Abstract
Inflammation is a protective response that occurs when the body is injured and is a primary pathological process that occurs in certain diseases, such as inflammatory bowel diseases, osteoarthritis and acute lung injury. Milk-derived exosomes (M-Exos) contain various physiologically active substances related to immunity. These substances can act on cells to lessen the damage attributed to inflammation. The present study aimed to extract M-Exos and explore the protective mechanism of M-Exos on the lipopolysaccharide (LPS)-induced inflammatory response in RAW 264.7 cells, a mouse macrophage cell line. Ultra-high speed cryo-centrifugation was used to extract M-Exos. Transmission electron microscopy, nanoparticle tracking analysis and western blotting were used to identify the M-Exos. Western blotting, reverse transcription-quantitative PCR and ELISA were used to analyze cellular inflammatory factors, oxidative stress factors and relevant inflammatory signaling pathways. These results indicated that treatment with M-Exos led to a notable recovery in cell viability and an improvement in the intracellular glutathione reduction induced by LPS. Reduced secretion of pro-inflammatory factors nitric oxide, IL-6 and TNF-α were also observed, as well as decreased expression levels of the oxidative stress factors nitric oxide synthase and cyclooxygenase-2. Furthermore, M-Exos could impact inflammation by regulating the toll-like receptor 4/NF-κB and PI3K/AKT signaling pathways and reducing apoptosis. Therefore, M-Exos may serve as a nutritional component of anti-inflammatory food, which could influence the occurrence and development of inflammation.
Keywords: milk-derived exosomes, toll-like receptor 4/NF-κB, PI3K/AKT, anti-inflammatory, apoptosis
Introduction
Inflammation is a physiological process in which tissues within the vascular system are stimulated by various factors, such as injury (1). Inflammation is a protective response that eliminates damage caused by stimuli and facilitates the repair of damaged tissues, thereby serving a key role in immune regulation (2). However, excessive inflammation can cause serious organ damage and dysfunction, potentially leading to autoimmune diseases, neurodegenerative diseases or cancer and thus significantly affecting the quality of life of patients (3,4). The exploration of novel therapeutic approaches for treatment of the inflammatory process has emerged as a focus for researchers.
Milk is a source of nutrition in the human diet, comprising of a multitude of nutrients, growth regulators, immune-related factors and other physiologically active substances, such as oligosaccharides and active peptides (5). Milk possesses anti-inflammatory and anti-oxidative properties (6,7). Additionally, milk is typically inexpensive and widely available body fluid that can be produced on an industrial scale in a manner that retains exosomes (Exos), enabling the extraction of milk-derived Exos (M-Exos). Due to the strong biocompatibility, high stability, safety profile and other biological characteristics of milk, as well as its anti-inflammatory, anti-apoptotic and tissue repair functions, M-Exos have been investigated in medical research (8-10).
M-Exos contain certain immune-related physiologically active substances, such as microRNAs (miRNA) and amino acids (11-14). These substances can transmit biological information into target cells in the body and serve a biological role in inflammatory reactions by transporting factors between cells and regulating biological pathways in recipient cells (15). Reif et al (16) reported that miRNAs or proteins, such as TGF-β or DNA methyltransferases, found in M-Exos regulate inflammation, induce cell proliferation and contribute to the repair of colon tissue injury during colitis. The recovery effect of colon tissue injury is superior compared with that of human milk and it can be used as a premium nutritional supplement to human milk and be incorporated into enteral nutrition formulas. Ocansey et al (17) assessed the impact of M-Exos on intestinal inflammation in an ulcerative colitis (UC) mouse model and reported that M-Exos possess cytoprotective and anti-inflammatory properties, indicating that M-Exos may be important in the prevention and progression of UC. However, the precise mechanisms of underlying process are yet to be fully elucidated.
