Targeted delivery of engineered adipose-derived stem cell secretome to promote cardiac repair after myocardial infarction

Abstract

Stem cell secretome offers a promising alternative to stem cell transplantation for treating myocardial infarction (MI). However, its clinical application faces two major challenges: how to enhance the levels of growth factors within the secretome to promote cardiac cell survival and vascularization, and how to efficiently deliver the secretome to the infarcted heart during the acute MI phase without risking rupture of the weakened myocardium. To address these challenges, we upregulated angiogenic growth factors in the secretome from adipose-derived stem cells (ADSC-secretome) by conditioning the cells under hypoxia and with insulin-like growth factor 1 (IGF-1). Our results show that exposure to 1 % O₂ condition significantly increased the expression of VEGF, bFGF, and PDGF-BB compared to 5 % O₂ condition. Co-treatment with IGF-1 further elevated the levels of these growth factors and, notably, reduced the secretion of pro-inflammatory cytokines such as TNFα, IL-1β, and IL-6 from the ADSCs. To rapidly and specifically deliver the secretome to the infarcted heart during acute MI, we encapsulated it within ischemia-targeting nanoparticles. These nanoparticles, designed for intravenous injection, preferentially accumulated in the infarcted region. The treatment significantly improved cardiac cell survival, tissue vascularization, and cardiac function. These findings suggest that ADSC secretome, enriched with angiogenic growth factors, holds strong potential for facilitating cardiac repair following MI.

1. Introduction

Myocardial infarction (MI) is one of the most prevalent life-threatening diseases worldwide, with approximately 800,000 new cases annually in the United States alone. [1] MI results in the extensive loss of cardiac cells and a subsequent deterioration in cardiac function. While current surgical interventions, such as angioplasty and coronary artery bypass grafting, can rapidly restore blood perfusion and reduce early mortality, [2–4] they do not regenerate myocardial tissue and therefore cannot prevent long-term heart failure. Indeed, approximately 25 % of patients die from heart failure within one year following MI. [5,6]

To promote cardiac regeneration, stem cell therapy holds great potential. Studies have demonstrated that stem cell transplantation can reduce left ventricular remodeling and improve cardiac function. [7,8] However, the clinical efficacy of current stem cell therapies remains modest, [9,10] primarily due to challenges such as low cell retention and engraftment, immune rejection, and the fact that not all patients are suitable candidates for cell transplantation. Additionally, the use of undifferentiated stem cells raises concerns about tumorigenicity [11,12]. Moreover, no direct evidence has confirmed that transplanted stem cells differentiate into cardiac lineages. [13,14] Instead, improvements in cardiac function are thought to result primarily from the paracrine effects of stem cells. [15,16] Therefore, delivering the stem cell secretome—rather than the cells themselves—directly to the infarcted heart may offer a more promising approach to promoting cardiac repair in clinical settings.

The secretome comprises the entire set of proteins secreted by cells, including growth factors, cytokines, chemokines, hormones, and enzymes. Unlike single growth factor therapies, stem cell secretome therapy offers the advantage of simultaneously providing multiple growth factors critical for cardiac cell survival and vascularization, which cannot be easily achieved with individual growth factors alone. [17–34] Secretomes derived from embryonic stem cells (ESCs), bone marrow-derived mesenchymal stem cells (BMSCs), and induced pluripotent stem cells (iPSCs) have shown promise in mediating cardiac repair after MI in both small and large animal models. [35–37] Among the various sources of stem cell secretomes, adipose-derived stem cells (ADSCs) offer distinct advantages, including ease of acquisition, rapid proliferation, and potent paracrine effects. [38,39] Studies have confirmed that ADSC-mediated cardiac repair is primarily driven by their paracrine factors, which reduce apoptosis, promote angiogenesis, alleviate inflammation, and inhibit fibrosis [40,41].

While stem cell secretome therapy has demonstrated encouraging effects in stimulating cardiac cell survival and angiogenesis, its efficacy remains suboptimal, limiting its widespread clinical application. [42–50] This is largely due to the fact that current secretome therapies are not optimized for the expression of prosurvival and angiogenic growth factors necessary for enhanced cell survival and accelerated angiogenesis in infarcted hearts. Although strategies such as preconditioning cells with hypoxia, [51] cytokines [52,53], or small molecules [54] and manipulating cell-cell interactions [55] have been explored, these approaches have not demonstrated the ability to efficiently rescue cardiac cells and rapidly induce angiogenesis, likely due to insufficient expression of key prosurvival and proangiogenic growth factors. Therefore, alternative methods to effectively upregulate the expressions of these growth factors are urgently needed.

Prompt delivery the stem cell secretome into infarcted hearts after MI to timely rescue cardiac cells and promote angiogenesis poses another challenge for stem cell secretome therapy. Current efforts to deliver secretome into the infarcted hearts have focused on encapsulating the secretome in cardiac patches, [43,44,47,48] or injectable hydrogel. [45,46] These approaches, however, often require suturing or myocardial injection for implantation, which are unsuitable during the acute stage of MI, the critical therapeutic window for effective treatment, [56–58] because such procedures pose a high risk of damaging the already weakened myocardium. Thus, a more effective and translational delivery method is needed.

Nanoparticles have been extensively used in intravenous drug delivery because their size is significantly smaller than the diameter of capillaries (i.e., 5–6 μm), thereby preventing embolism formation [59]. Polymeric nanocarriers can accumulate in ischemic tissues through the enhanced permeability and retention (EPR) effect of the vasculature [60,61]. However, their retention time in the bloodstream is limited due to rapid clearance by the immune system. To address this, surface modification strategies have been employed to prolong circulation time.

Cell membrane-camouflaged nanoparticles have gained significant attention in recent years for intravenous drug delivery applications [62–68]. A key advantage of cell membrane coating is the ability to disguise nanoparticles as autologous cells, helping them evade immune recognition and clearance [69]. Among various membrane types, platelet membrane coatings offer unique benefits, including prolonged circulation time, sustained drug release, and potential for targeted delivery via incorporation of specific ligands [62,65,66]. Notably, platelet membrane-coated nanoparticles can selectively bind to injured endothelium, enhancing drug accumulation at ischemic sites and improving delivery efficiency [65,66].

In this work, we engineered secretomes from ADSCs with enhanced prosurvival and proangiogenic growth factor expression by preconditioning the cells with both hypoxia and insulin-like growth factor-1 (IGF-1). This dual conditioning synergistically upregulated these growth factors. Furthermore, we developed a targeted delivery system for ADSC-secretome, enabling delivery to the infarcted heart without the need for procedures such as suturing or myocardial injection. The secretome was encapsulated in ischemic heart-targeting nanoparticles with platelet membrane cloaking, allowing for intravenous administration during the acute phase of MI and efficient targeting to the ischemic heart. Our studies comprehensively evaluated the efficacy of ADSC-secretome on cardiac cell activities in vitro and in infarcted hearts, demonstrating its potential as a new therapeutic strategy for cardiac repair.

