Abstract
It is well known that multiple myeloma (MM) cells are highly dependent on the bone marrow (BM) microenvironment. However, the complex interactions and signaling pathways between MM cells and BM stromal cells remain inadequately defined. In this study, we employed an in vitro coculture model to investigate these interactions. We found that coculturing MM cells with BM-derived HS5 stromal cells stimulated the secretion of hyaluronic acid (HA) and interleukin-6 (IL-6), and significantly increased the expression of CD44 and F-actin stress fibers polymerization in MM cells. Among the three hyaluronan synthase (HAS) isoforms, HAS3 mRNA expression was most significantly elevated in MM cells following coculture with HS5. This coculture also resulted in upregulation of HAS3 and IL-6 mRNA in MM cells. Notably, MM cells in direct contact with HS5 cells exhibited higher proliferative capacity compared to those not in contact with the stromal cells. Additionally, coculturing MM cells with HS5 led to the formation of membrane protrusions in MM cells, with CD44 enrichment observed at these polarized regions. Further analysis revealed that Rac1 co-localizes with CD44 on MM cells within the coculture system, suggesting that Rac1 signaling plays a critical role in CD44-mediated cytoskeletal rearrangements. Importantly, silencing CD44 expression in MM cells reduced F-actin polymerization, as well as impaired MM cell migration and adhesion to HS5. Our findings highlight the involvement of the HA/CD44/F-actin pathway in MM–BM migration and adhesion, suggesting that CD44 may serve as a novel therapeutic target to disrupt the MM–BM microenvironment.
Supplementary Information
The online version contains supplementary material available at 10.1007/s10238-025-01649-4.
Keywords: CD44, Multiple myeloma cells, Stromal cells, Interleukin-6, Hyaluronic acid, F-actin
Introduction
Multiple myeloma (MM) is the second most common hematologic malignancy. MM cells rely on the bone marrow (BM) microenvironment for survival, progression and resistance to therapy [1]. A critical event in the pathogenesis of MM is the trafficking of transformed post-germinal center plasma cells to the BM microenvironment, where they interact with various stromal components to support their growth and survival.
The permissive BM microenvironment in MM consists of endothelial cells, stromal cells, immune cells, as well as the acellular extracellular matrix, cytokines and extracellular vesicles [2, 3]. A deeper understanding of the complex signaling networks between these BM compartments is needed to facilitate the discovery of effective therapeutic strategies aimed at targeting MM in the context of the BM microenvironment [4]. Morphologically, a subset of MM cells may be polarized with uropod on one end and lamellipodia on the other end. These polarized MM cells demonstrate enhanced migratory potential compared to their nonpolarized counterparts [5].
CD44 is a widely expressed type I transmembrane protein found in various cell types and serves as the primary receptor for hyaluronic acid (HA) [6]. CD44 is localized to uropods and plays an important role in lymphocyte homing, adhesion and migration. Binding of CD44 to HA anchors MM cells to the extracellular matrix (ECM) and induces actin cytoskeletal rearrangement, forming the basis of cell adhesion and migration [6–8]. Mechanistically, HA binding to CD44 activates Rac1, and RacGTPase signaling has been shown to regulate actin assembly, driving membrane ruffling, pseudopod extension, cell motility and cellular transformation [9]. In fact, Rac1 is critical in cytoskeleton-mediated processes, including tumor cell adhesion, growth, survival and migration [10].
HA has the ability to specifically target CD44-overexpressing solid tumors, including hematological cancers as well as breast, prostate and lung cancers [11–14]. HA is synthesized by three isoforms of the hyaluronan synthase family (HAS1–3) and is subsequently degraded by hyaluronidases (HYAL) [15]. Notably, CD44 presents not only on hematological cancer cells but also on human hematological cancer stem cells, making CD44 an especially attractive target for hematological cancer therapy. The role of CD44 is primarily driven by the stimulation of HA production through enhanced activation of HAS [16, 17].
In multiple myeloma (MM), MM cells interact with bone marrow stromal cells (BMSC) through direct cell-to-cell contact or cytokine-mediated paracrine signaling. A key cytokine implicated in MM pathogenesis is interleukin (IL)−6 [18, 19]. Interestingly, IL-6 not only upregulates CD44 expression but is also induced by HA-mediated activation of CD44 [20–22].
Given that HA and CD44 play a critical role in MM [6–8], we investigated the involvement of CD44 in MM–BM migration and adhesion through the HA/CD44/F-actin molecular pathway.
Our results showed that the concentrations of HA and IL-6 were elevated in the supernatants of cocultured cells. Among the three HAS isoforms, HAS3 mRNA expression exhibited the most significant increase in the MM cells. MM cells cocultured with HS5 stromal cells upregulated both HAS3 and IL-6 expression in MM cell. Notably, this coculture induced polarization in some myeloma cells, with uropods forming at one end of the cell and CD44 preferentially localized to the uropod. In contrast, nonpolarized cells exhibited uniform CD44 expression across the entire cell surface. Additionally, we observed that coculture with HS5 cells led to cytoskeletal rearrangement and activation of the small GTPase Rac1 at the leading edge of the membrane.