Macrophages are essential parts of the immune system that significantly contribute to the inflammatory response (18). LPS can bind to toll-like receptor 4 (TLR4) on the surface of macrophages, resulting in a cascade of events that disrupt cell-signaling pathways and cytokine secretion, leading to inflammation (19,20). The TLR4/NF-κB and PI3K/AKT inflammatory signaling pathways are involved in the onset and progression of LPS-induced RAW 264.7 macrophage inflammation, which are strongly associated with the production and release of pro-inflammatory factors. Crosstalk also exists between the TLR4/NF-κB and PI3K/AKT signaling pathways (21-23). The present study used LPS to stimulate macrophages to establish a model of cellular inflammation. The occurrence and development of LPS-induced macrophage-related inflammation was investigated using M-Exos, with the aim of clarifying the mechanism by which M-Exos regulate inflammation. These results provided an experimental basis for subsequent research and application of M-Exos, a natural bioactive substance, and offered new insights into anti-inflammatory nutrients in food.
Materials and methods
Materials
LPS (cat. no. L6529) extracted from Escherichia coli O55:B5 was obtained from Sigma-Aldrich (Merck KGaA). FBS, penicillin G, streptomycin and DMEM were obtained from Gibco (Thermo Fisher Scientific, Inc.). Methylthiazolyldiphenyl-tetrazolium bromide (MTT; ≥98%) was obtained from Beijing Solarbio Science & Technology Co., Ltd. DMSO (≥99%) was obtained from Sinopharm Chemical Reagent Co., Ltd. The following rabbit antibodies were purchased from Beyotime Institute of Biotechnology: Anti-TLR4 (cat. no. AF8187; 1:1,000), anti-GAPDH (cat. no. AG8015; 1:3,000), anti-inducible nitric oxide synthase (iNOS) (cat. no. AF7281; 1:1,000), anti-cyclooxygenase-2 (COX2) (cat. no. AF1924; 1:1,000) and Cy3-labeled goat anti-rabbit IgG (H+L) (cat. no. A0516; 1:500). Rabbit anti-phosphorylated (p)-p65, anti-p65 antibodies and HRP-conjugated goat anti-rabbit IgG were purchased from Sangon Biotech. Rabbit anti-p-IκBα, anti-IκBα, anti-tumor susceptibility 101 (TSG101), anti-CD63 and anti-CD81 antibodies were purchased from Abcam. Rabbit anti-p-PI3K, anti-PI3K, anti-p-AKT, anti-AKT, anti-Bax and anti-Bcl2 antibodies were purchased from Cell Signaling Technology, Inc.
Isolation of exosomes in milk
M-Exos were isolated according to a previously described method, in which M-Exos were obtained from bovine milk through a combination of centrifugation and isoelectric-point precipitation (24,25). A 720 ml bottle of non-fat (<0.5%) pasteurized fresh milk was purchased from Jingdong Supermarket (Nei Mongol, China). The milk was centrifuged at 13,000 x g for 30 min at 4˚C to remove the upper fat layer, part of the casein and lower cellular remains. The pH of the milk was adjusted to 4.6 (the isoelectric point of casein) with ~15 ml 2 mol/l hydrochloric acid to precipitate casein. The protein precipitate was removed by centrifugation at 10,000 x g for l h at 4˚C and the residual proteins in the collected supernatant were removed by filtration through 0.45 and 0.22 µm injection filters. The supernatant was ultracentrifuged using a horizontal rotor at 135,000 x g for 1 h at 4˚C (ultra-centrifuge CP80NX; Hitachi, Ltd.). The precipitate was obtained by washing with 4˚C precooled sterile PBS solution three times and resuspended in PBS to obtain the purified M-Exo sample. The protein content of M-Exo was assessed using a BCA protein assay kit (cat. no. P0012S; Beyotime Institute of Biotechnology).
Characterization of exosomes
The physical dimensions of M-Exos were evaluated using a nanoparticle tracking analyzer (NTA; cat. no. NS300) and Nanosight NTA3.2 software (Malvern Instruments, Ltd.). The characterization of M-Exos was conducted using transmission electron microscopy (TEM; cat. no. JEOL-2100F; JEOL Ltd.). Western blotting was employed to assess the protein expression profile of M-Exos by detecting TSG101 (cat. no. ab133586), CD63 (cat. no. ab134045) and CD81 (cat. no. ab286173) expression levels at a dilution of 1:1,000. Western blotting was performed as described below.
