Skip to main content
The Plant Pathology Journal logoLink to The Plant Pathology Journal
. 2025 Jun 1;41(3):311–320. doi: 10.5423/PPJ.OA.08.2024.0129

Rapid Diagnosis of Major Phytoplasma Infected Trees Using the Loop-Mediated Isothermal Amplification Method in South Korea

Geon-Woo Lee 1,, Hyeong-Woo Lee 2,, Sun Keun Lee 3,*, Sang-Sub Han 1,*
PMCID: PMC12146621  PMID: 40468878

Abstract

Tree diseases associated with phytoplasma infections predominantly affecting nine host trees have serious impacts on tree growth and cause significant economic losses in South Korea. Loop-mediated isothermal amplification (LAMP)-based primers for early detection were developed to evaluate their accuracy. First, the 16S rRNA gene of phytoplasma was successfully amplified from the extracted DNA of various infected tree species using the polymerase chain reaction method. Two types diagnostic kits developed for phytoplasma detection were evaluated. The first kit detected phytoplasma infection within 30 min under isothermal conditions at 65°C, while the second kit did so within 40 min. Both kits could detect the nine different species of host trees infected with phytoplasma. When tested with 10 ng of the synthetic target gene, the FAM value became detectable at 10 min and remained consistent until 40 min. The lowest detection concentration was 0.01 pg/μL, and the limit of detection was 100 copies/μL. All of the phytoplasmas from nine diseased hosts were early detected. Furthermore, phytoplasma was not detected in healthy specimens, confirming the diagnostic kits’ accuracy in distinguishing between healthy and infected strains. The LAMP method confirmed rapid, accurate, and visually assessable detection of phytoplasma, suggesting it will enable early diagnosis of phytoplasma infections in South Korea.

Keywords: isothermal nucleic acid amplification, LAMP, Phytoplasma rapid diagnosis kit


Phytoplasmas are plant pathogens that infect more than 1,000 species of plants globally, characterized by their lack of cell walls and diverse morphological shapes (Namba, 2019; Tran-Nguyen et al., 2008). Phytoplasma-infected plants exhibit symptoms such as yellowing, witches’ broom, and stunted growth (Bertaccini et al., 2014; Kumari et al., 2019; Musetti and Pagliari, 2019). In South Korea, phytoplasma infections affect approximately 27 tree species (Han et al., 2021a, 2021b; Jung et al., 2012; Lee, 2020), with nine of these species recognized as major hosts causing annual economic losses. There are several phytoplasma diseases known in South Korea, affecting a variety of tree species. These include Paulownia witches’ broom (PaWB), Mulberry dwarf (MD), Melia azedarach witches’ broom (MaWB), and Sumac witches’ broom (SuWB) associated with the 16SrI group (Han and Cha, 2002; Han et al., 2001, 2015; Jung et al., 2012). Additionally, Jujube witches’ broom (JuWB), Chinese Elm yellows (CEY), and Japanese raisin witches’ broom (JrWB) associated with the 16SrV group (Han et al., 2021a; Jung, 2003; Kamala-Kannan et al., 2011). In Jeju Island, the Elaeocarpus sylvestris decline, which causes significant dieback annually, belongs to the 16SrXXXII group (Lee and Han, 2023). Additionally, Leafy lespedeza witches’ broom (LlWB) is another phytoplasma-infected tree species predominantly found in South Korea (Kim and Jung, 2007).