These findings suggest that intracellular signaling induced by CD44 ligation enhances MM cell migration and invasion through Rac1 activation. Knockdown of CD44 expression in MM cells impaired the formation of uropods and significantly inhibited cell migration, adhesion and homing.
Methods and materials
All experiments were conducted in biological replication, with each experiment repeated at least three times.
Cell lines
NCI-H929, MM1S and HS5 cells were a kind gift of Prof. Yan Xu, Chinese Academy of Medical Sciences Institute of Hematology and Blood Diseases Hospital, Tianjin, China, were grown in RPMI 1640 with 10% fetal calf serum. 293 T cell lines were grown in DMEM with 10% fetal calf serum.
Antibodies and reagents
The following human monoclonal antibodies (mabs) were used: anti-CD44 (Cat:3570 T) and anti-RAC1 (Cat:2465 T) from Cell Signaling, FITC-CD44 (Cat:555478) and APC-CD138 (Cat:347193) from Becton Dickinson, hyaluronic acid and IL-6 test by magnetic particle chemiluminescence immunoassay system from Beijing Medconn Medical Devices Co., Ltd., Phalloidin-iFluor 555 (Cat:ab176756) from Abcam, CellTraceTM CFSE Cell Proliferation kit (Cat:C34554) from Thermo Fisher Scientific, hyaluronidase (H8030) from Solarbio Life Sciences.
CD44 knockdown
Lentiviral-based shRNAs targeted to CD44 (pLVshRNA-EGFP [2 A] Puro-CD44, Inovogen Tech. Co.), or a nonspecific scrambled control, were transfected with packaging vectors using Lipofectamine (Life Technologies) into 293 T cells. Concentrated supernatant was used to transduce H929 and MM1S cells, which were selected with puromycin (Sigma-Aldrich).
Primary coculture screening assays
To analyze the impact on morphology and function of myeloma cell direct contact, myeloma cells (2 × 105) were cocultured together with (2:1) with stromal cell (HS5) in RPMI 1640 medium containing 10% FBS for 24 h in a 6-well culture plate. HS5 cells at a density of 1 × 105 cells/well were seeded into 6-well plates and cultured overnight to allow the cells to become adherent. Cells from MM cell line (H929 and MM1.S cells) were seeded into these plates at a 2:1 ratio between MM cells and HS5 cells, and the two types of cells were cocultured for 24 h. Cells from each plate were separately collected and used to prepare single-cell suspensions with a nylon mesh (400 microns, BD). CD138 magnetic beads (Miltenyi, Germany) were utilized to sort MM cells in the cell suspensions; flow cytometry-based identification revealed that this process produced sorting purities > 95%.
Real-time PCR
The mRNA expression of CD44, IL-6 and HAS3 were detected by RT-PCR in MM cell lines and in sorted CD138+ cells from coculture system.
Total RNA was isolated using Trizol (Invitrogen), and cDNA was synthesized using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems; Foster City, CA). The genes expression levels were measured by qRT-PCR with the SYBR Green PCR kit (Roche) using Light-Cycler®480 Real-Time PCR System (Roche). The reactions were incubated in a 96-well optical plate at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Data were quantified by the 2–∆∆Ct method using GAPDH as a reference gene and are shown as the fold increase against the values for H929/MM.1S alone. Primer sequences are shown in Table 1. All PCR assays were carried out in triplicate, and the mean of triplicates is reported.
Table 1.
The primers sequences
| Primer | Sequence |
|---|---|
| GAPDH P1 | TGCACCACCAACTGCTTAGC |
| GAPDH P2 | GGCATGGACTGTGGTCATGAG |
| CD44S P1 | CTGAAGACATCTACCCCAGCAAC |
| CD44S P2 | CCTGTAATGGTTATGTTTCCAACG |
| IL-6-P1 | AAGCCAGAGCTGTGCAGATGAGTA |
| IL-6-P2 | TGTCCTGCAGCCACTGGTTC |
| HAS1-P1 | TACAACCAGAAGTTCCTGGG |
| HAS1-P2 | CTGGAGGTGTACTTGGTAGC |
| HAS2-P1 | GTGGATTATGTACAGGTTTGTGA |
| HAS2-P2 | TCCAACCATGGGATCTTCTT |
| HAS3-P1 | GAGATGTCCAGATCCTCAACAA |
| HAS3-P1 | CCCACTAATACACTGCACAC |
Western blot analysis
The extracted proteins were separated by SDS-PAGE on 10–12% polyacrylamide gels and stained with Coomassie blue. The following primary antibodies were used: anti-GAPDH (Abcam, (ab9484), 1:1000), anti-CD44 (Abcam, ab189524, 1:1000). Blots were incubated with goat anti-rabbit HRP secondary antibodies at 0.2 ug/mL before imaging.