Cell culture and treatment
RAW 264.7 cells were obtained from The Cell Bank of Type Culture Collection of The Chinese Academy of Science. Cells were cultured in DMEM supplemented with high glucose (4.5 g/l), 10% FBS, 0.5% penicillin G and 0.5% streptomycin. Cells were incubated at 37˚C in a humidified atmosphere with 5% CO2. Cells were passaged every 2 days. Once cells reached 70-80% confluence, the cells were scraped using a cell scraper and 1/4 of the cell fluid was removed and added to DMEM high-glucose complete medium (Gibco; Thermo Fisher Scientific, Inc.). In a T25 cell culture bottle (Wuxi NEST Biotechnology Co., Ltd.), the cells were evenly distributed by shaking horizontally and subsequently incubated at 37˚C and 5% CO2. To determine the role of M-Exos in regulating inflammation and the underlying mechanisms of action, the RAW 264.7 macrophages were categorized as follows: i) The control group, which consisted of cells cultured in DMEM alone for 24 h; ii) the LPS group, which included cells cultured in DMEM supplemented with 1 µg/ml LPS for 24 h at 37˚C; and iii) the LPS + M-Exos group, which comprised cells cultured in DMEM containing 1 µg/ml LPS and 25, 50 or 100 µg/ml M-Exos for 24 h at 37˚C.
Cell viability evaluation by MTT assay
The RAW 264.7 cells were seeded at a density of 1x104 cells/well in 96-well plates. The DMEM group was cultured in DMEM medium, the Exo group was cultured in DMEM with different M-Exos concentrations (10, 20, 50, 100, 200 and 400 µg/ml), the LPS group was cultured with 1 µg/ml LPS and the LPS + M-Exos group was cultured with 1 µg/m LPS and different Exos concentrations (10, 20, 50, 100 and 200 µg/ml). Following a 24 h incubation period at 37˚C, a 1% MTT solution was added to each well and cells were incubated in the dark for 4 h. Thereafter, the medium was aspirated and replaced with 100 µl of DMSO in each well. Following a 10 min incubation at 37˚C, the absorbance was determined at a wavelength of 570 nm using a microplate reader (Multiskan; Thermo Fisher Scientific, Inc.). Cell viability was calculated using the following formula: Cell viability (%)=OD absorbance of tested groups/OD absorbance of control group x100.
ELISA assay
The RAW 264.7 cells were seeded at a density of 3x105 cells/well in 6-well plates for 24 h and each group was treated as aforementioned. After 24 h of co-culture with M-Exos, the cell medium was collected and centrifuged at 500 x g for 5 min at room temperature. The serum of mice was collected by centrifugation at 1,500 x g for 15 min at 4˚C. Subsequently, the supernatant was analyzed using a Rat IL-6 Uncoated ELISA Kit (cat. no. 88-50625-88; Thermo Fisher Scientific, Inc.) and Mouse TNF alpha Uncoated ELISA Kit (cat. no. 88-7324-88; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions.
Reverse transcription-quantitative PCR (RT-qPCR)
RT-qPCR was used to quantify the mRNA expression levels of IL-6, TNF-α, iNOS and COX-2. Total RNA was extracted from RAW 264.7 cells and colon tissues using a commercial RNeasy™ Total RNA extraction kit (Beyotime Institute of Biotechnology) following the manufacturer's instructions. RT was performed using a Revert Aid First-Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Inc.) using the same concentration of RNA/sample of each group, following the manufacturer's instructions. Gene expression was quantified by RT-qPCR using an UltraSYBR mixture (Jiangsu CoWin Biotech Co., Ltd.) using a LightCycler® 96 real-time system (Roche Diagnostics GmbH). Initial denaturation was performed at 95˚C for 10 min, denaturation at 95˚C for 15 sec, and annealing and extension at 60˚C for 1 min (35 cycles). GAPDH was used as the normalization control and the data were analyzed using the 2-ΔΔCq method (26). The primer sequences for each target gene are shown in Table I.