As of now, the diagnosis of phytoplasma infections is primarily conducted using molecular biological methods, with polymerase chain reaction (PCR) technology being the most widely utilized. However, PCR-related techniques are time-consuming and require expensive equipment, which can be inconvenient. Recently, loop-mediated isothermal amplification (LAMP) has been recognized for enabling early diagnosis, offering higher amplification efficiency, greater specificity, and faster reaction speeds compared to traditional PCR methods (Notomi et al., 2000). Furthermore, unlike PCR, LAMP operates under isothermal conditions without the need for gel electrophoresis, allowing for shorter testing times and the use of low-cost equipment like heat blocks. This method is cost-effective, convenient, and efficient, making it widely applicable for diagnosing infectious diseases in humans, animals, and plants (Dhama et al., 2014). Research on phytoplasma-infected plants using LAMP has been conducted globally across various groups of phytoplasmas. For instance, diagnostic researches using the LAMP method have been conducted on plants infected with various groups of phytoplasmas. These include plants infected with 16SrI group phytoplasmas (Hammond et al., 2021; Sugawara et al., 2012; Tomlinson et al., 2010; Wang et al., 2017; Yu et al., 2020), 16SrII group (Bekele et al., 2011), 16SrIII and 16SrXI groups (Nair et al., 2016; Obura et al., 2011), Flavescence dorée phytoplasma (Kogovšek et al., 2015), 16SrXI group (Siriwardhana et al., 2012), and 16SrX group (De Jonghe et al., 2017; Siemonsmeier et al., 2019). Detecting phytoplasma infections in plant tissues with appropriate diagnosis and identification by group is crucial for disease surveillance and control (Akahori et al., 2024; Dickinson, 2015; Hodgetts, 2019). Therefore, this study aims to develop a rapid LAMP detection method based on the 16SrRNA gene sequences of phytoplasmas infecting major tree species in South Korea. By doing so, our objective is to facilitate swift on-site early diagnosis of phytoplasma-infected tree species, contributing to disease surveillance and control efforts.

Materials and Methods

Symptomatic sample collection and DNA extraction

Samples were collected from major phytoplasma-infected trees in South Korea from 2022 to 2023 (Fig. 1). The symptomatic midrib tissue (0.2 g) from collected samples, showing signs of disease, was used to extract total plant DNA using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). This study used nine phytoplasma-associated diseases, as listed in Table 1. In addition, asymptomatic healthy strains as controls were also used to extract DNA for each diseased strain in this study. One microliter of extracted DNA was electrophoresed on a 0.8% agarose gel at 100 V for 30 min and visualized using a UV transilluminator to confirm amplification. Subsequently, the concentration was measured using a spectrophotometer (NanoDrop, Thermo Scientific, Waltham, MA, USA).

Fig. 1.

Fig. 1

Tree species primarily infected by phytoplasma and their various symptoms in South Korea. (A) Paulownia Witches’ broom (PaWB). (B) Mulberry dwarf (MD). (C) Melia azedarach witches’ broom (MaWB). (D) Sumac witches’ broom (SuWB). (E) Jujube witches’ broom (JuWB). (F) Chinese Elm yellows (CEY). (G) Japanese raisin witches’ broom (JrWB). (H) Elaeocarpus sylvestris decline (ESD). (I) Leafy lespedeza witches’ broom (LlWB).

Table 1.

List of major host trees of phytoplasma diseases collected in this study

Host plants Associated disease (acronym) Collected locations 16S rRNA groups classification using iPhyClassifier (GenBank accession no.) Reference
Paulownia coreana Uyeki Paulownia Witches’ broom (PaWB) Jeonju-si, Jeollabuk-do 16SrI-B (AF279271) Han et al. (2001)
Morus alba L. Mulberry dwarf (MD) Buan-gun, Jeollabuk-do 16SrI-B (AY075038) Han and Cha (2002)
Melia azedarach L. Melia azedarach witches’ broom (MaWB) Jindo-gun, Jeollanam-do 16SrI-B (KJ754171) Han et al. (2015)
Rhus javanica L. Sumac witches’ broom (SuWB) Buan-gun, Jeollabuk-do 16SrI-B (AB693125) Jung et al. (2012)
Ziziphus jujuba Mill. Jujube witches’ broom (JuWB) Wanju-gun, Jeollabuk-do 16SrV-B (AB052879) Jung (2003)
Ulmus parvifolia Jacq. Chinese elm yellows (CEY) Yeosu-si, Jeollanam-do 16SrV-B (MW522355) Han et al. (2021a)
Hovenia dulcis Thunb. Japanese raisin witches’ broom (JrWB) Hamyang-gun, Gyeongsangnam-do 16SrV-B (AB442218) Kamala-Kannan et al. (2011)
Elaeocarpus sylvestris var. ellipticus (Thunb.) H. Hara Elaeocarpus sylvestris decline (ESD) Seogwipo-si, Jeju-do 16SrXXXII-E (OL689203) Lee and Han (2023)
Lespedeza cyrtobotrya Miq. Leafy lespedeza witches’ broom (LlWB) Chuncheon-si, Gangwon-do 16SrVI-A (AB279597) Kim and Jung (2007)