The measurement of hyaluronic acid and IL-6
The concentration of HA and IL-6 was measured by magnetic microparticle chemiluminescence immunoassay method on the automatic chemiluminescence immunoassay analyzer (Ranos IMS 1200) with hyaluronic acid determination kit and interleukin-6 determination kit from Beijing Hui Zhong Medical Equipment Co., Ltd.
Actin polymerization assay
Actin polymerization was investigated as described [23]. Bone marrow stromal cell lines HS5 (1 × 105) were grown on the 6-well for 8 h to produce a confluent monolayer, myeloma cells (2 × 105) were added to stromal cells incubated for 12 h at 37 °C. Images were analyzed with a Leica confocal microscope. On the other hand, unattached cells were removed, followed by limited trypsin digestion and scraping to remove the HS5 and myeloma cells. 400 ul of cell suspension was added to 100 ul of a solution containing 50 ug/ml Phalloidin-iFluor 555, intracellular F-actin was measured by flow cytometry as mean fluorescence intensity and represented as percentages of F-actin relative to baseline.
Dye labeling and cell culture
Cells were labeled using a CellTraceTM Cell Proliferation kit (carboxyfluorescein diacetate succinimidyl ester (CFSE), Thermo Fisher Scientific) according to the manufacturer’s instructions. For new CFSE tube, add 18 ul DMSO into tube, to get 5 mM (working solution 1:1000 dilution). The cell suspension was incubated with CFSE at a final concentration of 1 µM for 10 min at 37 °C, followed by the addition of complete medium to stop the reaction. Cells were then washed twice with PBS and resuspended in an appropriate medium for flow cytometry analysis.
HS5 cells (1 × 105) were allowed to attach overnight, and then myeloma cells (labeled using CFSE) were added to stromal cells, cultured for up to 48 h. Unattached cells (untouched with HS5 stromal cells) and attached cells (direct touched with HS5) were analyzed on a FACSCanto II flow cytometer [24].
Flow cytometry
Initially, forward scatter (FSC) and side scatter (SSC) parameters were used to gate on viable cells by excluding debris and dead cells. Live cells were selected based on their FSC and SSC profiles. This was followed by a doublet exclusion step to eliminate any clumped cells. The cell suspension was incubated with CD44-FITC conjugated monoclonal antibody (or appropriate isotype control) at a concentration of 1:100 for 30 min on ice, in the dark. After the incubation, cells were washed twice with PBS to remove unbound antibody, which were analyzed on a FACSCanto II flow cytometer.
Adhesion assays
HS5 cells (1 × 105) were allowed to attach overnight, and myeloma cells (transfected with GFP-tagged CD44 sh or vector alone) (2 × 105) were added to stromal cells. Unattached cells were removed, followed by limited trypsin digestion and scraping to remove the HS5 and myeloma cells. Samples were analyzed on a FACSCanto II flow cytometer, and the percentage of events that were GFP was determined. The relative percent adhered was calculated by: [(cell number attached fraction)/(cell number attached fraction + cell number unattached fraction)] × 100, followed by normalization to vehicle controls. Each experiment was repeated using at least three independent biological replicates.
Trans-endothelial migration assay
MM migration was determined using 24-well, 6.5-mm-internal-diameter Transwell cluster plates with polycarbonate membranes (8.0 μm pore size) separating the two chambers (Corning Costar, Cambridge, MA). Bone marrow stromal cell lines HS5 (1 × 105) were grown on the insert for 8 h to produce a confluent monolayer. MM cell (2 × 105 cells/well) (transfected with GFP-tagged CD44 sh or scrambled shRNA alone) suspensions starved for 3 h in serum-free RPMI 1640 were loaded onto the insert (upper chamber). Plates were then incubated for 12 h at 37 °C. At the end of the incubation period, cells migrating through bone marrow stromal cell layers into the lower chamber were harvested for flow cytometric analysis to quantify the migrated cells as described [19]. Each experiment was repeated using at least three independent biological replicates.
Immunofluorescence staining
To evaluate morphological changes, MM cells were cocultured with HS5. Cells were fixed with 4% paraformaldehyde for 20 min at 4 °C and permeabilized with 0.2% Triton X-100 at room temperature for 5 min. Staining was performed with an anti-CD44-fluoresceinisothiocyanate (FITC)-labeled monoclonal antibody, phalloidin (Abcam, ab176759), 4′,6-diamidino-2-phenylindole (DAPI, DNA), anti-Rac1 antibody and the cells were incubated with fluorescent dye-coupled secondary antibodies for 1 h at RT. After being washed with PBS, samples were stained with DAPI (Beyotime, P0126) for 5 min. Images were analyzed with a Leica confocal microscope.
Electron microscopy
Cells were fixed and analyzed as described previously [25]. Protrusion counts were performed in at least 20 cells in different group, which were randomly selected from different fields of view for counting the number of cellular protrusion by two independent investigators blinded to experimental conditions.