Table I.
PCR primer sequences used in RAW264.7 cells.
| Gene | Sequence (5'-3') |
|---|---|
| IL-6 forward | ACAACCACGGCCTTCCCTACTT |
| IL-6 reverse | CACGATTTCCCAGAGAACATGTG |
| TNF-α forward | AAGCCTGTAGCCCACGTCGTA |
| TNF-α reverse | GGCACCACTAGTTGGTTGTCTTTG |
| iNOS forward | GAGCTCGGGTTGAAGTGGTATG |
| iNOS reverse | GAAACTATGGAGCACAGCCACAT |
| COX-2 forward | CTGGTGCCTGGTCTGATGATGTATG |
| COX-2 reverse | AGCTGTACTCCTGGTCTTCAATGTTG |
| GAPDH forward | GAGCCAAACGGGTCATCATCT |
| GAPDH reverse | GAGGGGCCATCCACAGTCTT |
iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase-2.
Measurement of nitric oxide (NO) levels
RAW 264.7 cells were seeded at a density of 3x105 cells/well in 6-well plates for 24 h. The supernatant of RAW 264.7 cells was collected at 500 x g for 5 min at 4˚C for the measurement of NO using a commercial NO detection kit (cat. no. S0021S; Beyotime Institute of Biotechnology) in accordance with the manufacturer's instructions.
Measurement of glutathione (GSH) levels
RAW 264.7 cells were seeded at a density of 3x105 cells/well in 6-well plates for 24 h. The precipitate of RAW 264.7 cells was collected by centrifugation at 300 x g for 5 min and protein removal reagent S solution (Beyotime Institute of Biotechnology) was added at three times the volume of the cell precipitate. After vortexing thoroughly and incubating at 4˚C for 10 min, the homogenate was centrifuged at 10,000 x g for 10 min at 4˚C. The supernatant was collected for measurement of total GSH using a commercial GSH assay kit (cat. no. S0053; Beyotime Institute of Biotechnology) in accordance with the manufacturer's instructions.
Western blotting
RAW 264.7 cells were seeded at a density of 3x105 cells/well in 6-well plates for 24 h. After 24 h of co-culture with M-Exos, the cell medium was aspirated and 80 µl of RIPA lysis buffer (Beyotime Institute of Biotechnology) and 1 mM PMSF (Sangon Biotech Co., Ltd.) were added. Cells were subsequently lysed on ice. Samples were centrifuged at 12,000 x g for 10 min at 4˚C and the supernatant was used for subsequent experiments. Protein samples were measured using a Pierce™ BCA protein assay kit (Beyotime Institute of Biotechnology) in accordance with the manufacturer's instructions. After protein denaturation with loading buffer (Beyotime Institute of Biotechnology), protein samples (20 µg) were separated using 10% SDS-PAGE. Proteins were subsequently transferred from the gel to a PVDF membrane (MilliporeSigma). The PVDF membrane was treated with a blocking solution (QuickBlock™ Western; cat. no. P0252; Beyotime Institute of Biotechnology) to inhibit non-specific binding at room temperature for 10 min, then the membranes were incubated at 4˚C for 12-16 h with the primary antibodies. Following removal of the primary antibodies, the membrane was incubated with secondary antibodies for 1 h at room temperature. The membrane was rinsed three times (10 min/rinse) with TBS-T solution (0.1% Tween 20) after each step. Protein bands were visualized using a chemiluminescence image-analysis system (Tanon-5200; Tanon Science and Technology Co., Ltd.). The antibodies used were as follows: Rabbit anti-iNOS (cat. no. AF7281; 1:1,000), anti-COX-2 (cat. no. AF1924; 1:1,000), anti-TLR4 (cat. no. AF8187; 1:1,000), anti-p-p65 (cat. no. D155006; 1:1,000), anti-p65 (cat. no. D221030; 1:1,000), anti-p-IκBα (cat. no. ab133462; 1:5,000), anti-IκBα (cat. no. ab32518; 1:2,000), anti-p-PI3K (cat. no. 17366T; 1:1,000), anti-PI3K (cat. no. 4249T; 1:1,000), anti-p-AKT (cat. no. 4060T; 1:1,000), anti-AKT (cat. no. 9271T; 1:1,000), anti-GAPDH (cat. no. AG8015; 1:3,000), anti-Bax (cat. no. 2772T; 1:1,000), anti-Bcl2 (cat. no. 3498T; 1:1,000) and HRP-conjugated goat anti-rabbit IgG (cat. no. D110058; 1:10,000). Gray scan analysis was performed using ImageJ software (version 1.8.0; National Institutes of Health).