2. Materials and methods

2.1. ADSC-secretome collection and characterization

Mouse adipose-derived stem cells (ADSCs) were cultured in minimum essential medium alpha (αMEM, Thermo Fisher), supplemented with 10 % fetal bovine serum (FBS, Atlanta Biologicals) and 1 % penicillin-streptomycin (MilliporeSigma). Once the cells reached 70–80 % confluency, the medium was replaced with serum-free αMEM. The cells were then incubated under different oxygen conditions (21 %, 5 %, and 1 %) and treated with varying concentrations of IGF-1 (Peprotech) (0 and 20 ng/mL). To collect the secretome, the conditioned medium was harvested, centrifuged at 300 ×g for 5 min, and filtered through a 220 nm filter. The filtered medium was then concentrated using a Vivaspin concentrator (3 kDa MWCO, GE Healthcare), lyophilized, and stored at −80 °C.

The molecular weights of proteins in the secretome were analyzed using SDS-PAGE. Specifically, 50 μg of denatured proteins were loaded onto a 4–15 % stain-free SDS-PAGE gel (Bio-Rad) and imaged with the ChemiDoc XRS+ system (Bio-Rad). The concentrations of VEGF, bFGF, PDGF, and IGF-1 in the secretome were quantified using ELISA kits (PeproTech) according to the manufacturer’s protocols and normalized to the total protein content, as determined by a Bradford assay (n ≥ 3 for each group). For the protein array assay, secretome samples containing 100 μg of total protein (n = 2 for each group) were analyzed using the Proteome Profiler Mouse Angiogenesis Array Kit (R&D Systems) following the manufacturer’s instructions. Pixel density was quantified using Image Lab software.

2.2. Nanoparticle fabrication

ADSC-secretome-loaded nanoparticles were fabricated using a water-in-oil-in-water (w/o/w) double emulsion method, following our established protocols. [70–72] Briefly, the concentrated ADSC-secretome was re-suspended in 0.1 % w/v poly(vinyl alcohol) (PVA) to form the internal aqueous phase. Then, 0.1 mL of the above solution was rapidly added to 1 mL of 5 % w/v poly(lactic-co-glycolic acid) (PLGA) in dichloromethane and sonicated for 1 min using an ultrasonic liquid processor (Cole Parmer). The resulting primary emulsion was added to 4 mL of 0.7 % w/v PVA solution and sonicated for 1.5 min to form the secondary emulsion. This w/o/w emulsion was stirred overnight at 4 °C to allow solvent evaporation. The nanoparticles were collected by centrifugation at 12,000 rpm for 15 min, and washed 3 times with Dulbecco’s phosphate-buffered saline (DPBS).

The secretome encapsulation ratio was calculated by measuring the content of VEGF in the secretome before and after encapsulation using an ELISA kit (Peprotech). Specifically, the VEGF concentration in the inner aqueous phase prior to nanoparticle fabrication was measured to determine the total input content (m₁). Following the double emulsion process, nanoparticles were pelleted by centrifugation, and the VEGF concentration in the supernatant was measured to determine the content of unencapsulated VEGF (m₂). The encapsulation ratio was then calculated using the formula: Encapsulation ratio = (m₁ − m₂)/m₁ × 100%.

2.3. Cloaking platelet membrane onto nanoparticles and conjugating ischemia-targeting peptide

Platelets were isolated from bovine blood (Quad Five) by gradient centrifugation and suspended in DPBS containing 1 mM ethylenediaminetetraacetic acid (EDTA) and 2 μM prostaglandin E1 to prevent activation. The platelet membrane was processed through four freeze-thaw cycles, washed with DPBS containing protease inhibitors (Thermo Fisher), and sonicated in an ultrasonic bath (130 W, Fisher Scientific) for 5 min. The resulting platelet membrane was then sonicated with nanoparticles for 5 min. To conjugate the ischemia-targeting peptide CSTSMLKAC (CST), 10 mg of platelet membrane-coated nanoparticles were mixed with 10 mg peptide in 25 mM NaH₂PO₄ buffer. Suberic acid bis(N-hydroxysuccinimide ester) was added as a cross-linker, and the mixture was stirred at room temperature for 2 h. Afterward, the solution was dialyzed against deionized (DI) water overnight and lyophilized. The resulting platelet membrane-cloaked, CST-conjugated nanoparticles loaded with ADSC-secretome were abbreviated as PMCNP/Sec.

2.4. Nanoparticle characterization

Transmission electron microscopy (TEM) images were captured using a FEI Tecnai G2 Spirit. The size and surface ζ-potential of the nanoparticles were measured using a Malvern Zetasizer Nano-ZS ZEN 3600. To assess the binding affinity of the nanoparticles to collagen, PMCNP/Sec nanoparticles were incubated in culture plates with or without collagen coating for 1 h. After incubation, the plates were washed three times with DPBS, and the fluorescence intensity was measured using a plate reader.

2.5. Cell culture

Rat neonatal cardiomyocytes (RNCs, Lonza) were cultured in rat cardiomyocyte growth medium BulletKit (Lonza) supplemented with 5-bromo-2′-deoxyuridine to inhibit fibroblast proliferation. One vial of RNCs containing 4 million cells was seeded into 40 wells of a 96-well plate. The cardiomyocytes exhibited spontaneous beating after 24 h in culture and were subsequently used for experiments. Rat cardiac fibroblasts (RCFs, Cell Applications) were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10 % fetal bovine serum (FBS). One vial containing 500,000 RCFs was seeded into two T25 flasks. Cells between passages 7 and 10 were used for in vitro experiments. Human umbilical vein endothelial cells (HUVECs, Lonza) were cultured in endothelial cell growth medium-2 BulletKit (Lonza). One vial of HUVECs containing 500,000 cells was seeded into two T25 flasks. Cells between passages 3 and 6 were used for assays. Mouse bone marrow-derived macrophages (BMDMs) were isolated from the femurs and tibias of C57BL/6 J mice (Jackson Laboratories) and cultured in minimum essential medium alpha (αMEM) supplemented with 10 % FBS and macrophage colony-stimulating factor. Cells were plated at a density of 300,000 cells/cm². All cells were maintained under standard culture conditions (37 °C, 5 % CO₂).

2.6. Cellular uptake assay and cytotoxicity test

For the cellular uptake assay, RNCs, RCFs, and HUVECs were incubated with 10 mg/mL PMCNP/Sec for 2 h. The cells were then washed with DPBS, fixed with 4 % paraformaldehyde (PFA), and stained with DAPI (MilliporeSigma) and F-actin (Abcam). Fluorescent images were captured using a confocal microscope (Olympus FV1200). The uptake ratio was calculated as the percentage of cells showing nanoparticle uptake. To assess nanoparticle toxicity after cellular uptake, RCFs were incubated with 10 mg/mL PMCNP/Sec (n = 10 per group) for 24 h, after which cell viability was determined using an MTT assay [73,74].

