Dietary arachidonic acid improves the growth performance, anti-oxidant capacity and ovary development of female rice field eel broodstocks (Monopterus albus)

Abstract

Arachidonic acid (ARA) is crucial for the growth, antioxidant capacity, and reproductive performance of fish. This study was conducted to assess the impact of dietary ARA on female rice field eel (Monopterus albus) broodstocks. A total of 600 eels, averaging 117.96 ± 3.65 g, were randomly distributed into 12 tanks, with each tank containing 50 fish. Four isonitrogenous and isolipidic diets comprising 0, 0.50%, 1.00%, and 1.50% ARA were formulated and fed to experimental fish for 10 weeks. Weight gain rates (WGR) increased significantly in 0.50% and 1.00% ARA groups compared to the control (ANOVA, P = 0.001; quadratic, P < 0.001). The lowest WGR and hepatosomatic index (HSI) values were observed in the 1.50% ARA group. Ovarian crude lipid content decreased in response to the increase of dietary ARA (P < 0.001). Serum alanine aminotransferase (ALT) activity was significantly reduced in 1.00% and 1.50% ARA groups (linear and quadratic, P < 0.01). Compared to the control, dietary addition of ARA up to 1.50% increased hepatic superoxide dismutase activity and decreased malondialdehyde content linearly and quadratically (P < 0.01). The ovarian ARA proportion was significantly increased in dietary ARA groups (P < 0.001). Dietary ARA increased the concentration of serum estradiol (E2), and contents of ovarian prostaglandin E2 (PGE2) and vitellogenin (VTG) (P < 0.05). The mRNA levels of ovarian cytochrome P450 (cyp19a1a), luteinizing hormone receptor (lhr), and hepatic vitellogenin (vtg) were significantly upregulated following ARA treatment (P < 0.05). In summary, dietary ARA supplementation increased the growth performance and ovarian deposition of ARA, and reduced the ovarian crude lipid content of M. albus. Dietary ARA may regulate the synthesis of steroid hormones and VTG by enhancing the PGE2 downstream signaling pathway, thereby promoting gonadal development in female M. albus broodstock. The optimal dietary ARA supplementation for female M. albus broodstock is suggested to be 10.00 g/kg.

1. Introduction

Fatty acids are essential for fish metabolism, serving as the main energy source for growth and reproduction (Tocher, 2003). The lipid and fatty acid composition in broodstock diets significantly influences fish reproduction success and offspring survival (Izquierdo et al., 2001). Some unsaturated fatty acids, including arachidonic acid (ARA), docosahexaenoic acid (DHA), and eicosapentaenoic acid (EPA), are crucial for fish health (Lin et al., 2018). They cannot be synthesized by most carnivorous fish from dietary precursors, and need to be provided in the diet (Trushenski and Rombenso, 2020). Although freshwater fish can synthesize long chain polyunsaturated fatty acids (LC-PUFAs) via sequential elongation and desaturation, their capacity to convert LC-PUFAs is constrained and inadequate to meet sexual maturity demands, which might lead to unsuccessful reproduction (Tocher et al., 2003).

In contrast to the extensive investigations into the reproductive modulation effects of DHA and EPA, limited research on ARA has been reported. Nevertheless, ARA and ARA-derived products are crucial in steroidogenesis, follicle maturation, and ovulation (Franҫois and Glen, 1996; Patino et al., 2003; Wang and M. Stocco, 1999). In Blue gourami (Trichopodus trichopterus), reproductive performance was enhanced by 10.00 g/kg dietary ARA supplementation (Masoudi Asil et al., 2017). Dietary ARA addition (10.00 g/kg) increased serum estradiol (E2) content and upregulated the transcriptional expression of vitellogenin (vtg) in Chinese sturgeon (Acipenser sinensis) (Wu et al., 2021). Dietary ARA supplementation (4.67% and 10.07% of total fatty acids) enhanced steroid hormone levels, reproductive performance, and juvenile quality in yellow catfish (Pelteobagrus fulvidraco) (Fei et al., 2020).

The rice field eel (Monopterus albus) is a hermaphroditic freshwater fish species that naturally undergoes a sex change from female to male during its life cycle (Yue et al., 2020). This species was crucial to China's commercial fish farming industry, producing 355,203 t in 2023 (Bureau of Fisheries of the Ministry of Agriculture and Rural Affairs of China, 2024). To date, commercial compound diets have not met the nutritional requirements for successful ovary maturation and spawning of M. albus broodstocks (Jiang et al., 2024). Larvae and broodstocks for breeding primarily rely on wild capture, which represents as a major challenge in large-scale cultures of M. albus (Jiang et al., 2023). Gonadal development is a prerequisite for successful breeding of this species. Therefore, exploring suitable dietary supplements for diet optimization is urgently needed to improve gonadal development in M. albus.

A previous study showed that levels of ARA was significantly higher in the ovaries of wild M. albus than that in cultured individuals (Jiang et al., 2023). This finding aligns with earlier studies indicating that wild fish eggs typically contain a higher proportion of ARA compared to farmed fish eggs (Pickova et al., 2007; Salze et al., 2005). In addition, supplementation of dietary ARA at proportions of 1.40% and 2.80% enhanced growth performance and ovarian maturation, and delayed sexual reversal in M. albus females (Jiang et al., 2023). However, optimum ARA supplementation and its possible mechanism in ovarian development promotion remain unclear. This study seeks to investigate the appropriate dietary ARA supplementation for female rice field eel broodstocks. In addition, the concentrations of sex-related hormones and gene transcription changes were detected to determine the possible molecular regulation of ovary development.

2. Materials and methods

2.1. Animal ethics statement

Fish handling procedures were conducted with approval from the Animal Care and Use Committee of the Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences (approval no. YFI2023YHM01).