Immunofluorescence (IF) staining
RAW 264.7 cells were seeded at a density of 2x104 cells/well onto confocal dishes for 24 h. After 24 h of co-culture with M-Exos, the cell medium was aspirated. Cells were fixed using 4% paraformaldehyde (Beyotime Institute of Biotechnology) at room temperature for 10 min and subsequently subjected to blocking with the QuickBlock™ Blocking Buffer (Beyotime Institute of Biotechnology) at room temperature for 1 h. Permeabilization of the cells was performed using 0.5% Triton X-100 (Beyotime Institute of Biotechnology) for 15 min at room temperature. Subsequently, cells were incubated overnight at 4˚C with rabbit anti-iNOS antibodies (cat. no. AF7281; 1:300). The primary antibodies were removed, and the cells were incubated with Cy3-labeled secondary antibodies (cat. no. A0516; 1:500; Beyotime Institute of Biotechnology) at room temperature for 60 min. Then, the cell nucleus was stained using DAPI (Beyotime Institute of Biotechnology) at room temperature for 15 min in the dark. The samples were imaged using a fluorescence microscope (Ti-U; Nikon Corporation).
Animal experiments
Female C57BL/6J mice (n=15) were obtained from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. and kept in the experimental animal center of Wuxi Medical College at Jiangnan University (Wuxi, China). The specific-pathogen-free conditions were as follows: 20-26˚C, 45±10% humidity and 12 h/light-dark cycle. Mice were allowed to acclimate for 1 week, and then the experiment was conducted for 1 week. To establish the UC model, the mice were administered drinking water containing 3.0% (w/v) dextran sodium sulfate (DSS; 36-50 kDa; Dalian Meilun Biotechnology Co., Ltd.) for 7 days. The control group was provided ordinary drinking water. Mice were randomly divided into 3 groups (n=5/group): i) Control group; ii) DSS group; and iii) Exos-treated DSS group (Exos). The control and DSS groups were administered 200 µl PBS intragastrically daily, while the Exos group was administered intragastrically 400 µg of M-Exos daily. All groups were provided with standard maintenance feed for 7 days and euthanized on day 8. The weight of the mice was measured daily, and the disease activity index (DAI) was recorded (27). Animals (n=15) were anesthetized using 1 ml of 4% isoflurane for induction of anesthesia, followed by 1 ml of 1.5% isoflurane for maintenance and then euthanized by cervical dislocation. To confirm verify animal death following euthanasia, examination of cardiac arrest and reflex absence were assessed. No mice died unexpectedly during the experiment. The colon tissues and serum from each group were collected and subsequently frozen at -80˚C. All animal experimental protocols were approved by the Animal Ethics Committee of Jiangnan University [approval no. 20230830c1201005(355); Wuxi, China].
Statistical analysis
All experiments were performed in triplicate and the data are expressed as mean ± SEM. Statistical analysis was performed using the SPSS software (version 26.0; IBM Corp.) and data were presented using the GraphPad Prism software (version 8; Dotmatics). The Shapiro-Wilk and Levene tests were used to test the data normality and homogeneity of variance. If P>0.05, the data were considered to be normally distributed, whereas if P>0.05, the data were considered to have equal variance. The difference among groups was determined using a one-way ANOVA followed by Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.