Statistical analysis
Data were analyzed as indicated using GraphPad Prism 8.0 software. P < 0.05 was considered significant. All experiments were conducted in triplicate, and results presented as mean ± SEM. Datasets were tested for normality with Shapiro–Wilk tests prior to testing for significance. Data from multiple cells or multiple treatments were analyzed using one-way ANOVA and Tukey’s multiple comparison test.
Results
Abnormal metabolism of HA and IL-6 when MM cells cocultured with stromal cell HS5
Previous studies have shown that HA is present in abundance in the bone marrow extracellular matrix, and confers a survival advantage to MM cells [14]. To study the regulation and role of HA in the MM–BM microenvironment, we performed secretome analysis on 24 h conditioned media from HS5 alone, MM.1S alone, H929 alone, as well as cocultures of MM.1S + HS5 and H929 + HS5. We found that HS5 stromal cells secreted significantly higher levels of HA and IL-6 than the MM cell lines. Coculture of MM cells with HS5 stromal cells led to greater than an additive increase in HA and IL-6 secretion (Fig. 1).
Fig. 1.
HA and IL-6 content were increased in MM cells cocultured with HS5. (A) and (B) MM cells culture with or without HS5 were evaluated using hyaluronic acid and IL-6 test kits in the supernatants. (C) HAS1-3 mRNA level in MM cells. (D) and (E) HAS3 and IL-6 mRNA level in MM cells cocultured with or without HS5. Data are the mean ± SD of three independent experiments. The significantly differs from all other cell lines by one-way ANOVA testing and Tukey's multiple comparison testing, **P < 0.01, ***P < 0.001 versus MM1.S or H929 group
Next, we investigated the expression of HA and IL-6 in MM cells. Among the three HAS isoforms, HAS3 mRNA expression showed the greatest increase in the MM cells (Fig. 1C). MM cells cocultured with HS5 upregulated mRNA level of HAS3 and IL-6 in MM cell (Fig. 1D, E).
CD44 is the cognate receptor for HA and blocking CD44 has been shown to disrupt HA interaction with MM cells. Given IL-6 stimulates CD44 production in human macrophages [19], we therefore further sought to characterize the function of CD44 in MM–stromal interactions.
The distribution of CD44 and its co-localization with Rac1 on MM cells
As the cognate receptor for HA, CD44 is involved in homing and adhesion of MM cells to the BM microenvironment. We first confirmed higher CD44 expression in H929 and MM.1S cells compared to human PMBCs using real-time quantitative PCR (qPCR) and western blot (Supplementary 1). Previous studies have described CD44 expression that was localized to polarized protrusions found in CAG MM cells [5]. To study CD44 localization in our coculture model, we labeled MM cells with luc-mcherry and analyzed cell surface CD44 distribution with CD44-FITC antibody under confocal microscopy. We observed, in isolated cultures of H929 or MM1S cell lines, the diffuse nonlocalized distribution of cell surface CD44. In contrast, when H929 or MM1S were cocultured with HS5, CD44 was preferentially expressed on the leading membrane and polarized protrusion of MM cells (arrows) (Fig. 2A). Morphologically, the MM cells appeared rounder that cultured alone. Video confocal microscopy confirmed that coculture with HS5 stromal cells induced MM polarized protrusion formation (Supplementary 2).
Fig. 2.
The distribution of CD44 and its co-localization with Rac1 on MM cells. (A) MM cells were transfected with the luc-mcherry plasmid (red), labeled with CD44-FITC (green) and nuclear stain DAPI (blue), and subsequently analyzed using confocal microscopy (scale bar: 10 μm). (B) The localization of Rac1 was assessed by counterstaining with specific primary antibodies and Texas red-conjugated secondary antibodies (red), while CD44 was labeled with CD44-FITC (green) and nuclear stain DAPI (blue), Rac1 was found to co-localize with CD44 (scale bar: 10 μm) (color figure online)
HA–CD44 interaction activates RhoGTPase signaling in tumor cells, resulting in cytoskeletal rearrangements [26–28]. Rac1, a member of the Rho family of small GTPases, is required for the CD44-mediated cytoskeletal rearrangement, which has been shown to facilitate cell spreading in T cells [27]. We next explored whether CD44-induced cytoskeleton rearrangements in MM cells are mediated by Rac1 signaling. Cocultured MM and HS5 cells were stained with CD44-FITC and Rac1 antibody, followed by confocal microscopy visualization. Consistent with previous reports [27], we observed Rac1 and CD44 co-localization at the polarized protrusions of MM cells (Fig. 2B).
Quantifying CD44 expression and cell proliferation in MM cells by RT-PCR and flow cytometry
In our study, MM cells-HS5 interactions upregulated CD44 mRNA expression in MM cells (Fig. 3A). Coculturing MM cells with HS5 significantly increased the MM CD44 expression (Fig. 3B, C). We next measured proliferation of MM cells using the CFSE assay.
Fig. 3.