PCR analysis

To amplify the 16S rRNA gene of phytoplasmas, PCR was performed using the universal phytoplasma primers R16F2n (5′-GAAACGACTGCTAAGACTGG-3′) (Gundersen and Lee, 1996) and R16R2 (5′-TGACGGGCGGTGTGTACAAACCCCG-3′) (Lee et al., 1993). For the PCR reaction, the mixture included Emerald Amp GT PCR Master Mix [2× Premix] (Takara, Shiga, Japan), 10 pmoles of each primer, and 10–100 ng/μL of total plant DNA. Sterile distilled water was added to adjust the final reaction volume to 25 μL. The PCR conditions were slightly modified from the methods described by Gundersen and Lee (1996) and Lee et al. (1993). The reaction was initiated at 94°C for 7 min, followed by 28 cycles of 94°C for 1 min denaturation, 58°C for 2 min annealing, and 72°C for 3 min extension. The PCR was completed with a final extension step at 72°C for 10 min. The products obtained from PCR methods were mixed with Dyne Loading STAR (Dyne Bio, Seongnam, Korea) 1 μL and products 5 μL, loaded onto a 1.2% agarose gel, and electrophoresed at 100 V for 40 min. DNA bands were visualized using a UV transilluminator thereafter.

Design and synthesis of LAMP primers

The development of phytoplasma diagnostic kits using LAMP technology includes LAMP primers targeting the 16S rRNA gene region of phytoplasma, with the primer sequences (KOREA Patent no. 10-2496891) provided in Table 2 and Fig. 2. Two types of phytoplasma diagnostic kits will be developed, A-type designed to detect stained phytoplasma gene DNA amplified under isothermal conditions, and the B-type to visually identify phytoplasma detection.

Table 2.

Nucleotide sequences of primers for the phytoplasma LAMP diagnostic kit (KOREA patent no. 10-2496891)

Marker name Sequence (5′-3′) Length
KWF3 CCCTAGCTGGTCTGAGAGG 19
KWB3 CGGGTAACGTCAATGAGCAA 20
KWFIP GCGCCCATTGTGCAATATTCCCCCAGCAACACTGGAACTGA 41
KWBIP AAGCCTGATGCAGCCATGCGTTCCTCCCCGCTGAAAGT 38
KWLF TCCCGTAGGAGTCTGG 16
KWLB TGAAGAAGGCCTTCGG 16

LAMP, loop-mediated isothermal amplification.

Fig. 2.

Fig. 2

Gene alignment and location of universal loop-mediated isothermal amplification primers for detecting 16S rRNA gene of Korean isolates.

Measurement of limitation of detection

The detection limit of phytoplasma detection kits was evaluated. The synthetic target gene was serial diluted and added to reaction master mixture of phytoplasma detection kits. In case of Phytoplasma A-type Detection Kit, it was reacted at 65°C for 30 min and read the result of FAM value by HARU-2000 (Solution Mission Electronic Co., Ltd., Bucheon, Korea). In case of Phytoplasma B-type Detection Kit, it was reacted at 65°C for 50 min in HARU-2000 and read the result through the naked eye.