2.7. Blood compatibility of nanoparticles

The blood compatibility of PMCNP/Sec was assessed through hemolysis ratio and thromboresistance tests. For the hemolysis assay, red blood cells were isolated by centrifuging bovine blood at 500 ×g for 10 min, washed, and diluted with DPBS. The diluted red blood cells were then incubated with PMCNP/Sec for 1 h at 37 °C (n = 3 per group). DI water and 0.9 % sodium chloride solution served as positive and negative controls, respectively. After incubation, the mixture was centrifuged at 500 ×g for 10 min, and the free hemoglobin in the supernatant was measured by absorbance at 540 nm. The hemolysis ratio was calculated using the formula: Hemolysis ratio = (A_sample − A_{negative control}) / (A_{positive control} − A_{negative control}) × 100%.

For the thromboresistance assay, PMCNP/Sec (n = 3 per group) were incubated with bovine blood and 0.1 M CaCl₂ at 37 °C. At designated time points, the supernatant was separated from the thrombus and dispersed in DI water. The hemoglobin concentration from free red blood cells was measured by absorbance at 540 nm.

2.8. Release kinetics of the growth factors

Nanoparticles loaded with ADSC-secretome (PMCNP/Sec) were incubated in DPBS at a concentration of 10 mg/mL at 37 °C. At specific time points, days 1, 3, 5, 7, 10, 14, 21, and 28, the nanoparticles were collected by centrifugation at 12,000 ×g for 20 min, and the supernatants were carefully harvested. The concentrations of basic fibroblast growth factor (bFGF), IGF-1, vascular endothelial growth factor (VEGF), and platelet-derived growth factor (PDGF) in the supernatants were quantified using kits (PeproTech), following the manufacturer’s instructions.

2.9. Cell survival and migration assay

For in vitro cell survival assay, RNCs, RCFs, and HUVECs were seeded into 96-well plates at a density of 8000 cells per well. Nanoparticles loaded with IGF-1 (PMCNP/IGF-1) and ADSC-secretome (PMCNP/Sec) were separately added to the wells at a concentration of 10 mg/mL (n ≥ 5 for each group). After 5 days of culture under hypoxic conditions (1 % O₂), the cells were digested using a papain solution to release double-stranded DNA (dsDNA). The dsDNA content was then quantified using the PicoGreen dsDNA assay kit (Invitrogen) and normalized to the content measured on day 0.

For in vitro cell migration assay, RCFs and HUVECs were cultured in 6-well plates until they reached 85–95 % confluency. A scratch was made in the cell monolayer using a 200 μL pipette tip, followed by washing and the addition of serum-free medium, either alone or containing PMCNP/IGF-1 or PMCNP/Sec (10 mg/mL, n = 4 for each group). At designated time points, bright-field images were captured using an optical microscope (Olympus IX70). The distances between the two sides of the scratch were measured using ImageJ software, and the migration ratio was calculated.

2.10. Endothelial cell tube formation assay and myofibroblast formation assay

To assess the impact of nanoparticles on endothelial cell tube formation, HUVECs were cultured in a 3D collagen model, as previously described. [75] The collagen gel was prepared by combining rat tail collagen type I (Corning), FBS, DMEM, and sodium hydroxide, followed by incubation at 37 °C for 30 min. HUVECs were then embedded in the collagen gel at a density of 10,000 cells/well, either without treatment or in the presence of PMCNP/IGF-1 or PMCNP/Sec nanoparticles (10 mg/mL, n = 3 per group). After overnight culture in 1 % O2, the cells were fixed with 4 % paraformaldehyde and stained with 4′,6-diamidino-2-phenylindole (DAPI) and F-actin. Z-stack fluorescent images were captured using a confocal microscope (Olympus FV1200). Tube density was quantified using at least six images per group.

To examine the effect of nanoparticles on cardiac fibroblast differentiation into myofibroblasts, RCFs were cultured in the same 3D collagen model at a density of 10,000 cells/well, either untreated or treated with PMCNP/IGF-1 or PMCNP/Sec nanoparticles (10 mg/mL, n = 3 per group). Following overnight incubation under 1 % O₂, RCFs were fixed with 4 % paraformaldehyde and stained with DAPI, F-actin, and anti-alpha smooth muscle actin (αSMA). Z-stack fluorescent images were captured using a confocal microscope (Olympus FV1200), and the percentage of αSMA-positive cells was quantified using at least six images per group.

2.11. Gene expression

Total RNA was isolated from rat cardiac fibroblasts using TRIzol reagent, following the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized with a high-capacity cDNA reverse transcription kit (Thermo Fisher). Gene expression analysis was performed via real-time RT-PCR using SYBR Green (Invitrogen) and specific primer pairs (Table 1). β-actin served as the housekeeping gene. Data were analyzed using the ΔΔCt method (n ≥ 6).

Table 1.

Primers used for real-time RT-PCR.

Gene	Species	Primer sequence (5′–3′)
Vegf	Mouse	F	TAGAGTACATCTTCAAGCCG
		R	TCTTTCTTTGGTCTGCATTC
Fgf2	Mouse	F	CTGGCTTCTAAGTGTGTTAC
		R	GAAGAAACAGTATGGCCTTC
Pdgf	Mouse	F	GTGGGCAGGGTTATTTAATATG
		R	GAGGGGAACAACATTATCAC
Actb	Mouse	F	GATGTATGAAGGCTTTGGTC
		R	TGTGCACTTTTATTGGTCTC

2.12. Western blot analysis

Protein lysates were extracted from the cultured cells and separated by SDS-PAGE. Proteins were transferred onto LF-PVDF membranes (Bio-Rad) at 4 °C overnight. After transfer, the membranes were blocked and incubated with primary antibodies at 4 °C. The blots were washed with PBST (DPBS containing 0.1 % Tween 20) and incubated with the appropriate HRP-conjugated secondary antibodies. Immunoreactive bands were visualized using a detection kit (Advansta) and imaged with the ChemiDoc XRS+ System (Bio-Rad). The primary antibodies used were anti-GAPDH (1:4000, Abcam), anti-phospho-Erk1/2 (pErk1/2, 1:500, Cell Signaling), and anti-total Erk1/2 (tErk1/2, 1:1000, Cell Signaling).

2.13. Animal study

All animal care and experimental procedures were conducted in accordance with the National Institutes of Health guidelines, and the protocol was approved by the Institutional Animal Care and Use Committee at Washington University in St. Louis. Female 8-week-old C57BL/6 J mice (Jackson Laboratories) were used in the study. Myocardial infarction (MI) was induced by permanently ligating the left anterior descending (LAD) artery. [70,71] The animals were randomly assigned to four groups (N = 5 per group): (1) MI surgery only (MI); (2) MI surgery with an injection of blank nanoparticles (PMCNP); (3) MI surgery with an injection of IGF-1-loaded nanoparticles (PMCNP/IGF-1); and (4) MI surgery with an injection of ADSC-secretome-loaded nanoparticles (PMCNP/Sec). Nanoparticles were suspended in DPBS at a concentration of 10 mg/mL and intravenously injected (100 μL per mouse) 4 h post-surgery. Seven days after surgery, ex vivo fluorescence imaging was performed on the heart, liver, lungs, kidneys, and spleen using the IVIS Spectrum CT Imaging System (Perkin Elmer) with a dsRed emission filter.