2.2. Experimental diet

Four diets with equal level of nitrogen (457.00 g/kg) and equal level of lipid (87.60 g/kg) were prepared, incorporating ARA at concentrations of 0, 5.00, 10.00, and 15.00 g/kg, labeled as ARA 0, ARA 0.5, ARA 1.0, and ARA 1.5, respectively (Fei et al., 2020; Wu et al., 2021). Fish meal, fish oil, and ARA oil (Hubei Fuxing Biotechnology Co., Ltd., Hanchuan, Hubei, China) served as the main protein and lipid sources, while α-starch was used as the primary carbohydrate source. The primary fatty acids of ARA oil contained 44.88% ARA, 9.80% tetracosanoic acid, 8.91% palmitic acid, and 6.03% stearic acid. Table 1 details the ingredients and proximate composition of the diets, while Table 2 outlines the fatty acid composition. Ingredients were mashed, sieved through a 60-mesh sieve, precisely weighed, and incrementally mixed with fish oil to achieve uniformity. Water was incorporated into the final blend to create a dough, which subsequently underwent processing by a meat mincer to yield 3-mm diameter pellets. The pellet diets were air-dried using an electric fan and stored at −20 °C for future use.

Table 1.

Formulation and proximate composition of the experimental diets (g/kg DM basis).

Item	ARA 0	ARA 0.5%	ARA 1.0%	ARA 1.5%
Ingredients
Fish meal	420.00	420.00	420.00	420.00
α-starch	200.00	200.00	200.00	200.00
Soybean meal	109.90	109.90	109.90	109.90
Blood meal	60.00	60.00	60.00	60.00
Brewer yeast	50.00	50.00	50.00	50.00
Casein	60.00	60.00	60.00	60.00
Fish oil	60.00	48.90	37.80	26.70
Premix1	10.00	10.00	10.00	10.00
Choline	5.00	5.00	5.00	5.00
Ca(H2PO4)2	10.00	10.00	10.00	10.00
Antioxidant2	0.10	0.10	0.10	0.10
Earthworm meal	10.00	10.00	10.00	10.00
Mold inhibitor3	5.00	5.00	5.00	5.00
ARA enriched oil, 44.88%	0.00	11.10	22.20	33.30
Total	1000.00	1000.00	1000.00	1000.00
Proximate composition
Crude protein	457.40	456.90	458.80	457.10
Crude lipid	88.80	88.70	86.90	86.30
ARA4	0.97	6.88	12.29	18.35

ARA = arachidonic acid.

¹The vitamin and mineral premix provided in one kilogram of diet: 1500 mg MgSO₄·H₂O, 1250 mg FeSO₄·H₂O, 500 mg NaCl, 175 mg ZnSO₄·H₂O, 80 mg MnSO₄·H₂O, 15 mg CuSO₄·5H₂O, 2.5 mg CoCl₂·6H₂O, 1.5 mg KI, 1.0 mg Na₂SeO₃·5H₂O, 100 mg inositol, 50 mg vitamin E, 50 mg niacin, 40 mg pantothenic acid, 35 mg vitamin D₃, 25 mg vitamin A, 12 mg riboflavin, 12 mg vitamin B₁, 8 mg vitamin K₃, 8 mg vitamin B₆, 5 mg folic acid, 0.8 mg biotin, and 0.05 mg vitamin B₁₂.

²The antioxidant comprises 0.1% butylated hydroxytoluene.

³The mold inhibitor comprises sodium benzyl alcohol 40%, gluconolactone 30%, sodium dehydroacetate 10%, sorbic acid methyl 10%, and disodium EDTA 10%.

⁴ARA contents were calculated by multiplying the crude lipid content of the diet in Table 1 by the ARA percentage in the fatty acids in Table 2.

Table 2.

Composition of fatty acids (% of total fatty acids) in experimental diets.

Item	ARA 0	ARA 0.5%	ARA 1.0%	ARA 1.5%
C10:0	0.07	0.05	0.05	0.06
C12:0	0.11	0.09	0.07	0.06
C13:0	0.06	0.05	0.04	0.00
C14:0	5.74	5.00	4.13	3.56
C14:1	0.08	0.06	0.04	0.00
C15:0	0.60	0.54	0.46	0.41
C16:0	21.75	20.91	19.24	17.68
C16:1	7.82	6.94	5.76	4.79
C17:0	0.56	0.50	0.43	0.36
C18:0	4.69	4.83	4.95	4.96
C18:1n-9	18.20	16.11	14.25	12.53
C18:2n-6	7.48	6.93	6.73	6.48
C18:3n-6	0.00	0.54	0.90	1.32
C18:3n-3	1.63	1.42	1.31	0.99
C20:0	0.70	0.64	0.61	0.58
C20:1	2.97	2.75	2.50	1.94
C20:2	0.37	0.41	0.46	0.47
C20:3n-6	0.19	1.05	1.84	2.74
C20:4n-6 (ARA)	1.10	7.77	14.15	21.27
C20:5n-3 (EPA)	0.00	0.87	2.04	2.56
C22:0	0.20	0.45	0.79	1.03
C22:1n-9	0.31	0.36	0.30	0.26
C22:6n-3 (DHA)	13.83	11.97	10.05	8.33
C24:0	10.95	9.30	8.36	7.14
C24:1	0.59	0.47	0.54	0.49
Total saturated fatty acids	45.43	42.36	39.13	35.83
MUFA	29.98	26.68	23.39	20.01
PUFA	24.60	30.96	37.49	44.16
Omega3	15.46	14.26	13.40	11.85
Omega6	8.77	16.29	23.63	31.81
Omega3/Omega6 ratio	1.76	0.88	0.57	0.37
ARA/EPA ratio		8.89	6.92	8.30
ARA/DHA ratio	0.08	0.65	1.41	2.55
DHA/EPA ratio		13.70	4.91	3.25

ARA = arachidonic acid; DHA = docosahexaenoic acid; EPA = eicosapentaenoic acid; MUFA = monounsaturated fatty acid; PUFA = polyunsaturated fatty acid.