Quantifying CD44 and cells proliferation are measured in MM cells. (A) H929 and MM.1S cells were cocultured with HS5 subjected to quantitative RT-PCR for evaluating CD44 expression. (B) MM cells culture with or without HS5 were evaluated using flow cytometry. The percent of CD44 positive cell was measured by CD44-FITC stained (H929/MM1.S and H929 + HS5/MM1.S + H5). The negative control was stained by IgG-FITC antibody (H929 + IgG-FITC/MM1.S + IgG-FITC). (C) Graph shows the percent of CD44-FITC positive cell for each cell line. (D) The mean fluorescence intensity (MFI) of the CFSE was measured by CFSE stained. HS5-MM cocultures promote MM cells proliferation when compared to MM cells alone in CFSE histograms with display gradual decrease in fluorescence intensity. (E) Graph shows mean fluorescence intensity (MFI) for each cell line. All experiments representing three are given. **P < 0.01, ***P < 0.001 versus MM1.S or H929 group
Our results showed that MM cells proliferation rates were significantly increased in direct touched with HS5 stromal cells than those untouched ones (Fig. 3D, E). We confirmed that coculture promotes CD44 expression and MM cells proliferation.
Effects of CD44 knockdown on MM cell morphology, migration and adhesion to BMSC
To confirm the role of CD44 signaling in the MM–BM microenvironment, we performed lentiviral-based shRNA knockdown of CD44 (The transfection efficiency is shown by the western blot in Supplementary 3). Upon confirmation of effective CD44 knockdown, MM cells transfected with GFP-shCD44 plasmid (green) were cocultured with HS5 cells and then labeled with CD138-APC (yellow), Phalloidin-594-Alexa (actin filaments, red) and DAPI (DNA, blue). This allowed us to show that polymerization of actin filaments was driving the formation of polarized protrusions observed when MM cells were cocultured with HS5 cells. CD44 knockdown on the other hand inhibited the polymerization of F-actin (Fig. 4A) and reduced the formation of polarized protrusions in MM cocultured with HS5 (Fig. 4B).
Fig. 4.
Effects of knockdown CD44 on MM cell morphology and migration and adhesion to BMSC. (A) H929 cell was knockdown with GFP-shCD44 plasmid, which culture with HS5. Confocal images after immunocytochemistry staining with CD138-APC (yellow), Phalloidin-iFluor 555 (actin filaments, red), DAPI (DNA, blue) and transfecting with GFP-shCD44 plasmid (green) showed CD44-downregulation, changes in cell shape and reduction of F-actin content (scale bar: 10 μm). Representative staining images of actin content in H929 cells and statistical histogram, red fluorescence indicates the intensity of intracellular actin fluorescence. (B) Protrusions from MM cells coculturing with HS5 imaged with electron microscopy, scale bars, 2 μm. Protrusion counts were performed in at least 20 cells per condition by two independent investigators blinded to experimental conditions. Graph shows protrusion number of per cell. Data are from three independent experiments, and are presented as the mean ± SD, with “*” representing statistical significance at a level of P < 0.05 and **P < 0.01 using the student’s paired t test (color figure online)
In addition, knockdown CD44 had potential to inhibit MM cells migration and adhesion to HS5 (Fig. 5). CD44 deficient myeloma cell exhibited decreased strength of cell attachment and migration.
Fig. 5.
Effects of CD44 knockdown on adhesion, migration to BMSC of MM cells. (A) Adhesion of GFP-shCD44 and scrambled shRNA (Control) labeled MM1S and H929 cells to BMSCs. Unattached cells were washed and adherent cells (GFP+ signal) were measured by flow cytometer. Data are presented versus control (mean ± SD from five independent experiments). (B) Transwell migration (8 μm pores, Corning) of GFP-shCD44 and scrambled shRNA (Control) labeled MM1S and H929 cells. % of migrating cells to BMSC are shown. Data is presented as the mean ± SD from five independent experiments, *P < 0.05, **P < 0.01
Discussion
MM cells need to home to the BM as they are highly dependent on cell–cell interactions within the BM microenvironment for growth and survival [1, 12, 13]. These cell–cell interactions take place on the larger background of complex cytokine and extracellular matrix-triggered signaling networks. As the BM microenvironment is essential for MM cell survival and progression, understanding the underlying mechanisms that govern the communication between MM cells and BM stromal cells is crucial for developing novel therapeutic strategies [2].
Our results indicate that coculturing MM cells with BM-derived HS5 stromal cells significantly enhances the secretion of hyaluronic acid (HA) and IL-6. In our experiments, we found that HA and IL-6 were more highly secreted by HS5 compared to MM cells. Coculture of stromal cell and MM cell led to a significant increase in HA and IL-6 levels (Fig. 1). These molecules are known to play key roles in MM pathophysiology, with IL-6 being a major growth and survival factor for MM cells, and HA contributing to the maintenance of the BM niche [29].