Echocardiography was conducted using the Vevo 2100 ultrasound system (Fujifilm). M-mode measurements in the long-axis view of the left ventricle (LV) were used to calculate the LV end-systolic volume (LVESV) and LV end-diastolic volume (LVEDV) via the Teichholz formula: LV volume = 7.0 × D³ / (2.4 + D), where D is the diameter at either end-systole or end-diastole. Fractional shortening (FS) was calculated as the percentage change in diameter between systole and diastole, while the ejection fraction (EF) was calculated as EF = (LVEDV − LVESV) / LVEDV × 100%.

2.14. Histology and immunofluorescence

Heart sections were deparaffinized, permeabilized, blocked, and incubated overnight at 4 °C with the following primary antibodies: rabbit anti-αSMA (Abcam, 1:300), mouse anti-von Willebrand factor (vWF, Abcam, 1:300), mouse anti-myosin heavy chain (MHC, R&D, 1:50), rabbit anti-laminin (Abcam, 1:150), rat anti-Ki67 (Thermo Fisher, 1:250), mouse anti-α-actinin (Sigma, 1:200), rabbit anti-PGC1α (Abcam, 1:300), rabbit anti-CD68 (Abcam, 1:500), and mouse anti-CD206 (Abcam, 1:500). Following primary antibody incubation, corresponding secondary antibodies were applied for 1 h at room temperature, and nuclei were counterstained with DAPI. Fluorescent images were captured using a confocal microscope (Olympus FV1200). Hematoxylin and eosin staining, as well as picrosirius red staining, were also performed, and images were acquired using a light field microscope (Olympus CKX53).

2.15. In vivo protein analysis

Infarcted heart tissues were lysed using radioimmunoprecipitation assay (RIPA) buffer supplemented with protease inhibitors. Total protein concentration was quantified using the Bradford assay. The VEGF, PDGF, bFGF, TNFα, IL1β, and IL6 levels were measured using ELISA kits (PeproTech), following the manufacturer’s instructions.

2.16. Statistical analysis

All data were presented as means ± standard deviation. Statistical analysis was performed between groups using one-way analysis of variance (ANOVA) with Tukey’s post hoc test. A value of p < 0.05 was considered statistically significant.

3. Results and discussion

3.1. Upregulating expressions of angiogenic growth factors in ADSC-secretome

To enhance the expression of angiogenic growth factors in ADSC-secretome, we evaluated the effects of hypoxic preconditioning and exogenous IGF-1 stimulation on major angiogenic factors, including VEGF, PDGFBB, and bFGF (Fig. 1A). For hypoxic preconditioning, we compared mRNA expression levels of these growth factors in ADSCs cultured under 21 %, 5 %, and 1 % O₂ conditions. Vegf and Pdgfbb expressions were significantly higher under 1 % O₂ compared to 21 % and 5 % O₂ (Fig. 1B), while Fgf2 expression was similar between 21 % and 1 % O₂, and both were higher than under 5 % O₂. These findings are consistent with previous reports indicating that 5 % O₂ enhances the paracrine activity of stem cells [76–80]. However, we observed that 1 % O₂ more effectively upregulated angiogenic growth factor expression compared to 5 % O₂. Based on these results, 1 % O₂ was selected as the optimal oxygen concentration for subsequent preconditioning studies.

Fig. 1.

Optimization of the secretome released by adipose-derived stem cells (ADSCs). (A) Schematic illustration of different culture conditions to optimize ADSC secretome. (B) Gene expression of Vegf, Fgf2 and Pdgfbb in ADSC cultured under 21 %, 5 % and 1 % O₂ conditions. N = 5. (C) Gene expression of Vegf, Fgf2 and Pdgfbb in ADSC cultured with or without IGF-1 (20 ng/mL) under 1 % oxygen. N = 5. (D) SDS-PAGE of the secretome released by ADSC cultured with or without IGF-1. (E) Angiogenic growth factor concentration in ADSC secretome cultured with or without IGF-1. N = 3. (F) Angiogenic protein array of ADSC secretome cultured with or without IGF-1. N = 2. (G) Inflammatory cytokine concentration in ADSC secretome cultured with or without IGF-1. N = 3. (H) Immunoblotting of phosphorylated Erk1/2 in ADSC cultured with or without IGF-1. GAPDH serves as a loading control. (I) Quantification of the immunoblotting in (H). N = 3. *P < 0.05, **P < 0.01, ***P < 0.001.

We then investigated the effect of exogenous IGF-1 stimulation on the ADSC secretome under hypoxic conditions (1 % O₂). IGF-1 at 20 ng/mL significantly increased the mRNA expression of Vegf and Fgf2 (p < 0.001, Fig. 1C), while Pdgfbb expression also showed a notable increase (p = 0.09). Protein analysis of ADSC preconditioning media via SDS-PAGE revealed that IGF-1 stimulated the production of multiple proteins (indicated by red arrows, Fig. 1D). To identify these proteins, we conducted quantitative and semi-quantitative analyses using ELISA and protein arrays, respectively. IGF-1 supplementation led to significantly higher concentrations of VEGF (p < 0.01), and bFGF and PDGF (p < 0.001) in the preconditioning media compared to controls (Fig. 1E). Additionally, the expression of angiogenin, dipeptidyl peptidase-4 (DPPIV), endoglin, endostatin, and osteopontin was upregulated in the presence of IGF-1 (Fig. 1F).

Interestingly, while IGF-1 increased the secretion of pro-angiogenic factors, it did not upregulate TNFα and even decreased the expression of IL1β and IL6 (p < 0.05, Fig. 1G). These findings indicate that exogenous IGF-1 under hypoxic conditions stimulated pro-angiogenic factor production while reducing inflammatory cytokine expression. Mechanistically, IGF-1 treatment led to significantly enhanced phosphorylation of extracellular signal-regulated protein kinase (ERK1/2) compared to the control group (p < 0.001, Fig. 1H, I), a pathway known to boost ADSC paracrine secretion. [81]

Previous studies have shown that exogenous IGF-1 enhances the release of pro-angiogenic factors from ADSCs under normoxic conditions (21 % O₂) [41,82]. However, the effect of IGF-1 under hypoxia on ADSC paracrine activity has yet to be fully explored. This study confirms that hypoxic preconditioning improves ADSC paracrine secretion, and that exogenous IGF-1 further enhances the secretome by increasing pro-angiogenic growth factors and reducing inflammatory cytokines. The combination of hypoxic preconditioning and IGF-1 stimulation optimizes the ADSC secretome, making it a promising therapeutic approach to promote angiogenesis and alleviate inflammation in vivo.

3.2. Fabrication and characterization of ADSC secretome-loaded nanoparticles

ADSC secretome-loaded nanoparticles were fabricated using a double emulsion technique, with PLGA as the shell (Fig. 2A). The secretome encapsulation ratio was determined to be 72 %. These nanoparticles exhibited a core-shell structure (Fig. 2B) and had a hydrodynamic diameter of 152 nm (Fig. 2C). To reduce systemic clearance of the nanoparticle after IV delivery, the platelet membrane was coated onto the nanoparticles (Fig. 2A). Following platelet membrane coating, the nanoparticle diameter increased to 211 nm (Fig. 2 B, C), and the surface ζ potential shifted from −3 mV to −20 mV (Fig. 2D), closely resembling that of platelets. [65,83] The ischemia-targeting peptide CST was conjugated onto the nanoparticles at a density of 250 μg/mg_Nanoparticle.