2.3. Feeding management

Female cultured broodstock of rice field eels of 117.96 ± 3.65 g in weight and 43.31 ± 0.36 cm in length were acquired from a fish breeding farm (Qianjiang, China). The feeding trial was conducted indoors using plastic cubic tanks (1.50 m × 1.00 m × 0.50 m) at the Liangzi Lake Experimental Site, part of the Yangtze River Fisheries Research Institute, Chinese Academy of Fisheries Science. Following the acclimatization period of one week, the fish were allotted randomly into 12 tanks, with 50 individuals per replicate. During the experiment, fish in each group received manual feeding once a day (between 17:00 and 19:00) at roughly 2% to 3% of their body mass for 10 weeks. Following 2 h of feeding, left-over diet was gathered, dehydrated, and weighed. Each morning, feces were siphoned out, and one-third of the tank water was replaced. To assist with routine water replenishment, a plastic pipe was pierced and affixed at a 15.00-cm height outside the tank. The experiment was conducted with water temperatures ranging from 20 to 28 °C, dissolved oxygen levels exceeding 5.00 mg/L, and ammonia nitrogen concentrations being lower than 0.05 mg/L.

2.4. Sample collection

Following the feeding trial, the eels were subjected to a 24-h fasting period. The total fish weight and numbers in each tank were recorded. Individual sampled fish were anesthetized using 100 mg/L MS-222 (Sigma, Darmstadt, Germany) and weighed. Blood samples from three individuals per tank were collected through caudal venipuncture and allowed to coagulate at 4 °C for 12 h. Following centrifugation at 3000 × g for 10 min, the serum was extracted and stored at −80 °C. The hepatosomatic index (HSI), viscerosomatic index (VSI), and gonadosomatic index (GSI) were determined by dissecting and weighing the liver, entire viscera, and ovary from nine fish per tank. Tissue samples of liver and ovary were excised and divided into two sections. A section was immersed in liquid nitrogen and subsequently stored at −80 °C for analysis of biochemical parameters and gene transcription. The remaining section was stored at −20 °C for analysis of proximate and fatty acid composition.

2.5. Proximate composition

The proximate composition of diets and ovary samples was analyzed in triplicate according to Association of Official Analytical Chemists (AOAC, 2023) protocols, as follows. Ovaries from five fish per tank were mixed for measuring proximate composition. The moisture content was determined by drying the sample at 105 °C for 22 h (method 934.01). The crude protein content was evaluated using the Kjeldahl method (method 954.01) by an auto-analyser (K9840; Hanon Future Technology Group Co., Ltd., Jinan, Shandong, China). Soxhlet extraction with petroleum ether was applied for the crude lipid content determination (method 920.39). The ash content of ovary samples was measured by incinerating samples at 550 °C for 6 h in a muffle furnace (SX-4-10; Henan Sante Furnace Technology Co., Ltd., Luoyang, Henan, China) according to AOAC method 942.05. The ARA contents in the diets were calculated by multiplying the crude lipid content of the diet by the ratio of ARA to the total fatty acids of diets as illustrated in the following part of 2.7.

2.6. Biochemical parameters analysis

Hematological parameters such as albumin (ALB), alanine aminotransferase (ALT), aspartate aminotransferase (AST), cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) were assessed using the Mindray BS-460 automatic analyzer (Shenzhen Mindray Bio-Medical Electronics Co., Ltd., Shenzhen, China). Serum E2 levels were measured with the ADVIA Centaur XP Immunoassay System (Siemens Healthcare Diagnostics Inc., Dublin, Ireland).

Hepatic antioxidant parameters, such as superoxide dismutase (SOD), catalase (CAT), and malondialdehyde (MDA) levels, were measured using commercial kits according to the manufacturer's instructions (Item numbers A001-3-2, A007-1-1, and A003-1-2, Nanjing Jiangcheng Institute of Biological Engineering, Nanjing, Jiangsu, China). Liver samples were homogenized in a 9-fold volume of ice-cold physiological saline (w/v). Supernatants were collected by centrifugation at 2500 × g for 10 min. The SOD activity was assessed by combining supernatants with a reaction mixture comprising 50 mmol/L potassium phosphate buffer (pH 7.8), 0.1 mmol/L ethylene diamine tetra-acetic acid (EDTA), 0.1 mmol/L xanthine, 0.013 mmol/L cytochrome, and 0.024 IU/mL xanthine oxidase. A unit of SOD activity is the enzyme amount needed to suppress the ferricytochrome C reduction rate by 50%, measured spectrophotometrically at 550 nm. Liver supernatant samples for CAT activity were combined with a reaction mixture of 30 mmol/L hydrogen peroxide and 50 mmol/L phosphate buffered saline (PBS) at pH 7.8. One unit of CAT activity was defined as the enzyme required to decompose 1 μmol of hydrogen peroxide (H₂O₂) per second, measured by absorbance at 405 nm. The MDA content was assessed using the thiobarbituric acid (TBA) method, measuring absorbance at 532 nm. Data conversion and standardization were performed based on protein concentration.

Ovarian VTG and prostaglandin E2 (PGE2) levels were measured using enzyme-linked immunosorbent assay (ELISA) kits (Item numbers RXJ1300790F and RXJ1300929F, Quanzhou Ruixin Biotechnology Co., Ltd., Quanzhou, Fujian, China). Samples were weighed, homogenized, and thoroughly mixed in a PBS solution (pH 7.2-7.4). Following centrifugation at 5000 × g for 10 min, the supernatant from each sample was collected and incubated in testing wells for 60 min for VTG or 15 min for PGE2. Absorbance was determined at 450 nm.

2.7. Analysis of fatty acid composition

Diets and ovary samples from each group were weighed and crushed by freeze-drying. Each sample was diluted with a mixed solvent (chloroform:methanol = 2:1, v/v), sonicated for extraction, and then filtered. Filtrates were pooled from three replicates. The filtrate was treated with 2 mL of sodium hydroxide methanol solution, heated in a 60 °C water bath for 30 min, and then cooled. The mixture with BF3-methanol was subjected to a 60 °C water bath for 20 min, followed by the addition of n-hexane and saturated sodium chloride after cooling. The resulting mixture was extracted by oscillation and subjected to static stratification. Gas chromatography-flame ionization detection was performed using a Shimadzu GC-2030 gas chromatograph equipped with a gas chromatography capillary column (DB-WAX UI, Agilent J&W Scientific, Santa Clara, California, USA). Both the inlet and detector were maintained at 250 °C, utilizing high-purity nitrogen for flow. Hydrogen (H₂) and air gases were set at 3, 40, and 40 mL/min, respectively. Fatty acids in samples were identified by aligning retention times with standards, and peak areas were quantified as a percentage of the total fatty acid methyl ester content.