Evaluation of phytoplasma diagnostic kits

The phytoplasma diagnostic kits were tested on nine predominant tree species infected with phytoplasmas and nine healthy control species. The positive control utilized artificially synthesized phytoplasma target genes, while the negative control group utilized distilled water. For phytoplasma detection using the LAMP reaction, it was used 10 μL of 2× LAMP Enzyme Mixture or 2× color LAMP Enzyme Mixture, 4 μL of Phyto Primer Mixture, 4 μL of molecular grade water (DDW), and 2 μL of plant DNA. The mixture (19 μL) was supplemented with 1 μL of total DNA from the sample. Subsequently, the mixture was incubated in an isothermal nucleic acid amplification device (HARU-2000) set at 65°C for 30 and 40 min each for the two types of phytoplasma kit reactions. In the phytoplasma detection kit designed for visual confirmation, positive results were indicated by yellow, while negative results were indicated by pink. In the case of the other kit, it was added 10 μL of SYBR green I (Invitrogen, Carlsbad, CA, USA). Phytoplasma detection was indicated by yellow for positive results and orange for negative results, with the accuracy of detection confirmed through fluorescence using a UV transilluminator. Furthermore, after measuring the FAM values using HARU-2000 device, it was interpreted the presence or absence of positive results. The analysis of FAM values for each sample was conducted using SPSS version 19.0 statistical software (SPSS Inc., Chicago, IL, USA), where one-way analysis of variance (ANOVA) was performed. Additionally, it was considered results statistically significant if P < 0.05.

Results

Symptomatic sample collection and DNA extraction

For each of the nine phytoplasma-infected strains as well as their corresponding healthy controls, 1 μL of extracted DNA from each sample was electrophoresed on a 0.8% agarose gel at 100 V for 30 min. Clear bands were observed and visualized under a UV transilluminator. Additionally, DNA concentrations were measured with a spectrophotometer, which revealed an average quantification of approximately 50–60 ng/μL for the tissue samples that were taken from each individual sample.

PCR analysis

In order to determine the presence of phytoplasma infection in nine suspected infected strains and healthy control strains, a PCR amplification process was conducted on the 16S rRNA gene. Symptomatic strains exhibited a clear and distinct single band of DNA around 1.2 kb, thereby confirming the presence of phytoplasma infection (Fig. 3). No bands were amplified or detected in the healthy control strains.

Fig. 3.

Fig. 3

Agarose gel electrophoresis patterns of PCR products using primer pair R16F2n/R2 from trees infected with phytoplasma. M, molecular weight marker (100 bp); N, distilled water. Paulownia Witches’ broom (PaWB), Mulberry dwarf (MD), Melia azedarach witches’ broom (MaWB), Sumac witches’ broom (SuWB), Jujube witches’ broom (JuWB), Chinese Elm yellows (CEY), Japanese raisin witches’ broom (JrWB), Elaeocarpus sylvestris decline (ESD), and Leafy lespedeza witches’ broom (LIWB) strains were described in Table 1.

Limitation of detection analysis

For the Phytoplasma A-type Detection Kit, a positive reaction was detected 10 min after initiating the LAMP reaction at 65°C (Fig. 4). But after 40 min reaction time, negative control (distilled waste) was shown like the positive control in FAM value and naked eye observation (Fig. 4A and B). As shown in Fig. 4C, FAM value read by HARU-2000, the maximum FAM value was shown in 30 min. Therefore, the reaction time for the Phytoplasma A-type Detection Kit was set to 30 min. The lowest detection concentration was 0.01 pg/μL (Fig. 5), and the limitation of detection (LoD) was 100 copies/μL (Fig. 6). The LoD was 10 copies/μL for both devices, and the specificity was 100% (data not shown). In case Phytoplasma B-type Detection Kit, the positive reactions were shown 30 min after reaction initiation (Fig. 7). The lowest detection concentration was 1 fg/μL in 40 min reading (Fig. 7), and the LoD was 1,000 copies/μL in 50 min reading (Fig. 8).

Fig. 4.

Fig. 4

Loop-mediated isothermal amplification (LAMP) reaction according to the time course of Phytoplasma A-type Detection Kit. Positive, 10 ng of LAMP target gene; Negative, distilled water (DW) only. (A) Under UV lamp. (B) With naked eye. (C) FAM value.

Fig. 5.

Fig. 5

Determination of limitation of detection (pg/μL) by Phytoplasma A-type Detection Kit. (A) Under UV lamp. (B) With naked eye. (C) FAM value.

Fig. 6.