Fig. 2.

Synthesis and characterization of platelet membrane (PM)-coated and ADSC secretome-loaded nanoparticles (PMCNP/Sec). (A) Schematic illustration of nanoparticle synthesis and PM coating. (B) Transmission electron microscopy images of nanoparticles (NP/Sec) and PM-coated NPs (PMCNP/Sec). Scale bar = 100 nm. (C) Hydrodynamic size of NP/Sec and PMCNP/Sec. N = 3. (D) Surface ζ potential of NP/Sec and PMCNP/Sec. N = 3. (E) Schematic illustration of PMCNP/Sec binding to culture plate (Ctrl) and collagen-coated surface. (F) Fluorescence intensity of PMCNP/Sec binding to culture plate (Ctrl) and collagen-coated surface. N = 4. (G) Cellular uptake of PMCNP/Sec by rat neonatal cardiomyocytes (RNCs), rat cardiac fibroblasts (RCFs) and mouse bone-marrow derived macrophages (BMDMs). Blue: nuclei; Green: cytoplasm. Red: PMCNP/Sec. (H) Quantification of the uptake ratio. N = 5. (I) Viability of RCFs after uptaking PMCNP/Sec. N = 8. (J) Images of hemolysis assay using PMCNP/Sec. DI water and PBS were used as controls. (K) Thromboresistance test of PMCNP/Sec. PBS was used as a control. ***P < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Platelets naturally bind to subendothelial collagen, [65,83] indicating that platelet membrane-coated nanoparticles (PMCNP/Sec) may have the potential to target injured vasculature. To test this, we incubated PMCNP/Sec on both the control culture plate and the collagen-coated surface, then measured the fluorescence intensity of the nanoparticles bound to each surface (Fig. 2E). The fluorescence intensity on the collagen-coated surface was approximately three times higher than on the uncoated surface (p < 0.001, Fig. 2F), confirming that platelet membrane-coated nanoparticles preferentially bind to collagen.

After delivery to the infarcted heart, these nanoparticles may be taken up by cells in the infarcted heart, such as cardiomyocytes, cardiac fibroblasts, and macrophages. We assessed the uptake of PMCNP/Sec in RNCs, RCFs, and mouse bone marrow-derived macrophages (BMDMs) (Fig. 2G). After 2 h of incubation, the uptake ratios were 20 % for RNCs, 32 % for RCFs, and 13 % for BMDMs (Fig. 2H). These uptake ratios are relatively low compared to other polymeric nanoparticles without lipid coatings reported in the literature. [84] This reduced uptake is consistent with previous findings that platelet membrane coating decreases cellular uptake. [65,85] Importantly, nanoparticle uptake did not affect cell viability (p > 0.05, Fig. 2I), indicating that the nanoparticles were non-toxic to cells.

Nanoparticle compatibility with blood is crucial for in vivo applications. We performed a hemolysis assay to assess potential damage to red blood cells (Fig. 2J). The hemolysis ratio for PMCNP/Sec was 0.6 %. Such a low value is considered highly blood-compatible. [86] We also evaluated the thromboresistance of the nanoparticles, as platelet membrane coating could potentially induce clotting. However, blood samples treated with PMCNP/Sec showed hemoglobin absorbance changes similar to those in PBS-treated samples (Fig. 2K), indicating that the nanoparticles were thromboresistant, and platelet membrane coating did not induce blood clotting.

3.3. Release kinetics of growth factors

To evaluate the release profiles of angiogenic growth factors from the nanoparticles, they were incubated in PBS at 37 °C for 4 weeks. VEGF, bFGF, and PDGF-BB were continuously released from the nanoparticles throughout this period (Fig. 3). Since IGF-1 was used as a stimulatory factor to enhance the upregulation of angiogenic growth factors in the ADSC-secretome, its release profile was also assessed. Similar to VEGF, bFGF, and PDGF-BB, IGF-1 exhibited sustained release over 28 days. The release rate was faster during the first 7–10 days, followed by a slower phase. The rapid initial release is attributed to the large surface-to-volume ratio of the nanoparticles, which accelerated the hydrolysis of the PLGA shell leading to faster protein diffusion. All of these released growth factors play essential roles in cardiac repair after MI. Exogenous VEGF, bFGF, and PDGF-BB have been shown to promote therapeutic angiogenesis in the infarcted heart [87–89]. Additionally, PDGF-BB enhances scar mechanics and reduces ventricular arrhythmias [89], while IGF-1 promotes cardiac cell survival. [90] The sustained release of these growth factors in the infarcted myocardium has the potential to stimulate vascularization, support cardiac growth, and mitigate adverse remodeling.

Fig. 3.

Release kinetics of angiogenic growth factors from ADSC secretome-loaded nanoparticles. (A-D) Cumulative release of (A) VEGF, (B) bFGF, (C) PDGF-BB, and (D) IGF-1 from 10 mg/mL nanoparticles loaded with ADSC secretome for 28 days. N = 3.

3.4. Effect of ADSC-secretome releasing nanoparticles on cardiomyocytes, cardiac fibroblasts and endothelial cells in vitro

Cardiac repair after MI is a complex process involving various cell types, including cardiomyocytes, cardiac fibroblasts, and endothelial cells. Cardiomyocytes make up the heart muscle and generate the contractile force of the myocardium. Endothelial cells (ECs) are essential for restoring blood vessels, which helps alleviate ischemia in the myocardium, preventing cardiomyocyte death, infarct expansion, and left ventricular remodeling. [91] Cardiac fibroblasts, the most abundant cell type in the myocardium, are responsible for extracellular matrix (ECM) synthesis, regulation of cell signaling, and electro-mechanical function. [92] We investigated the effects of ADSC-secretome-loaded nanoparticles (PMCNP/Sec) on these cell types in vitro. Cells were cultured under hypoxic (1 % O₂) and serum-free conditions to mimic the low-oxygen, nutrient-deprived environment of the infarcted heart. Nanoparticles loaded with IGF-1 (PMCNP/IGF-1) were used as a control to assess the effects of ADSC-secretome beyond the pre-supplemented IGF-1. We first studied cardiomyocytes, which comprise the heart muscle and generate contractile force in the myocardium. The sudden ischemia after MI leads to suspended oxygen and nutrient supply, which causes massive cardiomyocyte death. In vitro, we measured dsDNA content to quantify the live RNCs, and showed extensive death after 5 days of culture, with over 70 % of cells dying (Fig. 4A). Both PMCNP/Sec and PMCNP/IGF-1 significantly improved RNC survival, with PMCNP/Sec demonstrating a more significant increase in cell survival than PMCNP/IGF-1 (p > 0.05). IGF-1 is known to play a critical role in cardiomyocyte homeostasis, exerting pro-survival and anti-apoptotic effects. [93] However, IGF-1 can also maladaptively promote cardiomyocyte hypertrophy. [94,95] To address this, we measured RNC size after treatment with PMCNP/Sec and PMCNP/IGF-1 (Fig. 4B). No significant differences in cell size were observed among the PMCNP/Sec, PMCNP/IGF-1, and control groups (Fig. 4C), indicating that neither IGF-1 nor the other paracrine factors in ADSC-secretome caused cardiomyocyte hypertrophy. ECs have been reported to be less sensitive to ischemia than cardiomyocytes, yet the poor survival rate under prolonged ischemia is still an obstacle to vascularization. [96] After 5 days of culture under hypoxia, HUVECs showed a 56 % survival rate (Fig. 4D). PMCNP/IGF-1 slightly elevated HUVEC survival to 72 % (p < 0.05). Strikingly, the dsDNA content of HUVECs in the PMCNP/Sec group was 126 % of that on day 0, indicating that ADSC-secretome largely enhanced the survival of HUVECs, and even promoted proliferation. Similarly, the survival of RCFs was significantly compromised in the hypoxic environment, with only ~40 % surviving after 5 days (Fig. 4E). Treatment with PMCNP/Sec significantly enhanced RCF survival (p < 0.05), while PMCNP/IGF-1 alone did not.