2.8. Gene expression analysis

Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and its concentration and quality were assessed via gel electrophoresis and a Nanodrop2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The cDNA was synthesized using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara Bio Inc., Kyoto, Japan). Quantitative real-time PCR was performed in a 20-μL volume using SYBR Green PCR Master Mix (Takara Bio Inc., Kyoto, Japan) according to the manufacturer's instructions. Ribosomal protein L17 (rpl-17) was selected as the housekeeping gene based on previous research (Hu et al., 2014), and relative gene expression changes were assessed using the 2^−ΔΔCt method. Primers were selected using the online Primer-BLAST of the NCBI website (https://www.ncbi.nlm.nih.gov/tools/primer-blast/), with the following criteria: no hairpin, guanine and cytosine contents between 40% and 60%, amplification temperatures (T_m) between 50 and 60 °C, and amplification product lengths from 100 to 300 base pairs (bp). All primers included in this research encompassed the amplification efficiency of 90% to 110% and R² ≥ 0.99. The NCBI GenBank numbers of the amplified gene sequences, corresponding primer sequences, annealing temperatures, and amplification efficiencies are provided in Table 3.

Table 3.

The RT-qPCR primer sequences utilized in the experiment.

Gene	GenBank no.	Forward (5′-3′)	Reverse (5′-3′)	Amplification length, bp	Annealing temperature, °C	Efficiency, %
cyp19a1a	XM_020605765.1	GCCACTTTTGTCATATGTGAGATTC	CCACAGAGCTACGTTGTTGTTAAAT	253	56.50	104.45
hsd3β	XM_020586257.1	AATCCTGTCTATGTGGGCAAC	CATCAAGACATGGTTAAGGTCCGA	156	57.00	92.59
Star	XM_020590513.1	CCCACGAGGTTTCCACAGAG	CACAGGGCTTGATAACAATACAGG	192	57.00	105.01
Er	XM_020603920.1	AGGAGGTCGTGGTGTCATCG	GCTCTTACGGCGGTTCTTGTCT	200	57.00	92.71
Fshr	XM_020605116.1	GCACACCATCACTTACGCC	CACCCGAGACTCCACATCC	175	56.50	93.08
Lhr	XM_020603272.1	GAGCATCTCTAACACAGGGA	GGCAGGAATGAAGTCAATC	115	52.00	100.26
Vtg	XM_020589403.1	TACCCCAAAACTTCCATCTTGCC	ATGAAAGCAGTATTCACGCCCAT	118	53.50	100.12
rpl-17	XM_020587712.1	GTTGTAGCGACGGAAAGGGAC	GACTAAATCATGCAAGTCGAGGG	160	52.00–57.00	98.00

RT-qPCR = relative quantitative real-time PCR; bp = base pair; cyp19a1a = cytochrome P450; hsd3β = 3β-hydroxysteroid dehydrogenase; star = acute steroid regulator; er = estrogen receptor; fshr = follicle-stimulating hormone receptor; lhr = luteinizing hormone receptor; vtg = vitellogenin; rpl-17 = ribosomal protein L17.

2.9. Calculations and statistical analysis

$$\text{Survival}\text{rate}\left(\text{SR},\%\right)=100\times \text{Final}\text{number}\text{of}\text{fish}/\text{Initial}\text{number}\text{of}\text{fish,}$$

$$\text{Weight}\text{gain}\left(\text{WG},\%\right)=100\times \left(\text{Final}\text{body}\text{weight}–\text{Initial}\text{body}\text{weight}\right)/\text{Initial}\text{body}\text{weight,}$$

$$\text{HSI}\left(\%\right)=100\times \text{Hepatopancreas}\text{weight}/\text{Body}\text{weight,}$$

$$\text{VSI}\left(\%\right)=100\times \text{Visceral}\text{weight}/\text{Body}\text{weight,}$$

$$\text{GSI}\left(\%\right)=100\times \mathrm{G}\text{onad}\text{weight}/\text{Body}\text{weight.}$$

Statistical analyses were performed using SPSS 25.0 software (IBM Corp., Armonk, NY, USA) employing one-way ANOVA. The statistical model applied was the following:

$$Y_{ij}=\mu +T_i+e_{ij}\text{,}$$

where Y_ij denotes the dependent variable observation, μ is the overall mean, T_i represents the fixed treatment effect, and e_ij is the residual error. Duncan's multiple comparison test was adopted to determine significant differences at the P < 0.05 level when data normality and variance homogeneity were confirmed. A Dunnett's T3 test was employed for comparative analysis in cases of non-homogeneous variances. Using SPSS 25.0, linear and quadratic regression analyses were performed to examine the relationship between ARA concentrations and the measured parameters.

3. Results

3.1. Growth performance and morphological parameters

Fish fed with 0.50% and 1.00% ARA diets exhibited significantly higher WGR values compared to the other groups (ANOVA, P = 0.001; quadratic, P < 0.001; Table 4). The lowest WGR was found in the ARA 1.5 group. The HSI value in the ARA 1.5 group was lower than in the ARA 0, ARA 0.5, and ARA 1.0 groups, with no significant differences observed among the latter three groups (P > 0.05). The SR, VSI, and GSI were not significantly changed by dietary ARA supplementation (P > 0.05). There was a linear relationship between the HSI and dietary ARA concentrations.

Table 4.

Impact of ARA supplementation on growth performance and morphometric parameters in female Monopterus albus broodstocks (%).