Results
Preparation and characterization of M-Exos
The protein concentration of the M-Exos extracted was 1.0-1.5 mg/ml, as assessed using a BCA assay. TEM analysis showed that the extracted M-Exos exhibited classical the Exo structural feature of a round or elliptical cup-shaped morphology (Fig. 1A). NTA demonstrated that the diameter of the bovine M-Exos ranged from 20-150 nm, with a particle size of 115.7±1.7 nm (Fig. 1B) and a particle concentration of 1.14x10-9 particles/ml. Western blot analysis demonstrated that the Exo-enriched proteins CD63, CD81 and TSG101 were expressed in the extracted M-Exos (Fig. 1C). These results demonstrated the successful extraction of M-Exos, which were used in subsequent experiments.
Figure 1.
Preparation and characterization of M-Exos. (A) Representative TEM images of Exos morphology. Scale bar, 200 nm. (B) Particle size graph and representative image of the distribution of Exos detected using a nanoparticle tracking analyzer. Scale bar, 200 nm. (C) Expression of exosomal markers (CD63, CD81 and TSG101) evaluated using western blotting. Exos, exosomes; M-Exos, milk-derived Exos; TSG101, tumor susceptibility 101.
Effect of M-Exos on the proliferation of RAW 264.7 cells
To assess the impact of M-Exos on the viability of RAW 264.7 cells, a series of M-Exos concentrations (10, 20, 50, 100, 200 and 400 µg/ml) were added to the RAW 264.7 cell cultures for 24 h. The objective was to evaluate the effect of M-Exos on the viability of RAW 264.7 cells (Fig. 2A). Compared with the control group, the administration of M-Exos from 0 to 200 µg/ml did not exert any significant adverse effects on the viability of RAW 264.7 cells after 24 h of co-culture. However, M-Exos at a concentration of 400 µg/ml caused a significant decrease in the viability of RAW 264.7 cells. Accordingly, the subsequent experiments were conducted using M-Exo concentrations of 10, 20, 50, 100 and 200 µg/ml.
Figure 2.
Effects of M-Exos on the proliferation of (A) RAW264.7 cells or (B) LPS-induced RAW264.7 cells. Data are presented as mean ± SEM (n=3). *P<0.05, **P<0.01 and ***P<0.001 vs. control group. #P<0.05, ##P<0.01 and ###P<0.001 vs. LPS group. Exos, exosomes; M-Exos, milk-derived Exos; LPS, lipopolysaccharides; Con, control.
To evaluate the effect of M-Exos on the viability of LPS-induced RAW 264.7 cells, different concentrations of M-Exos (10, 20, 50, 100 and 200 µg/ml) were added to DMEM high-glucose medium containing 1 µg/ml of LPS and cells were incubated for 24 h and cell viability was assessed (Fig. 2B). Compared with the control group, the cell viability of the LPS alone group was significantly reduced by ~40%. Significant differences were observed in the cell viability of the groups treated with different concentrations of M-Exos compared with the LPS group (P<0.05). Increased M-Exos concentration caused an increase in cell viability, with the highest level of cell viability recorded at an M-Exo concentration of 100 µg/ml.
Effect of M-Exos on the expression of inflammatory cytokines in RAW 264.7 cells
Compared with the control group, LPS stimulation significantly increased the secretion of IL-6 and TNF-α pro-inflammatory factors by RAW 264.7 cells (P<0.05; Fig. 3A and B). Following incubation with M-Exos, the secretion of IL-6 and TNF-α decreased significantly, except in the RAW 264.7 cells treated with the lowest concentration of M-Exos (25 µg/ml). Increased secretion of NO caused by LPS stimulation of RAW 264.7 cells was significantly reduced by M-Exo co-culture treatment (P<0.05) (Fig. 3C). Following LPS stimulation, the mRNA expression levels of IL-6 and TNF-α in RAW264.7 cells increased significantly (Fig. 3D and E). Conversely, the expression levels of IL-6 and TNF-α decreased significantly following M-Exos treatment (P<0.05), except in lowest concentration group (25 µg/ml), which was consistent with the ELISA results. Following, M-Exo co-culture, the excessive consumption of GSH in RAW 264.7 cells stimulated by LPS was significantly recovered (P<0.05; Fig. 3F). As the concentration of M-Exos increased, the ability of M-Exos to inhibit the secretion of inflammatory factors becomes more pronounced. This indicated that M-Exos exert a dose-dependent effect on the cellular inflammatory response. Accordingly, 100 µg/ml was selected as the optimal concentration of M-Exos for subsequent studies on anti-inflammatory activity. In conclusion, M-Exos may positively regulate the expression levels of inflammatory factors in RAW 264.7 cells.
