Protocol for isolating, culturing, and artificially infecting the Arsenophonus endosymbiont of Nilaparvata lugens

Summary

Endosymbionts play a crucial role in insect physiology and adaptation. Here, we present a protocol for isolation, cultivation, and artificial infection of the Arsenophonus endosymbiont of Nilaparvata lugens. We describe steps for symbiont isolation, in vitro culture maintenance, genetic modification, and host reinfection. This protocol enables controlled studies of symbiont-host interactions and provides a foundation for symbiont-based pest management strategies.

For complete details on the use and execution of this protocol, please refer to Cai et al.¹

Graphical abstract

Highlights

• •Steps for isolating the Arsenophonus endosymbiont from Nilaparvata lugens
• •Instructions for establishing in vitro cultures of Arsenophonus
• •Procedures for introducing plasmid DNA into Arsenophonus via electroporation
• •Guidance on reinfecting N. lugens hosts via microinjection of cultured Arsenophonus

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Endosymbionts play a crucial role in insect physiology and adaptation. Here, we present a protocol for isolation, cultivation, and artificial infection of the Arsenophonus endosymbiont of Nilaparvata lugens. We describe steps for symbiont isolation, in vitro culture maintenance, genetic modification, and host reinfection. This protocol enables controlled studies of symbiont-host interactions and provides a foundation for symbiont-based pest management strategies.

Before you begin

Prepare rice seedlings for rearing N. lugens

Timing: 10 days

Note: Rice seedlings are essential for rearing and egg collection of N. lugens in this experiment, and a sufficient quantity should be obtained before the experiment; if feasible, they can also be collected directly from paddy fields.

• 1.Use a specialized dry container to measure the appropriate amount of rice seeds and place them in a white basin;
• 2.Wash the rice seeds 3–4 times with clean water to remove empty shells, gravel, and other debris;
• 3.
  Seed Soaking:

  • a.
    Add water to the white basin, ensuring that the water level does not exceed the rice seeds. Soak the seeds for at least 24 h.
  • b.
    If soaking exceeds 24 h, change the water daily to prevent seed spoilage.
• 4.
  Bud Germination:

  • a.
    Rinse the soaked rice seeds and drain excess water as much as possible (keep them moist but not submerged); Place the seeds in a 30°C incubator for germination.
  • b.
    Once the seeds show white sprouts, stir them evenly to ensure uniform germination.
• 5.
  Sowing:

  • a.
    Pour a layer of water into a glass culture dish, neatly lay two layers of filter paper in the glass culture dish, ensuring no large air bubbles, and drain any excess water while keeping the paper fully moistened.
  • b.
    Evenly spread the sprouted rice seeds on the glass culture dish.
• 6.Germination Cultivation: Stack the dishes plates neatly to prevent water evaporation and place them in a 30°C incubator and do not uncover or add water during the process.
• 7.Apply the water twice a day when seedlings grow to 3 cm (every 12 h). Use an appropriate amount of water, ensuring that it just soaks the bottom seeds, this can allow the leaves to unfold properly to prevent mold and odor development.
• 8.Continue cultivation until the rice seedlings grow to about 10 cm.

Note: The rice seeds used in this experiment are Taichung Native 1. The rice variety for insect rearing can be replaced arbitrarily, but its impact on Arsenophonus remains unknown.

Prepare N. lugens adults with Arsenophonus infection

Timing: 10 days

• 9.In the damaged rice field (by N. lugens, Figure 1A), hold a white plastic basin at the base of the rice stems. Pat the other side of the rice stems to make the individual N. lugens fall into the basin. Use an aspirator to collect the field samples and place them in the laboratory for feeding.
• 10.N. lugens are maintained on rice seedlings at 28 ± 2°C under 70%–80% relative humidity and a 16-h light/8-h dark photoperiod.
• 11.Collect whole-body samples of N. lugens from multi-field populations. Ensure that the sample size for each group is greater than 30 insects.
• 12.Place the test insect in a 2 mL grinding tube, add three sterile steel beads with a diameter of 2 mm, and grind the sample. Prepare the homogenate using PBS buffer.
• 13.Extract total genomic DNA using the FastDNA SPIN Kit following the manufacturer’s protocol (https://www.mpbiochina.com/cn/116560000-fastdna-spin-kit-for-soil-samp-cf).
• 14.Prepare PCR reactions using three primer sets (ArsftsK, Ars16S, and Arsfrag,^2,3,4; Table 1) to confirm the presence of Arsenophonus.
• 15.Set up a 20 μL PCR reaction:

Reagent	Amount
DNA template	1 μL
2×Hieff PCR Master Mix	10 μL
Primer 1	1 μL
Primer 2	1 μL
ddH2O	to 20 μL

• 16.Run the PCR with the following thermal cycle:

Steps	Temperature	Time	Cycles
Initial denaturation	95°C	3 min	1
Denaturation	95°C	10 sec	35 cycles
Annealing	55°C	20 sec
Extension	72°C	30 sec
Final extension	72°C	4 min	1
Hold	4°C	forever

• 17.Determine whether there is an Arsenophonus infection through 1% agarose gel electrophoresis.
• 18.Select the field population with a positive detection of Arsenophonus infection as the test population, followed select male and female adults in a ratio of 1:1 for mating.

Note: This step e. can be replaced with 16S rRNA amplicon sequencing. This method can provide a better understanding of the microbial composition in N. lugens samples,⁵ but it comes at a higher cost.

Figure 1.

Distribution of Nilaparvata lugens in rice fields

(A) Damage caused by N. lugens.

(B) Feeding sites of N. lugens on rice.

Table 1.

Primers table of this protocols

Primer name	Forward primer (5′-3′)	Reverse primer (5′-3′)
ArsftsK	GCCGATCTCATGATGACCG	CCATTACCACTCTCACCCTC
Ars16S	TTCGGTCGGAACTCAAAGG	TCTGAGTTCCGCTTCCCATC
Arsfrag	ATCGGTAACTTATTCGCCAGGT	CCCCACGACTATATTGCTGAAC
16SrRNA (27F/1492R)	AGAGTTTGATCCTGGCTCAG	GGTTACCTTGTTACGACTT
Nl18Sa	GTAACCCGCTGAACCTCCT	TCCGAAGACCTCACTAAATC

^aReference genes for quantitative of bacterial symbionts in N. lugens.

Prepare rice seedlings carried with N. lugens eggs

Timing: 6 days

• 19.Place a rice seedling in a glass tube. Select a single female N. lugens adult that has mated (rearing together with male adults more than 3 days) and let it lay eggs inside the glass tube.
• 20.After 24 h of egg-laying, collect the rice seedlings with insect eggs and the corresponding female adult should be collected.
• 21.Repeat steps 1. d-h. Retain the eggs of the test insects that are detected to be positive for Arsenophonus infection for use in the formal experiment.

Note: Rice seedlings with successful oviposition by N. lugens have visible notches on the stem (Figure 2A).

Figure 2.

Appearance of rice seedlings after being oviposited by the Nilaparvata lugens

Oviposition marks (A) and dissection method (B) of Nilaparvata lugens on rice. The white arrow indicates the oviposition marks.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Bacterial and virus strains
Arsenophonus nilaparvatae strain HZAU001	This study	N/A
Critical commercial assays
DNase agar	Qingdao Hope	No. HB4118
Brain heart infusion (BHI)	Coolaber	No. PM0640
FastDNA SPIN Kit	MP Biomedicals, USA	No. 116540600
2×Hieff PCR Master Mix	Shanghai YEASEN	No. 10102ES
Hieff qPCR SYBR Green Master Mix (No Rox)	Shanghai YEASEN	No. 11201ES
Experimental models: Organisms/strains
N. Lugens: strain XY2017 (eggs, nymphs, and adults)	Zhang et al.5	N/A
Rice strain Taichung Native 1	Zhang et al.5	N/A
Oligonucleotides
Primers for 16S rRNA, see Table 1	Srinivasan et al.6	N/A
Primers for ArsftsK, see Table 1	Mouton et al.3	N/A
Primers for Ars16S, see Table 1	Guo et al.2	N/A
Primers for Arsfrag, see Table 1	Pang et al.4	N/A
Primers for Nl18S, see Table 1	Xi et al.7	N/A
Recombinant DNA
Plasmid: pOM1-gfp	Basset et al.8	N/A
Other
BioRad CFX384 PCR instrument	Bio-Rad	N/A
Microscope	Olympus	SZX16
Microscope	Olympus	IX 51
Quality borosilicate glass capillaries	WPI	No. 504949

Step-by-step method details

Isolation and cultivation of Arsenophonus from N. lugens

Timing: 7 days

This step describes the isolation and cultivation of Arsenophonus from N. lugens eggs. The protocol involves surface sterilization of eggs, bacterial isolation, PCR identification, and strain preservation. It may have reference significance for the isolation and cultivation of Arsenophonus in other Hemiptera insects.