Item	Dietary treatments				SEM	P-value
	ARA 0	ARA 0.5	ARA 1.0	ARA 1.5		ANOVA	Linear	Quadratic
Survival	92.95	100.00	97.79	81.48	3.954	0.394	0.323	0.206
WGR	12.47b	21.84a	17.94a	6.44c	1.870	0.001	0.202	<0.001
VSI	14.90	14.88	14.75	13.93	0.235	0.424	0.151	0.252
HSI	3.59a	3.19ab	3.24ab	2.63b	0.124	0.047	0.009	0.032
GSI	10.75	11.01	12.09	13.13	0.356	0.063	0.008	0.026

ARA = arachidonic acid; GSI = gonadosomatic index; HSI = hepatosomatic index; SEM = standard error of the mean; VSI = viscerosomatic index; WGR = weight gain rate.

Significant differences (P < 0.05) in the same row are indicated by different letters.

3.2. Ovary proximate composition

The ovarian crude lipid content in female rice field eels declined with higher dietary ARA levels (P < 0.001; Table 5). The highest ovarian ash content was present in fish fed 1.50% ARA, while the lowest was recorded in the ARA 1.0 group. Ovarian crude protein and moisture contents in the fish did not significantly differ among the four treatment groups (P > 0.05). A linear relationship was observed between ovarian crude lipid content and dietary ARA levels.

Table 5.

Effect of ARA supplementation on ovarian proximate composition of female Monopterus albus broodstocks (%).

Item	Dietary treatments				SEM	P-value
	ARA 0	ARA 0.5	ARA 1.0	ARA 1.5		ANOVA	Linear	Quadratic
Crude protein	21.80	22.33	21.83	22.48	0.127	0.087	0.176	0.409
Crude lipid	6.43a	5.15b	4.86c	3.99d	0.264	<0.001	<0.001	<0.001
Ash	1.82b	1.76bc	1.62c	2.23a	0.070	<0.001	0.080	0.001
Moisture	67.25	68.00	69.13	68.43	0.440	0.642	0.322	0.495

ARA = arachidonic acid; SEM = standard error of the mean.

Significant differences (P < 0.05) in the same row are indicated by different letters.

3.3. Serum biochemistry

The ALT activity gradually decreased with increasing ARA supplementation (Table 6). The ARA 1.0 group exhibited significantly elevated levels of TC (ANOVA, P = 0.01) and HDL-C (ANOVA and quadratic, P < 0.05) compared to the other groups. No significant differences in AST activity or LDL-C and ALB concentrations were observed among the four groups (P > 0.05).

Table 6.

Effect of ARA supplementation on serum biochemical indicators of female Monopterus albus broodstocks.

Item	Dietary treatments				SEM	P-value
	ARA 0	ARA 0.5	ARA 1.0	ARA 1.5		ANOVA	Linear	Quadratic
ALT, U/L	2.48a	2.08ab	1.70b	1.70b	0.109	0.018	0.003	0.006
AST, U/L	11.25	11.62	12.53	13.40	0.543	0.509	0.125	0.307
TC, mmol/L	4.19b	4.16b	4.73a	4.11b	0.080	0.010	0.645	0.158
LDL-C, mmol/L	0.40	0.42	0.49	0.49	0.019	0.256	0.059	0.166
HDL-C, mmol/L	2.57b	2.53b	2.83a	2.29b	0.053	0.001	0.263	0.023
ALB, g/L	17.03	17.83	18.22	16.17	0.290	0.049	0.406	0.026

ARA = arachidonic acid; ALB = albumin; ALT = alanine aminotransferase; AST = aspartate aminotransferase; HDL-C = high density lipoprotein cholesterol; LDL-C = low density lipoprotein cholesterol; SEM = standard error of the mean; TC = cholesterol.

Significant differences in the same row are indicated by different letters (P < 0.05).

3.4. Fatty acid profile of ovary

The ovarian fatty acid profiles of female broodstocks are shown in Table 7. Dietary supplementation of ARA increased the total saturated fatty acid concentrations compared to those in the control group. Dietary ARA supplementation increased the levels of saturated fatty acids C16:0, C17:0, and C18:0 (ANOVA, P < 0.001), while decreasing C14:0 content compared to the control group (ANOVA, P < 0.001). The highest and lowest C15:0 contents were found in the ARA1.5 and ARA 0.5 groups, respectively. Total monounsaturated fatty acids (MUFA) decreased as dietary ARA increased. The ARA 0.5 group exhibited reduced concentrations of total polyunsaturated fatty acids (PUFA) and lower levels of linoleic acid (C18:2n-6), linolenic acid (C18:3n-3), and EPA (C20:5n-3) compared to the control, whereas these concentrations increased in the ARA 1.0 and ARA 1.5 groups (P < 0.05). The ARA (C20:4n-6), n-6 polyunsaturated fatty acid (omega 6), and the ratios of ARA/EPA and ARA/DHA were increased by dietary ARA treatment (P < 0.05). The DHA (C22: 6n-3) levels and ovarian omega 3/omega 6 ratios were significantly lower in fish fed ARA-supplemented diets (ARA 0.5, ARA 1.0, and ARA 1.5 groups) compared to those in the ARA 0 group (P < 0.05). There was a linear relationship between the ovarian ARA content and dietary ARA levels.

Table 7.

Impact of ARA supplementation on ovarian fatty acid composition (% of total fatty acids) in female Monopterus albus broodstocks.