HA, a critical component of the extracellular matrix, has been shown to promote interactions between MM cells and the BM stromal microenvironment [14]. HA binds to CD44, its cognate receptor, to induce posttranslational modifications and conformational changes in CD44, which in turn regulates downstream signaling pathways involved in numerous pathobiological processes, including inflammation, wound healing, tumor growth and metastasis [30–32].
Our study focused on elucidating the downstream effects of HA-CD44 signaling in the MM–stromal microenvironment. We first confirm high CD44 expression in H929 and MM1S MM cell lines and found that CD44 expression is upregulated in MM cells after coculture with HS5 (Fig. 3). Then, we showed that HA and IL-6 secretion were significantly increased when MM cells were cocultured with HS5 cells. Consistent with our findings, CD44 expression in human macrophages correlates with IL-6 secretion, and IL-6 stimulates CD44 expression in human macrophages [19, 33].
Morphologically, MM and HS5 coculture induces actin cytoskeletal polymerization in a portion of MM cells resulting in the formation of polarized protrusions (Fig. 4A). Consistent with prior reports, Kelly et al. reported preferential HA-CD44 localization at the pseudopod of KG1a cells [34]. The increase in HA secretion, combined with the enhanced expression of CD44 and the development of F-actin stress fibers, suggests that the interaction between MM cells and HS5 stromal cells induces a series of molecular events that strengthen the adhesion and migration of MM cells within the BM microenvironment. Next, we found that the functional relevance of CD44 in MM–BM interactions was further confirmed by the knockdown of CD44 in MM cells, which resulted in reduced F-actin polymerization and inhibited MM cell migration and adhesion to HS5 cells.
The striking observation that MM cells in direct contact with HS5 stromal cells exhibited higher CD44 expression and increased proliferative capacity emphasizes the importance of cell-to-cell contact in modulating MM cell behavior. Prior studies indicate that CD44 binding to HA activates Rac1 to promote tumor cell migration [10], possibly by inducing actin polymerization as reported in T cell lines [35] and fibroblasts [36]. Rac1, one of the Rho family small GTPases, is a cytoskeletal signaling-related protein that plays a critical role in MM proliferation [10]. Consistent with this, we observed the co-localization of Rac1 with CD44 provides further insight into the molecular mechanisms involved in this process (Fig. 2B). To test the functional consequences of HA-mediated CD44 signaling, we performed CD44 knockdown in MM cells which led to decreased polarized protrusion formation as well as inhibition of MM migration and adhesion (Fig. 5). For assays like migration and adhesion, where biological variability can be high, we ensured that each replicate was conducted under the same experimental conditions, minimizing technical variation. In addition, we monitored key parameters, such as cell confluence and culture conditions, to further reduce variability. It was suggested that HGF could be linked to HA-CD44 signaling in MM–stromal interactions, as both processes are involved in promoting tumor growth and metastasis. HGF, by stimulating the c-Met receptor, can enhance IL-6 secretion and activate Rac1, further amplifying MM migration and adhesion to the BM microenvironment [37].
Taken together, HA-mediated CD44 signaling likely activates Rac1, resulting in MM conformational change, which facilitates MM migration and invasion within the BM microenvironment. Our article has several shortcomings as the scope of our current study is primarily focused on in vitro investigations. In future studies, we will use animal models, further confirming our observations.
In conclusion, we demonstrated that CD44 plays a critical role in MM–stromal interactions. Inhibition of signaling pathways regulating these cellular protrusions may therefore represent a promising strategy to disrupt MM migration and adhesion to the BM microenvironment.
Supplementary Information
Below is the link to the electronic supplementary material.
CD44 expression in the MM cells. CD44 expression was tested in the various cells by western blotting and qPCR. A. The level of CD44 protein was measured in the various cells by western blot (top) and GAPDH (bottom). B. mRNA expression of CD44 by qPCR. Data are means ± SEM from three independent experiments. (JPG 90 kb)
Morphological characteristics of MM cells by video. Representative time lapse video recording of protrusion in MM cells. luc-mcherry plasmid to label myeloma cells (red), and HS5 cell was stained with CFSE (green). (AVI 3129 kb)
Morphological characteristics of MM cells by video. Representative time lapse video recording of protrusion in MM cells. luc-mcherry plasmid to label myeloma cells (red), and HS5 cell was stained with CFSE (green). (AVI 6649 kb)
CD44 expression in MM cells transfected with sh-CD44 plasmids. CD44 expression was decreased in MM cells transfected with sh-CD44 plasmids by western blot examination. (JPG 115 kb)
Acknowledgements
The authors acknowledge and appreciate their colleagues for their valuable efforts and comments on this paper.
Author’s contribution
ZK Wang and L Xue wrote the main manuscript text and funding acquisition, HY Liang wrote review & editing and approved the version to be published, C Yang analyzed the data and prepared Supplementary 1–3, YT Guo and J Zhou performed the research and prepared Figs. 1, 2, 3, 4 and 5. Y Xu provided cells and supervision. All authors reviewed the manuscript.