• 1.
  Surface sterilization of collected eggs.

  • a.
    Four days after egg incubation. Dissect the N. lugens eggs from the rice seedlings under a dissecting microscope using tweezers (Figure 2B).
  • b.
    Place 30 insect eggs at the bottom of a 1.5 mL centrifuge tube.
  • c.
    Add 1 mL of 75% alcohol into the centrifuge tube. Invert the centrifuge tube to ensure that the surfaces of the eggs are fully in contact with the liquid and cleaned (30 S).
  • d.
    Use a syringe to suck out the alcohol in the centrifuge tube and discard it. Wash thoroughly with 1 mL sterile deionized water to remove ethanol residues.
  • e.
    Repeat steps b and c three times.
• 2.
  Homogenization and bacterial plating.

  • a.
    Homogenize the sterilized eggs in 100 μL sterile deionized water using a sterile micropestle.
  • b.
    Spread the homogenate directly onto DNase agar without dilution.
  • c.
    Incubate the plates at 28°C under standard aerobic conditions.
  • d.
    Observe the plates daily for bacterial colony growth.
  • e.
    After six days, select small bacterial colonies for further purification under an Olympus IX51 inverted microscope (Figures 3A and 3B). Troubleshooting 1.

Note: Since the colonies of Arsenophonus are smaller than those of conventional bacteria and are translucent, it is recommended to use a microscope to assist in observing the colonies. The colony surface is covered with mucus, making it appear smoother on the air-exposed side. So, observation using an inverted microscope provides a clearer view.

• 3.
  Purification of bacterial strain.

  • a.
    Select isolated bacterial colonies and streak onto fresh DNase agar.
  • b.
    Repeat the streaking process for five successive generations to ensure purity.
  • c.
    Store purified colonies at 4°C for short-term use.
• 4.
  Identification via 16S rRNA gene sequencing.

  • a.
    Extract bacterial DNA from purified colonies using a commercial DNA extraction kit or standard phenol-chloroform extraction.
  • b.
    Amplify the 16S rRNA gene using primers 27F/1492R⁶ (Table 1) in a 20 μL PCR reaction containing:

    Reagent	Amount
    DNA template	1 μL
    2×Hieff PCR Master Mix	10 μL
    Primer 1	1 μL
    Primer 2	1 μL
    ddH2O	to 20 μL

  • c.
    Run PCR with the following thermal cycling conditions:

    Steps	Temperature	Time	Cycles
    Initial denaturation	95°C	3 min	1
    Denaturation	95°C	30 sec	35 cycles
    Annealing	50°C	30 sec
    Extension	72°C	1 min
    Final extension	72°C	4 min	1
    Hold	4°C	forever

  • d.
    Sequence the purified product using the original primers (Tsingke Biotechnology Co. Ltd.).
• 5.
  Strain preservation and enrichment culturing.

  • a.
    For enrichment culturing, streak the strain onto brain heart infusion (BHI) medium and incubate at 28°C under aerobic conditions. The culture of the enriched strain can be collected in about 6 days.
  • b.
    Transfer the bacterial suspension to 10 × 1.5 mL centrifuge tubes and centrifuge at 12,000 × g for 10 min. Re-suspended the all the pellets using 300 μL of fresh BHI medium, and then add 600 μL of 80% glycerol. Store the strain at −80°C for long-term preservation.
  • c.
    Subculture activated strain every 6 days to maintain viability. Troubleshooting 2.

CRITICAL: Ensure the integrity of the eggs and sterility during handling to prevent contamination. Use freshly prepared ethanol and deionized water for sterilization. If bacterial growth is not observed after six days, check incubation conditions and agar quality.

Note: 1) Both DNase agar and BHI agar can keep Arsenophonus growth. However, during the primary culture of Arsenophonus in N. lugens, DNase agar has a higher success rate. If possible, please try to carry it out simultaneously. 2) You can choose antibiotics (Ampicillin, Polymyxin B, Vancomycin, or Gentamicin) for the selective medium formulation.

Figure 3.

Colony appearance of Arsenophonus

(A and B) represent the wild-type strain HZAU001: (A) colony morphology captured with a macro camera, and (B) colony morphology observed under an inverted microscope.

(C and D) correspond to Arsenophonus-GFP: (C) light microscopy image and (D) epifluorescence microscopy image of the colonies.

Genetic manipulation of Arsenophonus of N. lugens in vitro

Timing: 13 days

This step describes the process of introducing the plasmid DNA into Arsenophonus using electroporation, followed by selection and fluorescence detection. This protocol refers to the research of Nadal et al.⁹ and has been locally improved according to the strain.