Item	Dietary treatments				SEM	P-value
	ARA 0	ARA 0.5	ARA 1.0	ARA 1.5		ANOVA	Linear	Quadratic
C14:0	2.44a	2.00c	2.15b	2.16b	0.050	<0.001	0.309	0.242
C14:1	0.02	0.02	0.02	0.02	0.001	0.778	0.441	0.715
C15:0	0.57bc	0.52c	0.62ab	0.73a	0.025	<0.001	<0.001	<0.001
C15:1	0.07ab	0.06b	0.09a	0.08ab	0.004	<0.001	0.009	0.025
C16:0	26.10b	25.62c	26.31b	28.16a	0.294	<0.001	0.002	<0.001
C16:1	12.19a	10.81b	10.73b	9.47c	0.291	<0.001	<0.001	<0.001
C17:0	0.49d	0.52c	0.58b	0.71a	0.026	<0.001	<0.001	<0.001
C18:0	6.50c	8.53a	7.17b	8.30a	0.253	<0.001	0.167	0.405
C18:1n-9t	0.18b	0.18b	0.19a	0.18b	0.002	0.003	0.083	0.003
C18:1n-9c	21.72b	22.77a	19.43c	19.21c	0.457	<0.001	<0.001	0.002
C18:2n-6	5.36b	5.02c	5.59a	5.70a	0.080	<0.001	0.005	0.013
C20:0	0.24b	0.27c	0.23b	0.28a	0.007	0.001	0.222	0.202
C18:3n-6	0.10d	0.18c	0.24a	0.20b	0.015	<0.001	0.004	<0.001
C20:1	0.79a	0.81a	0.61c	0.65b	0.026	<0.001	0.001	0.006
C18:3n-3	1.36b	1.19c	1.45a	1.43a	0.032	<0.001	0.036	0.113
C20:2	0.44bc	0.42c	0.48a	0.46ab	0.008	0.011	0.048	0.157
C20:3n-6	0.24c	0.54b	0.60a	0.53b	0.043	<0.001	0.018	0.005
C22:1n-9	0.07b	0.10a	0.08b	0.09b	0.004	0.004	0.855	0.743
C20:3n-3	0.25b	0.29b	0.35a	0.36a	0.015	<0.001	<0.001	<0.001
C20:4n-6 (ARA)	1.71d	3.71c	4.38a	3.92b	0.308	<0.001	0.006	<0.001
C20:5n-3 (EPA)	2.65b	2.20d	2.50c	2.87a	0.076	<0.001	0.092	0.009
C22:6n-3 (DHA)	16.51a	14.20c	16.18b	14.47c	0.310	<0.001	0.27	0.538
Total saturates	36.34c	37.44b	37.07b	40.36a	0.466	<0.001	0.002	<0.001
Total MUFA	35.03a	34.75b	31.16c	29.70d	0.691	<0.001	<0.001	<0.001
Total PUFA	28.63c	27.81d	31.77a	29.94b	0.460	<0.001	0.025	0.042
Omega3	20.77a	17.97c	20.48a	19.12b	0.344	<0.001	0.693	0.908
Omega6	7.41d	9.46c	10.81a	10.35b	0.394	<0.001	0.001	<0.001
Omega3/Omega6 ratio	2.80a	1.90b	1.90b	1.85b	0.121	<0.001	0.008	0.007
ARA/EPA ratio	0.64d	1.69b	1.75a	1.37c	0.133	<0.001	0.114	0.011
ARA/DHA ratio	0.10c	0.26b	0.27a	0.27a	0.021	<0.001	0.007	0.006
DHA/EPA ratio	6.22b	6.47a	6.48a	5.05c	0.180	<0.001	0.014	<0.001

ARA = arachidonic acid; DHA = docosahexaenoic acid; EPA = eicosapentaenoic acid; MUFA = monounsaturated fatty acid; PUFA = polyunsaturated fatty acid; SEM = standard error of the mean.

Significant differences (P < 0.05) in the same row are indicated by different letters.

3.5. Antioxidant activity

Hepatic SOD activity exhibited an upward trend from ARA 0 to ARA 1.5 groups by increasing dietary ARA treatments (Table 8). The MDA content in fish from the ARA 1.5 group was lower compared to the ARA 0 and ARA 0.5 groups. The MDA content showed no significant differences across the ARA 0, ARA 0.5, and ARA 1.0 groups. Dietary ARA supplementation did not significantly affect CAT activity (P > 0.05). Linear relationships were observed between SOD activity, MDA content, and dietary ARA concentration.

Table 8.

Activities of SOD and CAT, and concentrations of MDA in the liver of female Monopterus albus broodstocks.

Item	Dietary treatments				SEM	P-value
	ARA 0	ARA 0.5	ARA 1.0	ARA 1.5		ANOVA	Linear	Quadratic
SOD, U/mL	36.21b	39.74ab	45.92ab	51.91a	1.889	0.008	<0.001	0.002
CAT, U/mg prot	9.06	9.42	10.07	10.42	0.304	0.391	0.078	0.220
MDA, nmol/mg prot	5.08a	4.87a	3.94ab	3.45b	0.218	0.014	0.001	0.005

ARA = arachidonic acid; CAT = catalase; MDA = malondialdehyde; SEM = standard error of the mean; SOD = superoxide dismutase.

Significant differences (P < 0.05) in the same row are indicated by different letters.

3.6. Concentrations of estradiol, vitellogenin and prostaglandin

The serum E2 concentration was highest in fish fed the ARA 1.5 diet, while no significant differences were found among the groups fed diets with 0, 1.0%, and 1.5% ARA (P > 0.05) (Table 9). Dietary ARA supplementation significantly elevated ovarian VTG content compared to the control group linearly, quadratically and in ANOVA analysis (P < 0.001). Fish-fed groups with ARA 1.0 and ARA 1.5 diets exhibited elevated ovarian PGE2 levels compared to the control group linearly and quadratically (P < 0.001). No significant difference in PGE2 content was observed in the ARA 0 and ARA 0.5 groups (P > 0.05).

Table 9.

The content of estradiol in the serum and the content of vitellogenin and prostaglandin in the ovary of female Monopterus albus broodstocks.

Item	Dietary treatments				SEM	P-value
	ARA 0	ARA 0.5	ARA 1.0	ARA 1.5		ANOVA	Linear	Quadratic
E2, pg/mL	234.97b	236.30b	341.82ab	391.80a	22.701	0.018	0.002	0.009
VTG, ng/g	40.92c	42.69b	43.94ab	45.23a	0.414	<0.001	<0.001	<0.001
PGE2, ng/g	162.34b	173.69ab	189.43a	190.79a	3.262	0.001	<0.001	<0.001

ARA = arachidonic acid; E2 = estradiol; PGE2 = prostaglandin E2; SEM = standard error of the mean; VTG = vitellogenin.