Fig. 6

Determination of limitation of detection (copies/μL) by Phytoplasma A-type Detection Kit. (A) Under UV lamp. (B) With naked eye. (C) FAM value at various copies. (D) FAM value.

Fig. 7.

Fig. 7

Determination of limitation of detection (pg/μL) by Phytoplasma B-type Detection Kit.

Fig. 8.

Fig. 8

Determination of limitation of detection (copies/μL) by Phytoplasma B-type Detection Kit.

Evaluation of phytoplasma diagnostic kits

Using two types of phytoplasma diagnostic kits, we tested nine phytoplasma-infected strains and nine healthy control strains (Fig. 9). First, with the Phytoplasma A-type Detection Kit, after isothermal amplification at 65°C for 30 min, all suspected infected samples (nine strains) displayed positive results (lemon yellow color), accurately detecting phytoplasma. The positive control using artificially synthesized phytoplasma also showed positive results. However, the nine healthy control strains and negative control showed orange color, indicating no detection of phytoplasma. Under UV observation, the nine infected samples exhibited fluorescence, confirming positive results for phytoplasma infection. In contrast, none of the healthy control strains or negative controls showed any fluorescence, confirming once again that they were not infected with phytoplasma. Using HARU-2000 device, it was measured FAM values to interpret the presence or absence of phytoplasma detection. According to the phytoplasma diagnostic kit manual, a sample was deemed positive if its FAM value was more than double that of the negative control’s FAM value. After analyzing the FAM values of the samples using one-way ANOVA following the Phytoplasma A-type Detection Kit testing, it was confirmed statistically significant differences (P < 0.05) among the samples (Fig. 10). This allowed us to accurately determine the presence or absence of phytoplasma infection in both infected and healthy samples. It was used the Phytoplasma B-type Detection Kit, which allows visual confirmation of phytoplasma detection without the use of reagents like SYBR green I. After conducting isothermal amplification at 65°C for 40 min, infected samples showed an orange color, confirming phytoplasma infection. In contrast, negative controls and the nine healthy control strains appeared pink, indicating they were not infected with phytoplasma. Therefore, this B-type detection kit clearly distinguished between phytoplasma-infected samples and negative controls within 40 min.

Fig. 9.

Fig. 9

The results of the Phytoplasma A-type Detection Kit and B-type Detection Kit with the DNA of phytoplasma-infected trees and reactions described in Table 1. Visual inspection (A) and under UV results (B) from the A-type detection kit. (C) Visual inspection results from the B-type detection kit. Visual inspection (D) and under UV results (E) from the A-type detection kit. (F) Visual inspection results from the B-type detection kit. (A–C) Tree samples infected with phytoplasma. (D–F) Healthy trees.

Fig. 10.

Fig. 10

The graph of groups from the results of FAM values according Phytoplasma A-type Detection Kit. Samples of diseased tree (A) and healthy trees (B), reactions described Table 1.