Funding
This study was financially supported by Project of Heilongjiang Provincial Health Commission (No. 20220303041084) and Excellent youth project of the Fourth Affiliated Hospital of Harbin Medical University (No. HYDSYYXQN202005).
Data availability
No datasets were generated or analyzed during the current study.
Declarations
Conflict of interest
The authors declare no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Zhenkui Wang, Yutong Guo and Chun Yang have contributed equally to this work and share first authorship.
References
- 1.Hideshima T, Anderson KC. Novel therapies in MM: from the aspect of preclinical studies. Int J Hematol. 2011;94(4):344–54. [DOI] [PubMed] [Google Scholar]
- 2.Minnie SA, Hill GR. Immunotherapy of multiple myeloma. J Clin Investig. 2020;130(4):1565–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Gooding S, Edwards CM. New approaches to targeting the bone marrow microenvironment in multiple myeloma. Curr Opin Pharmacol. 2016;28:43–9. [DOI] [PubMed] [Google Scholar]
- 4.Ho M, Xiao A, Yi D, et al. Treating multiple myeloma in the context of the bone marrow microenvironment. Curr Oncol. 2022;29(11):8975–9005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Børset M, Hjertner Ø, Yaccoby S, et al. Syndecan-1 is targeted to the uropods of polarized myeloma cells where it promotes adhesion and sequesters heparin-binding proteins. Blood. 2000;96(7):2528–36. [PubMed] [Google Scholar]
- 6.Luscinskas FW. Neutrophil CD44 rafts and rolls. Blood. 2010;116(3):314–5. [DOI] [PubMed] [Google Scholar]
- 7.Lauffenburger DA, Horwitz AF. Cell migration: a physically integrated molecular process. Cell. 1996;84(3):359–69. [DOI] [PubMed] [Google Scholar]
- 8.Nagano O, Saya H. Mechanism and biological significance of CD44 cleavage. Cancer Sci. 2004;95(12):930–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Bourguignon LYW, Gilad E, Brightman A, et al. Hyaluronan-CD44 interaction with leukemia-associated RhoGEF and epidermal growth factor receptor promotes Rho/Ras Co-activation, phospholipase Cϵ-Ca2+ signaling, and cytoskeleton modification in head and neck squamous cell carcinoma cells. J Biol Chem. 2006;281(20):14026–40. [DOI] [PubMed] [Google Scholar]
- 10.Bourguignon LYW, Zhu H, Shao L, et al. CD44 interaction with Tiam1 promotes Rac1 signaling and hyaluronic acid-mediated breast tumor cell migration. J Biol Chem. 2000;275(3):1829–38. [DOI] [PubMed] [Google Scholar]
- 11.Yang X, Sun Q, Li J, et al. Molecular epidemiology of carbapenem-resistant hypervirulent Klebsiella pneumoniae in China. Emerg Microbes Infect. 2022;11(1):841–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Zoeller M. CD44, hyaluronan, the hematopoietic stem cell, and leukemia-initiating cells. Front Immunol. 2015;6:235. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Gilbey AM, Burnett D, Coleman RE, et al. The detection of circulating breast cancer cells in blood. J Clin Pathol. 2004;57(9):903–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Kawano MM, Mihara K, Huang N, et al. Differentiation of early plasma cells on bone marrow stromal cells requires interleukin-6 for escaping from apoptosis. Blood. 1995;85(2):487–94. [PubMed] [Google Scholar]
- 15.Vincent T, Molina L, Espert L, et al. Hyaluronan, a major non-protein glycosaminoglycan component of the extracellular matrix in human bone marrow, mediates dexamethasone resistance in multiple myeloma. Br J Haematol. 2003;121(2):259–69. [DOI] [PubMed] [Google Scholar]
- 16.Toole BP. Hyaluronan: from extracellular glue to pericellular cue. Nat Rev Cancer. 2004;4(7):528–39. [DOI] [PubMed] [Google Scholar]
- 17.Yan Y, Zuo X, Wei D. Concise review: emerging role of CD44 in cancer stem cells: a promising biomarker and therapeutic target. Stem Cells Transl Med. 2015;4(9):1033–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Yan H, Song J, Jia X, et al. Hyaluronic acid-modified didecyldimethylammonium bromide/d-a-tocopheryl polyethylene glycol succinate mixed micelles for delivery of baohuoside I against non-small cell lung cancer: in vitro and in vivo evaluation. Drug Deliv. 2017;24(1):30–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Smyth MJ, Cretney E, Kershaw MH, et al. Cytokines in cancer immunity and immunotherapy. Immunol Rev. 2004;202:275–93. [DOI] [PubMed] [Google Scholar]
- 20.Zhu Z, Shen Z, Xu C. Inflammatory pathways as promising targets to increase chemotherapy response in bladder cancer. Mediat Inflamm. 2012;2012:1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Hägg D, Sjöberg S, Hultén LM, et al. Augmented levels of CD44 in macrophages from atherosclerotic subjects: a possible IL-6-CD44 feedback loop? Atherosclerosis. 2007;190(2):291–7. [DOI] [PubMed] [Google Scholar]