• 6.
  Activation and purification of Arsenophonus.

  • a.
    Retrieve a frozen stock of Arsenophonus and revive the culture through five consecutive generations of activation and purification.
  • b.
    Streak the purified strain onto BHI agar and incubate at 28°C for colony formation.
  • c.
    Use a single colony to inoculate 50 mL of BHI and incubate at 28°C under aerobic conditions for 6 days.
• 7.
  Preparation of competent cell of Arsenophonus.

  • a.
    Transfer the culture to 50 mL Greiner tubes and centrifuge at 20,000 × g for 10 min.
  • b.
    Discard the supernatant and resuspend the bacterial pellet in 10% sterile glycerol.
  • c.
    Wash the pellet five times with 1 mL of sterile 10% glycerol, centrifuging at 16,160 × g for 1 min after each wash.
  • d.
    Resuspend the final pellet in 50 μL of 10% sterile glycerol and keep on ice for 10 min.
• 8.
  Electroporation of Arsenophonus (For example, pOM1-gfp⁸).

  • a.
    Add 200 ng of plasmid pOM1-gfp to the bacterial suspension and mix gently.
  • b.
    Incubate the mixture on ice for 10 min.
  • c.
    Transfer the suspension to a 1 mm electroporation cuvette and apply 1 pulse at 2.6 kV using a Bio-Rad Micropulser electroporator.
  • d.
    Immediately add 1 mL of BHI broth to the cuvette and transfer the contents to a 5 mL sterile tube.
  • e.
    Incubate at 28°C and 250 r.p.m. for 24 h to allow recovery.
• 9.
  Selection of Transformed Arsenophonus.

  • a.
    Pellet the culture by centrifugation and plate the suspension onto BHI agar containing 50 μg/mL spectinomycin.
  • b.
    Seal the plate to prevent desiccation and incubate at 28°C for 6 days.
  • c.
    Monitor for colony formation on the agar surface.
  • d.
    Examine the transformed colonies under an Olympus SZX16 stereo-microscope.
  • e.
    Confirm the presence of GFP fluorescence, indicating successful transformation (Figures 3C and 3D).

CRITICAL: Maintain the electroporation cuvette on ice before pulsing to improve transformation efficiency.

Note: Here, the GFP plasmid is used as an example to demonstrate the feasibility of genetic manipulation. In theory, plasmids of similar size should be easily reproducible using this method, but further extensive exploration is still required.

Artificial infection of N. lugens with Arsenophonus via microinjection

Timing: 7 days

This protocol describes a microinjection-based method for artificially infecting N. lugens with Arsenophonus.

• 10.
  Preparation of Arsenophonus inoculum.

  • a.
    Culture Arsenophonus in BHI broth at 30°C with shaking until OD₆₀₀ reaches 0.2.
  • b.
    Transfer 1 mL of culture to a 1.5 mL microcentrifuge tube.
  • c.
    Centrifuge at 12,000 × g for 5 min and discard the supernatant.
  • d.
    Resuspend the bacterial pellet in 100 μL of sterile water to prepare the inoculum.
• 11.
  Microinjection procedure.

  • a.
    Place the N. lugens 3rd-instar nymphs in an Erlenmeyer flask, and anesthetize the test insects by filling the flask with carbon dioxide for 5 min.
  • b.
    Load the bacterial suspension into a fine glass capillary needle (∼0.06 mm, Figure 4).
  • c.
    Inject 50 nL of Arsenophonus suspension into the ventral thoracic abdomen of each N. lugens nymph, located between the mesothorax and metathorax, at an injection rate of approximately 50 nL per second (Figure 5).
  • d.
    Quickly withdraw the needle. Transfer injected nymphs onto fresh rice seedlings for rearing.
  • e.
    Collect insect samples (30 insects per sample) daily for six consecutive days after injection to assess the infection status.

CRITICAL: Ensure sterile conditions during bacterial preparation and insect handling. Optimize needle calibration and injection volume to minimize mortality. Before injection, it is necessary to ensure that the test insects are free from natural infection of Arsenophonus.

Figure 4.

The size of glass needles for microinjection

(B) represents the black-boxed region in (A).

Figure 5.

Microinjection method demonstration

(A) Injection Site on Nilaparvata lugens body. The red dot indicates the optimal injection site.

(B) Schematic diagram of needle insertion.

Quantification of Arsenophonus infection

Timing: 2–3 h

• 12.
  Relative Quantification of Arsenophonus.