Discussion

Phytoplasma infects entire plant tissues, making early detection and intervention crucial for preventing its efficient spread (Akahori et al., 2024; Namba, 2019; Yu et al., 2020). The LAMP-based detection method for phytoplasma is rapid and highly accurate, as it amplifies six gene regions simultaneously without requiring agarose gel electrophoresis. Moreover, it is more cost-effective than conventional PCR methods because it can amplify under isothermal conditions using a simple device (Notomi et al., 2000). Diagnosis of phytoplasma using LAMP involves the development of LAMP primers targeting specific genes for each group, including 16S rRNA, tuf, and groEL (Bekele et al., 2011; De Jonghe et al., 2017; Nair et al., 2016; Siemonsmeier et al., 2019; Sugawara et al., 2012; Tomlinson et al., 2010; Yu et al., 2020). Additionally, research has introduced Universal LAMP primers targeting the 23SrRNA gene, enabling simultaneous detection of all phytoplasma groups (Akahori et al., 2024). Subsequently, we successfully tested two phytoplasma diagnostic kits developed using LAMP primers designed within the 16S rRNA gene region for groups 16SrI, -V, -VI, and -XXXII. It is anticipated that this diagnostic kit could also be applicable to other groups of phytoplasmas. Furthermore, the developed phytoplasma diagnostic kits were able to accurately detect only phytoplasma-infected strains, distinguishing them from healthy strains. These kits represent the first domestically developed phytoplasma diagnostic tools in South Korea. The Phytoplasma A-type Detection Kit and Phytoplasma B-type Detection Kit successfully detected phytoplasma in infected tree specimens within 30 min and 40 min, respectively, using sample DNA concentrations of 50–60 ng/μL. In the LoD analysis of this diagnostic assay, the lowest detectable concentration was determined to be 0.01 pg/μL. Therefore, the DNA concentration measured in this study was considered adequate and sufficient for the detection of Phytoplasma. This rapid detection capability allows for early diagnosis of phytoplasma infections. Meanwhile, the Phytoplasma A-type Detection Kit offers the advantage of indirectly confirming the concentration of phytoplasma for each strain by displaying FAM values, which not only indicate the presence of phytoplasma infection but also reflect the level of detection concentration. Moreover, the total DNA concentration extracted from each plant species does not correlate with phytoplasma density, making it impossible to determine phytoplasma density from DNA concentration alone. This phytoplasma diagnostic kit is expected to be useful in effectively assessing phytoplasma-infected strains in South Korea, as it allows rapid determination of the pathogen’s amplification levels across various samples.

Footnotes

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This paper was supported by a project, “Field Application of Phytoplasma Diagnostic Kit and Detection Efficiency Test” and “Development of POCT diagnostic kits for Detecting Phytoplasma Disease in Trees” from the National Institute of Forest Science, South Korea (Project No. FE0100-2018-10-2022).