Fig. 4.

Effect of ADSC secretome-loaded nanoparticles on cardiac cell behaviors under hypoxia in vitro. (A) dsDNA content of rat neonatal cardiomyocytes (RNCs) after 5-day culture under 1 % O₂ with and without IGF-1-loaded nanoparticles (PMCNP/IGF-1) or ADSC secretome-loaded nanoparticles (PMCNP/Sec). N = 4. (B) Fluorescent images of RNCs with different treatments for 24 h. (C) Quantification of the size of RNCs. The results were normalized to that of the Ctrl group. N = 3. (D) dsDNA content of HUVECs after 5-day culture under 1 % O₂ with and without PMCNP/IGF-1 or PMCNP/Sec. N = 4. (E) dsDNA content of rat cardiac fibroblasts (RCFs) after 5-day culture under 1 % O₂ with and without PMCNP/IGF-1 or PMCNP/Sec. N = 4. (F) Migration of HUVECs cultured under 1 % O₂ with different treatments for 40 h. (G) Quantification of the migration ratio. N = 3. (H) Endothelial tube formation of HUVECs cultured with different treatments for 24 h. Scale bar = 20 μm. (I) Quantification of tube density. N = 4. (J) Immunoblotting of phosphorylated Erk1/2 and total Erk1/2 in HUVECs cultured with different treatments for 24 h. GAPDH serves as a loading control. (K) Migration of RCFs cultured under 1 % O₂ with different treatments for 48 h. (L) Quantification of the migration ratio. N = 3. (M) Immunofluorescence staining of alpha smooth muscle actin (αSMA, red) on RCFs cultured under 1 % O₂ with different treatments for 24 h. TGFβ1 was added in all groups at 5 ng/mL. Scale bar = 20 μm. (N) Quantification of αSMA positive myofibroblast density. N = 3. *P < 0.05, ***P < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Vascularization in infarcted hearts depends on endothelial cell migration and tube formation. We found that ADSC-secretome released from PMCNP/Sec significantly accelerated HUVEC migration compared to the PMCNP/IGF-1 and control groups (Fig. 4 F & G). Additionally, ADSC-secretome markedly promoted capillary-like tube formation (Fig. 4 H & I), with a ~ 3.5-fold increase in tube lumen density compared to the other groups. These findings suggest that ADSC-secretome effectively promotes endothelial cell migration and morphogenesis under hypoxic conditions, likely due to the presence of pro-angiogenic factors such as VEGF, bFGF, IGF-1, and PDGF, which are known to stimulate EC proliferation, migration, and tube formation. [97–99] Western blot analysis revealed that the enhanced HUVEC migration and tube formation induced by PMCNP/Sec were associated with activation of the Erk1/2 pathway (Fig. 4J). Erk1/2 is known to coordinate endothelial cell proliferation and migration during angiogenesis. [100] Upon activation, ERK1/2 phosphorylates and activates downstream targets such as ribosomal S6 kinase (RSK). Both ERK1/2 and RSK translocate into the nucleus, where they activate transcription factors including c-Fos, leading to the expression of genes involved in cell cycle progression, proliferation, and survival. [101]

Following MI, the migration of cardiac fibroblasts into the injury zone is essential for wound healing and left ventricular remodeling. Using a scratch assay, we found that PMCNP/Sec significantly enhanced RCF migration (p < 0.001, Fig. 4K & L). Increased fibroblast migration may lead to greater ECM deposition at the injury site, replacing the ECM degraded by matrix metalloproteinases (MMPs) such as MMP-2 and MMP-9. However, excessive ECM production can cause cardiac fibrosis and pathological remodeling. [102] The transdifferentiation of cardiac fibroblasts into myofibroblasts is the main contributor to fibrosis and scar generation. To assess whether ADSC-secretome promoted myofibroblast formation, we examined the expression of αSMA, a marker of myofibroblasts. Immunocytochemical staining results showed no significant differences in αSMA+ myofibroblast density among the groups (p > 0.05, Fig. 4 M & N), indicating that ADSC-secretome did not induce myofibroblast formation.

3.5. Biodistribution of ADSC secretome-loaded nanoparticles after IV delivery

To determine the biodistribution of ADSC-secretome-releasing nanoparticles designed to specifically target infarcted hearts after MI, the nanoparticles were intravenously injected into mice 4 h after the induction of MI (Fig. 5A). After 7 days, hearts and other major organs were harvested for nanoparticle biodistribution analysis using ex vivo IVIS imaging. The nanoparticles predominantly accumulated in the infarcted heart, as indicated by the much stronger fluorescent signal in the hearts injected with PMCNP/Sec compared to those without injection (Fig. 5B). IVIS imaging of the liver, lungs, spleen, and kidneys showed similar fluorescence signals between the group without injection and the group injected with PMCNP/Sec (Fig. 5C). These results demonstrate that the injected nanoparticles primarily localized to the infarcted heart, with minimal off-target accumulation in other major organs.

Fig. 5.

Effect of ADSC secretome-loaded nanoparticles on targeting capability, left ventricle wall thickness and heart function in mice after myocardial infarction (MI). (A) Timeline of the animal study. (B) IVIS images of the heart harvested 7 days after MI. (C) IVIS images of liver, lung, spleen and kidney harvested 7 days after MI. (D) Hematoxylin and eosin staining of the heart harvested 28 days after MI. Scale bar = 500 μm. (E) Quantification of left ventricle wall thickness. N = 5. (F, G) Echocardiographic analysis of the heart function 28 days after MI. Left ventricle ejection fraction (F) and fractional shortening (G) were measured. N = 5. *P < 0.05, ***P < 0.001.