Significant differences (P < 0.05) in the same row are indicated by different letters.

3.7. Steroidogenesis related gene transcription

Transcripts of ovarian cytochrome P450 (cyp19a1a) in fish fed ARA 1.0 and ARA 1.5 diets groups were higher than those in the control and ARA 0.5 diet groups (P = 0.012) (Fig. 1). Fish fed ARA 0.5 diet group exhibited higher transcription levels of the luteinizing hormone receptor (lhr) than fish in the other three groups (ANOVA, P < 0.001). The mRNA levels of the ovarian estrogen receptor (er) gene were significantly decreased by dietary ARA treatment (ANOVA, linear and quadratic, P < 0.001). Compared to the control, dietary ARA supplementation increased the hepatic vitellogenin (vtg) transcription linearly (P < 0.001), quadratically (P = 0.002) and in ANOVA analysis (P = 0.008), and the highest mRNA transcription was present in fish fed ARA 1.5 group. Transcriptional levels of 3β-hydroxysteroid dehydrogenase (hsd3β), acute steroid regulator (star), and follicle-stimulating hormone receptor (fshr) genes were not considerably influenced by varying dietary ARA concentrations (P > 0.05) (Fig. 1).

Fig. 1.

Relative transcription of genes related to steroidogenesis in ovary (cyp19a1a, hsd3β, star, er, fshr, lhr) and liver (vtg) of female Monopterus albus broodstocks. ARA = arachidonic acid; A = one-way ANOVA; L = linear regression; Q = quadratic regression; cyp19a1a = cytochrome P450; er = estrogen receptor; fshr = follicle-stimulating hormone receptor; hsd3β = 3β-hydroxysteroid dehydrogenase; lhr = luteinizing hormone receptor; star = steroidogenic acute regulatory protein; vtg = vitellogenin. Bars with different letters indicate significant differences (P < 0.05).

4. Discussion

Cultured rice field eel broodstocks are primarily fed a combination of wild trash fish and commercial pellet diets, rendering them unsuitable for artificial propagation (Zhou et al., 2011). Thus, commercially formulated diets of M. albus have not met the nutritional requirements for gonad development and spawning. Functional supplements for optimizing diet formulation may solve this problem. The representative n-6 polyunsaturated fatty acid ARA plays pivotal roles in various physiological activities in fish. This study assessed the impact of dietary ARA on growth performance, liver antioxidant capacity, ovarian composition, fatty acid profile, steroid hormones, and gene transcription related to steroidogenesis in M. albus. The findings suggest that ARA supplementation enhances both the overall performance and gonadal development of this fish species. The data could facilitate the improvement of diet formulation for M. albus broodstocks, and the regulation mechanism elucidation of ARA on gonadal development in freshwater fish.

4.1. Diverse influence of dietary ARA on the growth performance of rice field eels

The impact of dietary arachidonic acid (ARA) on fish growth remains uncertain. Studies have shown that dietary ARA does not significantly affect the growth performance of grass carp (Ctenopharyngodon idellus) (Tian et al., 2014), Atlantic salmon (Salmo salar) (Dantagnan et al., 2017), or Malabar red snapper (Lutjanus malabaricus) (Chee et al., 2020). In contrast, ARA negatively affected the growth of Pacific white shrimp (Litopenaeus vannamei) (Araújo et al., 2020) and black sea urchins (Diadema setosum, Leske, 1778) (Nhan et al., 2020). Our study showed that 0.50% and 1.00% dietary ARA improved the growth performance of female rice field eel broodstocks (Table 4). The result was consistent with findings in Japanese bass (0.08%−0.36%) (Xu et al., 2010), Japanese flounder (0.75%−1.0%) (Estevez et al., 1997), yellow catfish (0.60%−0.90%) (Ma et al., 2018), and European seabass (1.0%−4.0%) (Torrecillas et al., 2018). Elevated dietary ARA levels (1.50%) negatively impacted the growth performance of M. albus (Table 4). In a previous study, 1.40% and 2.80% dietary ARA improved the growth performance of M. albus with a crude protein content of 43% and varying levels of crude lipid from 9.16% to 10.86% in the experimental diets (Jiang et al., 2023). In our study, the experimental diets contained approximately 46.00% crude protein and 8.70% lipid. The ARA proportion in the ARA 1.5 diet group was 21.27 (Table 2), exceeding the 19.43% reported for the 2.80% diet group in a previous study (Jiang et al., 2023). Therefore, the inconsistency may be due to differences in the proximate composition and ARA proportion in the diets, culture conditions, and fish sources.

4.2. Dietary ARA caused the decrease of the lipid content in fish

This study found that dietary ARA decreased the ovarian lipid content in M. albus (Table 5), consistent with findings in Japanese sea bass (Xu et al., 2010), grass carp (Tian et al., 2014), and barramundi (Lates calcarifer) (Salini et al., 2016). Previously, it was suggested that ARA reduced lipogenesis by down-regulating key genes involved in the synthesis, desaturation, and elongation of fatty acids while promoting β-oxidation to inhibit fat accumulation (Xu et al., 2017). Further investigation is required to elucidate the specific mechanism by which ARA exerts its lipid-lowering effects in M. albus.