- 22.Varga C, Maglio M, Ghobrial IM, et al. Current use of monoclonal antibodies in the treatment of multiple myeloma. Br J Haematol. 2018;181(4):447–59. [DOI] [PubMed] [Google Scholar]
- 23.Bürger H, Kemming D, Helms M, et al. Expression of early placenta insulin-like growth factor (EPIL) in breast cancer cells provides an autocrine loop with enhancement of predominantly HER-2-related invasivity. Verh Dtsch Ges Pathol. 2005;89:201–6. [PubMed]
- 24.Hawkins ED, Hommel M, Turner ML, et al. Measuring lymphocyte proliferation, survival and differentiation using CFSE time-series data. Nat Protoc. 2007;2(9):2057–67. [DOI] [PubMed] [Google Scholar]
- 25.Kong J, Whelan KA, Laczkó D, et al. Autophagy levels are elevated in barrett’s esophagus and promote cell survival from acid and oxidative stress. Mol Carcinog. 2015;55(11):1526–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Bourguignon LYW. Hyaluronan-mediated CD44 activation of RhoGTPase signaling and cytoskeleton function promotes tumor progression. Semin Cancer Biol. 2008;18(4):251–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Föger N, Marhaba R, Zöller M. Involvement of CD44 in cytoskeleton rearrangement and raft reorganization in T cells. J Cell Sci. 2001;114(Pt 6):1169–78. [DOI] [PubMed] [Google Scholar]
- 28.Tsai FD, Philips MR. Rac1 gets fattier. EMBO J. 2012;31(3):517–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Vincent T, Jourdan M, Sy MS, et al. Hyaluronic acid induces survival and proliferation of human myeloma cells through an interleukin-6-mediated pathway involving the phosphorylation of retinoblastoma protein. J Biol Chem. 2001;276(18):14728–36. [DOI] [PubMed] [Google Scholar]
- 30.Veiseh M, Kwon DH, Borowsky AD, et al. Cellular heterogeneity profiling by hyaluronan probes reveals an invasive but slow-growing breast tumor subset. Proc Natl Acad Sci. 2014;111(17):E1731–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Sironen RK, Tammi M, Tammi R, et al. Hyaluronan in human malignancies. Exp Cell Res. 2011;317(4):383–91. [DOI] [PubMed] [Google Scholar]
- 32.Alstergren P, Zhu B, Glougauer M, et al. Polarization and directed migration of murine neutrophils is dependent on cell surface expression of CD44. Cell Immunol. 2004;231(1–2):146–57. [DOI] [PubMed] [Google Scholar]
- 33.Vincent T, Mechti N. IL-6 regulates CD44 cell surface expression on human myeloma cells. Leukemia. 2004;18(5):967–75. [DOI] [PubMed] [Google Scholar]
- 34.Brown KL, Birkenhead D, Lai JCY, et al. Regulation of hyaluronan binding by F-actin and colocalization of CD44 and phosphorylated ezrin/radixin/moesin (ERM) proteins in myeloid cells. Exp Cell Res. 2005;303(2):400–14. [DOI] [PubMed] [Google Scholar]
- 35.Oliferenko S, Kaverina I, Small JV, et al. Hyaluronic acid (HA) binding to CD44 activates Rac1 and induces lamellipodia outgrowth. J Cell Biol. 2000;148(6):1159–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Mackay DJG, Hall A. Rho GTPases. J Biol Chem. 1998;273(33):20685–8. [DOI] [PubMed] [Google Scholar]
- 37.Rao L, De Veirman K, Giannico D, et al. Targeting angiogenesis in multiple myeloma by the VEGF and HGF blocking DARPin(®) protein MP0250: a preclinical study. Oncotarget. 2018;9(17):13366–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
CD44 expression in the MM cells. CD44 expression was tested in the various cells by western blotting and qPCR. A. The level of CD44 protein was measured in the various cells by western blot (top) and GAPDH (bottom). B. mRNA expression of CD44 by qPCR. Data are means ± SEM from three independent experiments. (JPG 90 kb)
Morphological characteristics of MM cells by video. Representative time lapse video recording of protrusion in MM cells. luc-mcherry plasmid to label myeloma cells (red), and HS5 cell was stained with CFSE (green). (AVI 3129 kb)
Morphological characteristics of MM cells by video. Representative time lapse video recording of protrusion in MM cells. luc-mcherry plasmid to label myeloma cells (red), and HS5 cell was stained with CFSE (green). (AVI 6649 kb)
CD44 expression in MM cells transfected with sh-CD44 plasmids. CD44 expression was decreased in MM cells transfected with sh-CD44 plasmids by western blot examination. (JPG 115 kb)
Data Availability Statement
No datasets were generated or analyzed during the current study.