The accumulation of nanoparticles in the infarcted heart is likely due to their entry through the vasculature surrounding the infarcted area and the leaky vasculature within the infarcted tissue [103,104]. The targeting capability of the nanoparticles can be attributed to both the platelet membrane coating and the CST peptide. The platelet membrane serves two functions: first, it “disguises” the nanoparticles, enabling them to circulate in the bloodstream with reduced immune recognition; second, since platelet membrane naturally targets injured endothelium, [65] it helps the nanoparticles recognize damaged vasculature in the infarcted area. Additionally, the CST peptide specifically targets ischemic regions of the infarcted heart, as demonstrated in previous studies [70,71].

3.6. Effect of ADSC secretome-loaded nanoparticles on left ventricle wall thickness and heart function

To investigate the effect of ADSC-secretome released from nanoparticles on cardiac repair, we assessed left ventricular wall thickness and heart function 28 days after surgery. H&E staining revealed a significant increase in wall thickness in the PMCNP/Sec group compared to the MI, PMCNP (without secretome or IGF-1), and PMCNP/IGF-1 groups (p < 0.001, Fig. 5D & E). Echocardiographic analysis showed that mice treated with PMCNP/Sec had significantly improved ejection fraction and fractional shortening compared to those in the MI, PMCNP, and PMCNP/IGF-1 groups (p < 0.05, Fig. 5F & G). These findings demonstrate that the ADSC-secretome released from nanoparticles effectively attenuated left ventricular remodeling and restored compromised heart function following MI.

3.7. Effect of ADSC secretome-loaded nanoparticles on cardiac cell survival, proliferation and metabolism after MI

To investigate the mechanisms by which PMCNP/Sec nanoparticles improve cardiac function, we first evaluated their effects on the survival, proliferation, and metabolism of cells involved in cardiac repair. Both PMCNP/Sec and PMCNP/IGF-1 groups significantly enhanced cardiomyocyte survival, as indicated by a remarkably higher MHC+ cell density compared to the MI and PMCNP groups (Fig. 6A & B). These results are consistent with the in vitro cardiomyocyte survival assay (Fig. 4A). Notably, cardiomyocyte survival was similar between the PMCNP/Sec and PMCNP/IGF-1 groups, suggesting that the IGF-1 released from both nanoparticle formulations played a key role in protecting cardiomyocytes from apoptosis in ischemic heart tissue. Additionally, neither the secretome released from PMCNP/Sec nor the IGF-1 released from PMCNP/IGF-1 induced cardiomyocyte hypertrophy, as evidenced by comparable cardiomyocyte sizes across the MI and treatment groups (p > 0.05, Fig. 6C & D).

Fig. 6.

Effect of ADSC secretome-loaded nanoparticles on cardiac cell survival, proliferation and metabolism after MI. (A) Immunofluorescence staining of myosin heavy chain (MHC, green). Images were taken in the infarcted heart tissues 28 days after MI (scale bar = 20 μm, same below). (B) Quantification of MHC+ cell density. (C) Immunofluorescence staining of laminin (red). (D) Quantification of cardiomyocyte size. (E) Immunofluorescence staining of Ki67 (red). (F) Quantification of Ki67+ cell density. (G) Immunofluorescence staining of peroxisome proliferator-activated receptor-gamma coactivator-1alpha (PGC1α, red) and α-actinin (green). (H, I) Quantification of PGC1α ₊ cell density (H) and PGC1α ₊ α-actinin+ cardiomyocyte density (I). *P < 0.05, **P < 0.01, ***P < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

We further investigated whether the released ADSC-secretome promoted cell proliferation in the infarcted hearts. Ki67 staining was performed for the infarcted area. We observed a significantly higher density of Ki67+ cells in the PMCNP/Sec group compared to the MI, PMCNP, and PMCNP/IGF-1 groups (Fig. 6E & F). These results demonstrate that the components other than IGF-1 in the ADSC-secretome contribute to cell proliferation. As terminally differentiated cardiomyocytes do not proliferate, the proliferating cells are likely cardiac fibroblasts and endothelial cells, which play critical roles in extracellular matrix synthesis and vascularization, respectively.

To determine whether enhanced cell survival and proliferation were associated with increased metabolic activity in the infarcted hearts, we performed staining for peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α), a marker of mitochondrial biogenesis. Both the PMCNP/Sec and PMCNP/IGF-1 groups exhibited significantly higher densities of PGC-1α ₊ cells compared to the MI and PMCNP groups (Fig. 6G & H). There was no significant difference between the PMCNP/Sec and PMCNP/IGF-1 groups. This suggests that IGF-1 was primarily responsible for the observed increase in cell metabolism. Moreover, analysis of metabolic activity in cardiomyocytes showed a significantly higher density of PGC-1α/actinin+ cells in the PMCNP/Sec and PMCNP/IGF-1 groups (Fig. 6I), indicating that cardiomyocytes in these groups were more metabolically active.

3.8. Effect of ADSC-secretome releasing nanoparticles on tissue angiogenesis after MI

After MI, new blood vessel formation is crucial for alleviating ischemia and promoting long-term cell survival. To assess whether the upregulated angiogenic growth factors, such as VEGF, bFGF, and PDGF-BB, in the ADSC-secretome enhanced their expression after delivery to infarcted hearts and stimulated vascularization, we first measured their concentrations in the heart tissues. The results demonstrated that the PMCNP/Sec group had significantly higher VEGF and bFGF concentrations than the MI, PMCNP, and PMCNP/IGF-1 groups (Fig. 7A & B). Although the PMCNP/Sec and PMCNP/IGF-1 groups exhibited similar PDGF-BB levels, both were significantly higher than those in the MI and PMCNP groups (Fig. 7C).

Fig. 7.

Effect of ADSC secretome-loaded nanoparticles on vascularization after MI. (A-C) In vivo protein analysis to measure the concentration of VEGF (A), bFGF (B) and PDGF-BB (C) in the infarcted heart tissues 28 days after MI. N = 3. (D) Immunofluorescence staining of αSMA (red) and von Willebrand factor (vWF, green). Images were taken in the infarcted heart tissues 28 days after MI (scale bar = 20 μm). (E, F) Quantification of total blood vessel density (E, indicated by vWF+ lumen) and mature blood vessel (F, indicated by vWF+ αSMA+ lumen) density. *P < 0.05, **P < 0.01, ***P < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Next, we examined blood vessel density in the infarcted area following treatment. Total vessel density in the PMCNP/Sec group was markedly greater than in the MI, PMCNP, and PMCNP/IGF-1 groups (Fig. 7D & E). The PMCNP/IGF-1 group exhibited a slight increase in total vessel density compared to the MI and PMCNP groups. Notably, IGF-1 released from PMCNP/IGF-1 stimulated vessel maturation, leading to a significant increase in mature vessel density relative to the MI and PMCNP groups (Fig. 7F). Remarkably, PMCNP/Sec treatment further promoted mature vessel formation, resulting in a 5-fold increase in density compared to the MI and PMCNP groups. These results suggest that the upregulated angiogenic growth factors in the ADSC-secretome effectively stimulated vascularization in the infarcted area by promoting the formation of both capillaries and mature blood vessels.

