, lasR, rhlI, and rhlR genes after applying sPDI treatment with methylene blue at a concentration of 0.012 mM and a light dosage of 23 J/cm² to P. aeruginosa ATCC 27,853 and six clinical isolates. Additionally, there was a notable decrease in the expression of the rhlA gene, aligning with the findings of this study. Contrary to our results, however, Hendiani et al. reported an increase in the expression of phzM in P. aeruginosa ATCC 27,853 and two clinical isolates following sPDI treatment [34]. In their research, Komerik et al. proposed the inactivation of virulence factors within P. aeruginosa and Escherichia coli through the application of photodynamic therapy employing toluidine blue [55]. In a related examination, Sharma et al. explored the impact of photodynamic therapy with toluidine blue on P. aeruginosa’s virulence determinants, revealing a decrease in phospholipase and protease activities in the treatment group relative to the control group [56]. Tan et al.‘s analysis also explored the impact of photodynamic therapy with aminolevulinic acid (ALA-PDT) on the gene expression linked to QS (lasI, lasR, rhlI, and rhlR), as well as on the virulence factors pyocyanin and elastase in P. aeruginosa. Their results demonstrated a notable decrease in the mRNA levels of the genes lasI, lasR, rhlI, rhlR, lasB, and phzH in P. aeruginosa [36]. Observed minor discrepancies, such as variations in MBIC or lethal light dosages, might be attributed to specific experimental conditions, including the choice of photosensitizer and light source. Additionally, the genetic diversity of bacterial strains used in different studies could influence the effectiveness of PDT. Although this study focused on the photodynamic effects of the combined formulations, a comparative analysis of the antibiotics and their derived carbon dots was not conducted. Future investigations should address this gap by evaluating each component individually to enable a more precise assessment of the potential synergistic interactions underlying the observed antimicrobial efficacy. This study has certain limitations, including the exclusive use of a standard laboratory strain (P. aeruginosa ATCC 27853) without incorporating clinical isolates, and the absence of in vivo experiments to validate the in vitro findings. Future studies should address these aspects to enhance the generalizability and clinical relevance of the results. Furthermore, the present study did not evaluate the effect of sAPDI on the pqs quorum sensing system, which also plays an important regulatory role in virulence. The inhibitory effect of sAPDI on biofilm formation has been comprehensively evaluated in a previous study by our group, which complements the current gene expression findings [20]. Moreover, although this study focused on gene expression profiles, it did not include functional assays to directly quantify the production of virulence factors (e.g., elastase, pyocyanin, rhamnolipids). Such phenotypic evaluations are essential to validate the biological impact of sAPDI and should be considered in future studies. Nevertheless, we anticipate that our findings will lay essential groundwork for future clinical research on the impact of aPDT using antimicrobial agents. Future studies, particularly those employing in vivo models, will be crucial for translating these findings into clinical applications. Further research is needed to fine-tune PDT parameters and investigate the synergy between PDT and other antimicrobial methods.

Conclusion

The current study demonstrates that sAPDI, utilizing sub-MBIC concentrations of CDsGEN-NH₂, CDsIMP-NH₂, CDsGEN-IMP, and CDsIMP-GEN, in conjunction with a sub-lethal dose of UVA light irradiation, significantly reduces the expression of genes related to quorum sensing (lasI, lasR, rhlI, rhlR) and virulence (lasB, lasA, rhlA, and phzM) in P. aeruginosa. The findings presented here offer strong evidence supporting the use of CDs derived from imipenem and gentamicin as antimicrobial agents when combined with UVA light irradiation in the context of aPDT.

Abbreviations

aPDT

Antimicrobial photodynamic therapy

sAPDI

Sub-lethal doses of antimicrobial photodynamic inactivation

CDs

Carbon dots

sub-MBIC

Sub-minimum biofilm inhibitory concentrations

qRT-PCR

Quantitative real-time polymerase chain reaction

P. aeruginosa

Pseudomonas aeruginosa

QS

Quorum sensing

AHL

Acyl-homoserine-lactone

C4-HSL

N-butyryl-L-homoserine lactone

MDR

Multidrug-resistant

APDI

Antimicrobial photodynamic inactivation

PS

Photosensitizer

ROS

Reactive oxygen species

CLSI

Clinical and Laboratory Standards Institute

CDsGEN-NH₂

Amine functionalised CDs synthesised from gentamicin

CDsIMP-NH₂

Amine functionalised CDs synthesised from imipenem

CDsGEN-IMP

CDsGEN-NH₂ conjugated with imipenem

CDsIMP-GEN

CDsIMP-NH₂ conjugated with gentamicin

MBIC

Minimum biofilm inhibitory concentration

SEM

Standard error of the mean

Authors’ contributions

M.Y.A. and A.B. orchestrated and oversaw the study. M.Y.A., A.B., and M.P. were engaged in the analysis and interpretation of the data. S.S., M.S.A., A.F., L.S and M.A. took charge of data collection and experimental procedures. The final version of the manuscript received approval from all authors.

Funding

The financial support for this research was provided by the Vice Chancellor of Research and Technology of Hamadan University of Medical Sciences, Hamadan, IRAN, under grant numbers: 14000124468 and 140002281272.

Data availability

The corresponding author can provide the data upon request. Data is provided within the paper or supplementary information files.

Declarations

Ethics approval and consent to participate

The experimental protocols in this study were approved by the Ethics Committee of Hamadan University of Medical Sciences, Hamadan Iran, as evidenced by the ethics approval codes: IR.UMSHA.REC.1399.1065 and IR.UMSHA.REC.1400.078. The methods followed the relevant guidelines and regulations, and all participants, along with their legal guardians, obtained informed consent as approved by the Ethics Review Board.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.