  • a.
    Collect whole-body samples of N. lugens (sampling time set according to last step e.).
  • b.
    Extract total genomic DNA using the protocols described in before you begin, 2d and e.
  • c.
    Quantify DNA concentration using a Nanodrop fluorometer and dilute to 100 ng/μL by Nuclease-free water.
• 13.
  Quantification of Arsenophonus load of N. lugens via qRT-PCR.

  • a.
    Use the Ars16S primers for relative quantification.
  • b.
    Prepare a 20 μL qRT-PCR reaction:

    Reagent	Amount
    DNA template	1 μL
    Hieff qPCR SYBR Green Master Mix (No Rox)	10 μL
    Ars16S F	1 μL
    Ars16S R	1 μL
    Nuclease-free H2O	to 20 μL

  • c.
    Set up qRT-PCR on a Bio-Rad CFX384 with the following cycle:

    Steps	Temperature	Time	Cycles
    Initial denaturation	95°C	30 sec	1
    Denaturation	95°C	5 sec	40 cycles
    Annealing & extension	60°C	10 sec
    Melt curve analysis	55°C to 95°C		1

  • d.
    Normalize bacterial load using Nl18S⁷ as the reference gene.
  • e.
    Calculate relative Arsenophonus load using the 2^-ΔΔCT method.¹⁰

Expected outcomes

This protocol describes the steps involved in the isolation of Arsenophonus from N. lugens eggs, followed by in vitro culture, genetic modification and host reinfection. By following this experimental protocol, the important endosymbiont Arsenophonus of the N. lugens can be modified and tracked as a separate tool, and a population of artificially infected N. lugens can be obtained easily. These insects can be used for Arsenophonus functional studies or as models for host-symbiont interaction research.

Limitations

Although there are not many known endosymbionts in N. lugens, it is impossible to determine whether your insect population contains new bacterial species. Therefore, the method of isolation from eggs cannot completely eliminate the contamination of other bacteria.

Troubleshooting

Problem 1

Now that maternal detection of N. lugens female adults confirms a high abundance of Arsenophonus in the eggs, and standard sterile techniques effectively minimize contaminant bacteria, it is unexpected that no Arsenophonus colonies were observed on the DNase agar (step 2).

Potential solution

Ensure sufficient egg developmental time before sample collection. Monitoring results indicate that Arsenophonus is present at very low levels in the early stages of egg development. Around four days (96 h) after laying, the bacterial load of Arsenophonus undergoes a significant increase. Allowing enough incubation time will also reduce the risk of piercing the egg surface with forceps, making sampling more effective. The appearance of Arsenophonus colonies resembles water droplets when observed directly. They are transparent and not easily distinguishable, requiring careful observation. When colonies are difficult to locate under a dissecting microscope, a slightly higher magnification inverted microscope can be used. In this case, ensure that the DNase agar is thin enough to allow light penetration. Due to the longitudinal extension of the rod-shaped Arsenophonus, early-stage colonies are often compressed into a grooved appearance. Pay attention to these characteristics to prevent them from slipping away right before your eyes.

Problem 2

When selecting Arsenophonus single colonies from the DNase agar and attempting to enrich them in BHI liquid medium, no turbidity was observed in the BHI culture even after an extended period (step 5).

Potential solution

Due to the slow colony growth rate and low bacterial density, it is difficult to notice Arsenophonus in a 1.5 mL centrifuge tube. However, the bacteria are still growing at this stage, and their growth status can be observed by centrifuging at 12,000 × g for 5 min to get the pellet.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Professor Hu Wan (huwan@mail.hzau.edu.cn).

Technical contact

Questions about the technical specifics of performing the protocol should be directed to and will be answered by the technical contacts, Professor Hu Wan (huwan@mail.hzau.edu.cn).

Materials availability

Arsenophonus stains generated in this study have been deposited to China center for type culture collection (CCTCC AB2023033T) and Korean collection for type cultures (KCTC 8707).

Data and code availability

This study did not generate datasets and codes.

Acknowledgments

The authors are grateful to Professor Gregory D.D. Hurst and Dr. Pol Nadal-Jimenez for providing the plasmid pOM1-gfp and valuable suggestions in the early stages of protocol development. This work was supported by the National Natural Science Foundation of China (32472601).

Author contributions

H.W. designed the study. T.C. performed the experiments. H.W. and T.C. wrote the manuscript. All authors edited and approved the final manuscript.

Declaration of interests

The authors declare no competing interests.