3.9. Effect of ADSC-secretome releasing nanoparticles on cardiac fibrosis and inflammation after MI

To assess whether the delivery of ADSC-secretome to infarcted hearts influenced cardiac fibrosis, we measured collagen deposition following picrosirius red staining (Fig. 8A). Interestingly, both the PMCNP/Sec and PMCNP/IGF-1 groups exhibited a significantly lower collagen volume ratio compared to the MI and PMCNP groups (Fig. 8C). This indicates that components within the ADSC-secretome, as well as IGF-1, helped reduce fibrotic scar tissue formation, which is critical for preventing adverse remodeling after MI.

Fig. 8.

Effect of ADSC secretome-loaded nanoparticles on cardiac fibrosis and inflammation in the infarcted heart. (A) Picrosirius red staining of the infarcted heart tissues 28 days after MI (scale bar = 100 μm). (B) Immunofluorescence staining of CD68 (red) and CD206 (green). Images were taken in the infarcted heart tissues 28 days after MI (scale bar = 20 μm). (C) Quantification of collagen volume ratio. (D, E) Quantification of CD68+ pro-inflammatory cell density (D) and CD206+ anti-inflammatory cell density (E). (F–H) In vivo protein analysis to measure the concentration of TNFα (F), IL1β (G), IL6 (H) in the infarcted heart tissues 28 days after MI. N = 3. *P < 0.05, **P < 0.01, ***P < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

We then evaluated the effect of ADSC-secretome delivery on tissue inflammation. Macrophage = s are highly plastic immune cells and their polarization plays a significant role in the heart repair process [105]. We performed CD68 and CD206 staining to assess the presence of pro-inflammatory M1 macrophages and reparative M2 macrophages, respectively (Fig. 8B). There were no significant differences in the density of CD68+ M1 macrophages (Fig. 8D) or CD206+ M2 macrophages (Fig. 8E) across all groups. These findings suggest that the delivered ADSC-secretome, as well as the nanoparticles themselves (without secretome or IGF-1), did not trigger an inflammatory response. Furthermore, despite the presence of pro-inflammatory cytokines in the PMCNP/Sec nanoparticles, these results confirm that these cytokines did not induce macrophage polarization.

To determine whether the secretome released from the nanoparticles caused an increase in local inflammatory cytokines, we measured the concentrations of TNFα, IL1β, and IL6 in the infarcted heart tissues. Intriguingly, the PMCNP/Sec group exhibited significantly lower TNFα, IL1β, and IL6 levels than the MI and PMCNP groups (Fig. 8F, G, H). These findings demonstrate that although the ADSC-secretome contains pro-inflammatory cytokines, their dosage did not result in an overproduction of these cytokines in the infarcted hearts.

In summary, we demonstrated that the targeted delivery and sustained release of ADSC-secretome, enriched with upregulated angiogenic growth factors, significantly enhanced cardiac repair following MI. Compared to previous studies using stem cells or their paracrine factors in the same animal model, our approach achieved superior [35] or similar [106,107] restoration of cardiac function. Importantly, our method of delivering stem cell secretome to the infarcted heart offers several key advantages: (1) The composition of the secretome was optimized in vitro through hypoxia and exogenous molecule stimulation, enhancing the expression of angiogenic growth factors while reducing the expression of pro-inflammatory cytokines. (2) The nanoparticle delivery system, featuring platelet membrane cloaking and CST conjugation, targets ischemic cardiac tissue via two distinct mechanisms: the ischemia-targeting peptide CST directs the nanoparticles to the infarcted tissue, while the platelet membrane binds to injured vasculature [65,66,108]. This dual-targeting strategy enhances the efficiency of secretome delivery to the heart. (3) The system can be administered via IV injection during the acute MI stage, a critical therapeutic window for MI treatment. (4) This approach holds strong potential for clinical translation. Compared to the use of live cells, secretomes are more amenable to large-scale manufacturing due to their stability and storage advantages. Secretomes can be collected in bulk, frozen, and stored long-term without significant loss of bioactivity, allowing for off-the-shelf availability. Furthermore, secretome profiles can be tailored in vitro using defined preconditioning cues to produce disease-specific therapeutic compositions. While autologous stem cells and platelets could be used to personalize therapy and reduce immune rejection, the approach is also compatible with allogeneic sources. Allogeneic ADSCs and platelet membranes could be pooled and standardized under Good Manufacturing Practice (GMP) conditions, supporting the feasibility of scalable production and broader clinical use.

While we demonstrated that delivering ADSC-secretome at the acute MI stage via infarct-targeting nanoparticles promoted cardiac repair, our study has limitations. First, the nanoparticle dosage was not optimized. We anticipate that optimal dosage will further enhance cardiac cell survival and tissue vascularization, leading to improved cardiac function. Varying the concentration of nanoparticles may significantly impact therapeutic efficacy by modulating the amount and duration of secretome release in the infarcted heart. A subtherapeutic dose may result in insufficient biological activity, while excessively high doses could lead to unintended off-target effects or immune responses. Additionally, increased nanoparticle accumulation in non-cardiac organs at higher doses could compromise safety. Future studies will systematically investigate the dose–response relationship to identify an optimal dose that maximizes efficacy while minimizing potential side effects. Second, we did not specifically isolate or analyze the exosomal fraction of the ADSC-secretome. While our preparation included both soluble factors and extracellular vesicles, the lack of exosome-specific isolation means that the contributions of exosomal RNA and DNA cargo were not directly assessed. Given the emerging roles of exosomal microRNAs and other nucleic acids in modulating cardiac repair, future studies focusing on the isolation and characterization of ADSC-derived exosomes will be important to complement our current protein-centric findings and further elucidate the full spectrum of paracrine signaling mechanisms involved in cardiac repair. Third, while our study demonstrated improved cardiac repair and function following targeted delivery of ADSC-secretome-loaded nanoparticles in the acute phase of myocardial infarction, long-term outcomes remain to be fully evaluated. Specifically, the potential for arrhythmogenic risk due to structural remodeling or electrical heterogeneity in the infarcted myocardium was not assessed and warrants further investigation through long-term electrophysiological and histopathological studies. Fourth, although our IVIS imaging suggested minimal off-target accumulation particularly after accounting for organ-specific autofluorescence, comprehensive biodistribution studies using quantitative methods (e.g., radiolabeling) are needed to confirm systemic nanoparticle clearance and assess potential effects on off-target organs. Future studies will aim to address these safety aspects to fully establish the therapeutic potential and translational feasibility of this nanoparticle-based delivery platform. Lastly, this study focused on a murine MI model, which does not fully replicate human pathophysiology. However, this work lays the groundwork for validating the therapeutic efficacy in larger animal models, such as pigs, which more closely resemble human conditions.

4. Conclusions

In this study, we modulated the ADSC-secretome to upregulate VEGF, bFGF, and PDGFBB through hypoxic preconditioning and exogenous IGF-1 stimulation. The secretome releasing nanoparticles were able to be delivered non-invasively by IV injection and predominately accumulate in the infarcted hearts. The released ADSC-secretome effectively enhanced cell survival, proliferation, and metabolism, stimulated angiogenesis, and reduced inflammation and fibrosis. Collectively, these effects contributed to improved cardiac function and minimized adverse left ventricular remodeling after MI.

Data availability

Data will be made available on request.