4.3. Dietary ARA addition improved the antioxidant capacity of fish

The ALT activity serves as a general marker of liver function in vertebrates (Song et al., 2014). In this study, ALT activity of M. albus significantly reduced by dietary ARA treatment (Table 6), consistent with the prior research (Jiang et al., 2023); however, with higher dietary ARA levels. It was suggested that dietary ARA enhanced the hepatic function of rice field eels. As the primary line of defense against oxidation, SOD directly transforms superoxide anions into H₂O₂, and is subsequently converted by CAT into water and molecular oxygen (Matés, 2000). In fish, MDA is recognized as a consistent biomarker for determining the degree of oxidative stress (Draper and Hadley, 1990). Herein, SOD activities increased, whereas those of MDA content decreased with dietary ARA treatment (Table 8). Comparable findings have been observed in various species, including Chinese mitten crabs (Eriocheir sinensis) (Miao et al., 2022), Japanese sea bass (Xu et al., 2010), Malabar red snapper (Chee et al., 2020), and mud crabs (Scylla paramamosain) (Bian et al., 2022). The findings suggest that a specific level of ARA enhanced antioxidant capacity and liver health in female rice field eel broodstocks.

4.4. Dietary ARA can affect fatty acid composition

Fish tissue fatty acid composition is influenced by dietary fatty acid consumption (Fountoulaki et al., 2003; Nasopoulou and Zabetakis, 2012). Dietary ARA increased the proportion of ARA in the ovarian fatty acids of M. albus, a finding also observed in amberjack (Synechogobius hasta) (Luo et al., 2012) and gilthead seabream (Sparus aurata) (Magalhães et al., 2021). The ARA accumulation in gonadal lipids may serve as a foundational element for maturation-regulating functions in the gonads. The ovarian ARA ratio in control M. albus (1.70% of total fatty acids; Table 7) exceeded that of the control diet (1.10%; Table 2), highlighting the significant physiological role of ARA deposition in tissues (Willey et al., 2003). Besides, the deposition of saturated fatty acids in the ovary of the control fish (Table 7) was less than that in the control diet (Table 2), whereas the percentage of MUFA showed an opposite trend. The excessive saturated fatty acids in the experimental diet may have been de-saturated and elongated to form MUFA (Yuan et al., 2015). While polyunsaturated fatty acids (PUFA) tend to accumulate in the ovaries of freshwater and marine fish to prepare for spawning (Jeong et al., 2002; Pickova et al., 2007), not all dietary PUFAs are represented in the ovarian fatty acid profile. Conversely, the feeding time may be shorter, and there might be a window-sensitive period for fatty acid accumulation in the ovaries (Røjbek et al., 2014).

4.5. Dietary ARA improved ovary development possibly and partially by upregulating the PGE2 pathway

The 2-series PGE2 is an ARA metabolite catalyzed with cyclooxygenase (COX) (Wathes et al., 2007). The PGE2 stimulates progesterone secretion through the cyclic corpora lutea. It acts as a luteotrophic factor in the early luteal phase (Weems et al., 1997), suggesting that PGE2 participated in female reproduction by mediating LH signaling (Niringiyumukiza et al., 2018). This study found that dietary ARA elevated ovarian PGE2 concentrations and serum E2 levels, aligning with the observed increase in hepatic VTG transcription and ovarian VTG concentration in ARA-treated M. albus (Fig. 1). As gonads develop during vitellogenesis, increasing E2 levels stimulate VTG synthesis in the liver and its subsequent transport to the ovary, thereby regulating oocyte development (Hiramatsu et al., 2006). However, in some previous studies, ARA did not affect E2 levels in the Senegalese sole (Solea senegalensis) (Norambuena et al., 2013). Dietary ARA also reduced E2 concentrations in the tongue sole (Cynoglossus semilaevis) (Xu et al., 2017a). Our study demonstrated that increased E2 and VTG levels strengthened the positive effects of dietary ARA in fish species. Nevertheless, in our experiment, spawning performance was not evaluated. Oocytes induced from the experimental broodstocks could not be fertilized, probably because the period suitable for the artificial propagation of M. albus broodstocks fed with compound diets was extremely short. Further research is needed to assess the effects of dietary ARA supplementation on the spawning performance of rice field eels.

4.6. ARA supplementation might modulate ovary development by upregulation of steroidogenesis related gene expression

We also detected transcriptional changes of genes involved in steroid hormone synthesis. The conversion of cholesterol into steroid hormones is a complex process, mainly regulated by the steroid metabolism pathway, including cyp19a1a, star, and hsd3β genes (Flück and Pandey, 2017, Zhang et al., 2019). The estrogen receptor (ER) binds to estrogen, exerts its biological effects, and regulates estrogen levels (Pacwa et al., 2018). At certain physiological concentrations of FSH and LH, normal follicle development might depend on fshr and lhr transcriptional levels (Luo and Wiltbank, 2006). In this study, ARA upregulated the transcription levels of lhr and cyp19a1a, consistent with the serum E2 concentration. Dietary ARA decreased er gene transcription levels without significantly affecting hsd3β, star, and fshr gene transcription, contrasting with findings in yellow catfish (Fei et al., 2020) and tongue sole (Xu et al., 2017a). This could be linked to the feedback modulation of ARA by steroid hormones (Marks et al., 2013). The aforementioned genes exhibited differential transcription between immature and mature ovaries in tongue sole (Xu et al., 2017). The above studies, including the current study, suggest that ARA supplementation modulates steroid hormone synthesis and gonadal development; however, the effects differ with respect to the type of species, gender, and developmental stage.

5. Conclusion

In conclusion, this study indicates that dietary ARA supplementation enhances growth performance and ARA deposition in the ovary. Dietary ARA may enhance ovary development in female rice field eel broodstocks by influencing the PGE2 regulation pathway. Specifically, PGE2 stimulates the synthesis of E2 hormone and VTG protein, a process further mediated by the upregulation of steroidogenesis-related gene transcription of cyp19a1a and lhr. The optimal dietary ARA supplementation for female rice field eel broodstocks was suggested to be 10.00 g/kg (1.00%).

Credit Author Statement

Huamei Yue: Writing – review & editing, Supervision, Data curation, Conceptualization. Peng Fu: Methodology, Investigation. Haichao Deng: Writing – original draft, Methodology, Data curation. Rui Ruan: Software, Resources. Huan Ye: Investigation, Data curation. Chuang Zhang: Supervision, Funding acquisition. Chuangju Li: Writing – review & editing, Supervision, Project administration.

Declaration of competing interest

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, and there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the content of this paper.