References

  1. Akahori M., Miyazaki A., Koinuma H., Tokuda R., Iwabuchi N., Kitazawa Y., Maejima K., Namba S., Yamaji Y. Use of the 23S rRNA gene as a target template in the universal loop-mediated isothermal amplification (LAMP) of genomic DNA from phytoplasmas. Microbiol. Spectr. 2024;12:e0010624. doi: 10.1128/spectrum.00106-24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bekele B., Hodgetts J., Tomlinson J., Boonham N., Nikolić P., Swarbrick P., Dickinson M. Use of a real-time LAMP isothermal assay for detecting 16SrII and XII phytoplasmas in fruit and weeds of the Ethiopian Rift Valley. Plant Pathol. 2011;60:345–355. [Google Scholar]
  3. Bertaccini A., Duduk B., Paltrinieri S., Contaldo N. Phytoplasmas and phytoplasma diseases: a severe threat to agriculture. Am. J. Plant Sci. 2014;5:1763–1788. [Google Scholar]
  4. De Jonghe K., De Roo I., Maes M. Fast and sensitive on-site isothermal assay (LAMP) for diagnosis and detection of three fruit tree phytoplasmas. Eur. J. Plant Pathol. 2017;147:749–759. [Google Scholar]
  5. Dhama K., Karthik K., Chakraborty S., Tiwari R., Kapoor S., Kumar A., Thomas P. Loop-mediated isothermal amplification of DNA (LAMP): a new diagnostic tool lights the world of diagnosis of animal and human pathogens: a review. Pak. J. Biol. Sci. 2014;17:151–166. doi: 10.3923/pjbs.2014.151.166. [DOI] [PubMed] [Google Scholar]
  6. Dickinson M. Loop-mediated isothermal amplification (LAMP) for detection of phytoplasmas in the field. Methods Mol. Biol. 2015;1302:99–111. doi: 10.1007/978-1-4939-2620-6_8. [DOI] [PubMed] [Google Scholar]
  7. Gundersen D. E., Lee I.-M. Ultrasensitive detection of phytoplasmas by nested-PCR assays using two universal primer pairs. Phytopathol. Mediterr. 1996;35:144–151. [Google Scholar]
  8. Hammond C., Pérez-López E., Town J., Vincent C., Moreau D., Dumonceaux T. Detection of blueberry stunt phytoplasma in Eastern Canada using cpn60-based molecular diagnostic assays. Sci. Rep. 2021;11:22118. doi: 10.1038/s41598-021-01439-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Han M. S., Noh E. W., Yun J. K. Differentiation of phytoplasmas infecting Zizyphus jujuba and Paulownia coreana using PCR-RFLP. Plant Pathol. J. 2001;17:189–193. [Google Scholar]
  10. Han S., Cha B. Phylogenetic relationship of tree phytoplasmas in Korea. Korean J. Mycoplasmol. 2001;12:38–47. [Google Scholar]
  11. Han S., Cha B. Genetic similarity between jujube witches’ broom and mulberry dwarf phytoplasmas transmitted by Hishimonus sellatus Uhler. Plant Pathol. J. 2002;18:98–101. [Google Scholar]
  12. Han S.-S., Lee G.-W., Kim J.-S., Park J.-H., Lee S. K., Seralathan K.-K. Strains related to ‘Candidatus Phytoplasma ulmi’-are associated with Chinese Elm yellows in Korea. J. Plant Pathol. 2021a;103:1339–1340. [Google Scholar]
  13. Han S.-S., Baek S.-J., Lee S.-H., Seo S.-T., Seralathan K.-K. First report of aster yellows phytoplasma (16SrI-B) associated with witches’ broom disease of Melia azedarach var. japonica in Korea. J. Phytopathol. 2015;163:1055–1058. [Google Scholar]
  14. Han S.-S., Lee G.-W., Seralathan K.-K. First report of ‘Candidatus Phytoplasma asteris’ (16SrI-B) causing witches’-broom disease of Boehmeria pannosa Nakai & Satake in Korea. J. Plant Pathol. 2021b;103:1049–1050. [Google Scholar]
  15. Hodgetts J. Rapid sample preparation and LAMP for phytoplasma detection. Methods Mol. Biol. 2019;1875:187–201. doi: 10.1007/978-1-4939-8837-2_15. [DOI] [PubMed] [Google Scholar]
  16. Jung H. Y. Ph.D. thesis. The University of Tokyo; Tokyo, Japan: 2003. Phylogenetic classification of phytoplasmas that occur in Korea; p. 107. [Google Scholar]
  17. Jung H.-Y., Win N. K. K., Kim Y.-H. Current status of phytoplasmas and their related diseases in Korea. Plant Pathol. J. 2012;28:239–247. [Google Scholar]
  18. Kamala-Kannan S., Han S.-S., Lee K.-J., Velmurugan P., Lee Y. H., Chae J.-C., Lee Y.-S., Lee J.-Y., Oh B.-T. Association of elm yellows subgroup 16SrV-B phytoplasma with a disease of Hovenia dulcis. J. Phytopathol. 2011;159:171–174. [Google Scholar]
  19. Kim Y.-H., Jung H.-Y. Candidatus Phytoplasma trifolii associated with witches’ broom of Lespedeza cyrtobotrya M. Plant Pathol. J. 2007;23:106–108. [Google Scholar]
  20. Kogovšek P., Hodgetts J., Hall J., Prezelj N., Nikolić P., Mehle N., Lenarčič R., Rotter A., Dickinson M., Boonham N., Dermastia M., Ravnikar M. LAMP assay and rapid sample preparation method for on-site detection of flavescence dorée phytoplasma in grapevine. Plant Pathol. 2015;64:286–296. doi: 10.1111/ppa.12266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kumari S., Nagendran K., Rai A. B., Singh B., Rao G. P., Bertaccini A. Global status of phytoplasma diseases in vegetable crops. Front. Microbiol. 2019;10:1349. doi: 10.3389/fmicb.2019.01349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lee G. W. M.S. thesis. Jeonbuk National University; Jeonju, Korea: 2020. Investigation of decline for Elaeocarpus sylvestris var. ellipticus caused by phytoplasma in Korea. in Korean. [Google Scholar]
  23. Lee G.-W., Han S.-S. Molecular detection of phytoplasmas of the 16SrI and 16SrXXXII groups in Elaeocarpus sylvestris trees with decline disease in Jeju Island, South Korea. Plant Pathol. J. 2023;39:149–157. doi: 10.5423/PPJ.OA.07.2022.0091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lee I.-M., Hammond R. W., Davis R. E., Gundersen D. E. Universal amplification and analysis of pathogen 16S rRNA for classification and identification of mycoplasma like organisms. Phytopathology. 1993;83:834–842. [Google Scholar]
  25. Musetti R., Pagliari L. Phytoplasmas: methods and protocols. Springer; New York, USA: 2019. p. 362. [Google Scholar]
  26. Nair S., Manimekalai R., Ganga Raj P., Hegde V. Loop mediated isothermal amplification (LAMP) assay for detection of coconut root wilt disease and arecanut yellow leaf disease phytoplasma. World J. Microbiol. Biotechnol. 2016;32:108. doi: 10.1007/s11274-016-2078-4. [DOI] [PubMed] [Google Scholar]
  27. Namba S. Molecular and biological properties of phytoplasmas. Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 2019;95:401–418. doi: 10.2183/pjab.95.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Notomi T., Okayama H., Masubuchi H., Yonekawa T., Watanabe K., Amino N., Hase T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28:E63. doi: 10.1093/nar/28.12.e63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Obura E., Masiga D., Wachira F., Gurja B., Khan Z. R. Detection of phytoplasma by loop-mediated isothermal amplification of DNA (LAMP) J. Microbiol. Methods. 2011;84:312–316. doi: 10.1016/j.mimet.2010.12.011. [DOI] [PubMed] [Google Scholar]
  30. Siemonsmeier A., Hadersdorfer J., Neumüller M., Schwab W., Treutter D. A LAMP protocol for the detection of ‘Candidatus Phytoplasma pyri’, the causal agent of pear decline. Plant Dis. 2019;103:1397–1404. doi: 10.1094/PDIS-12-18-2150-RE. [DOI] [PubMed] [Google Scholar]
  31. Siriwardhana P. H. A. P.n, Gunawardena B. W. A., Millington S. Detection of phytoplasma associated with Waligama Coconut Leaf Wilt Disease in Sri Lanka by loop mediated isothermal amplification assay performing alkaline polyethylene glycol based DNA extraction. J. Microbiol. Biotechnol. Res. 2012;2:712–716. [Google Scholar]
  32. Sugawara K., Himeno M., Keima T., Kitazawa Y., Maejima K., Oshima K., Namba S. Rapid and reliable detection of phytoplasma by loop-mediated isothermal amplification targeting a housekeeping gene. J. Gen. Plant Pathol. 2012;78:389–397. [Google Scholar]
  33. Tomlinson J. A., Boonham N., Dickinson M. Development and evaluation of a one-hour DNA extraction and loop-mediated isothermal amplification assay for rapid detection of phytoplasmas. Plant Pathol. 2010;59:465–471. [Google Scholar]
  34. Tran-Nguyen L. T. T., Kube M., Schneider B., Reinhardt R., Gibb K. S. Comparative genome analysis of “Candidatus Phytoplasma australiense” (subgroup tuf-Australia I; rp-A) and “Ca. Phytoplasma asteris” strains OY-M and AY-WB. J. Bacteriol. 2008;190:3979–3991. doi: 10.1128/JB.01301-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Wang S., Wang S., WS, Lin C., Yu S., YS, Wang L., Piao C., Guo M., Guozhong T. Loop-mediated isothermal amplification assay for detection of five phytoplasmas belonging to 16SrI group based on target tuf gene. Sci. Silvae Sin. 2017;53:54–63. [Google Scholar]
  36. Yu S.-S., Che H.-Y., Wang S.-J., Lin C.-L., Lin M.-X., Song W.-W., Tang Q.-H., Yan W., Qin W.-Q. Rapid and efficient detection of 16SrI group areca palm yellow leaf phytoplasma in China by loop-mediated isothermal amplification. Plant Pathol. J. 2020;36:459–467. doi: 10.5423/PPJ.OA.06.2020.0094. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Plant Pathology Journal are provided here courtesy of The Korean Society of Plant Pathology

RESOURCES