Figure 3.
Effect of M-Exos on the expression of inflammatory cytokines in RAW264.7 cells. Concentration of (A) IL-6 and (B) TNF-α in culture supernatant measured by ELISA. (C) NO secretion was determined using the NO detection kit. Gene expression of (D) IL-6 and (E) TNF-α measured using reverse transcription-quantitative PCR. (F) GSH level. Data are presented as mean ± SEM (n=3). **P<0.01 and ***P<0.001 vs. control group. ##P<0.01 and ###P<0.001 vs. LPS group. M-Exos, milk-derived exosomes; NO, nitric oxide; GSH, glutathione; LPS, lipopolysaccharides; Con, control.
Effect of M-Exos on the expression of oxidative stress factors in RAW 264.7 cells
The relative expression levels of iNOS and COX-2 in RAW 264.7 cells were significantly increased in response to LPS stimulation compared with the control group (P<0.05; Fig. 4). Compared with the LPS group, the co-culture of M-Exos demonstrated a significant inhibitory effect on the relative protein expression levels of iNOS and COX-2, with a decrease of ~65 and 25%, respectively. Additionally, the mRNA expression levels of iNOS and COX-2 were decreased upon co-culture with M-Exos (P<0.05). After M-Exos co-culture, the decreased expression of iNOS was verified using IF (Fig. 4F); these results were consistent with the western blot and RT-qPCR results. These findings demonstrated that M-Exos can inhibit the LPS-induced synthesis of iNOS and COX-2 oxidative stress factors in RAW 264.7 cells.
Figure 4.
Effect of M-Exos on the expression of oxidative stress factors in RAW264.7 cells. (A) Western blot analysis of COX-2 and iNOS proteins. Protein semi-quantitative analysis of (B) iNOS and (C) COX-2 proteins. Gene expression levels of (D) iNOS and (E) COX-2 measured using reverse transcription-quantitative PCR. (F) iNOS expression was detected using confocal immunofluorescence. Scale bar, 10 µm. Data are presented as mean ± SEM (n=3). **P<0.01 and ***P<0.001 vs. control group. #P<0.05, ##P<0.01 and ###P<0.001 vs. LPS group. M-Exos, milk-derived exosomes; iNOS, inducible nitric oxide synthase; LPS, lipopolysaccharides; COX2, cyclooxygenase-2; BF, brightfield.
M-Exos decrease the LPS-induced activation of the TLR4/NF-κB signaling pathway in RAW 264.7 cells
The TLR4/NF-κB signaling pathway serves a pivotal role in the pathogenesis of LPS-induced inflammation in RAW 264.7 cells (21). Compared with the control group, the TLR4 receptor on the surface of macrophages was activated following LPS stimulation (Fig. 5), which was associated with the significantly increased phosphorylation of downstream proteins p65 and IκBα. Conversely, following M-Exos co-culture, the expression levels of related proteins (TLR4, p-p65 and p-iκBα) in this signaling pathway were significantly decreased (P<0.05). These findings demonstrated that M-Exos could impede the activation of the TLR4/NF-κB signaling pathway, thereby exerting a role in anti-inflammatory processes.
Figure 5.
Effects of M-Exos on the expression of TLR4/NF-κB signaling pathway related proteins in RAW264.7 cells. (A) Western blot analysis of TLR4/NF-κB signaling pathway-related proteins. (B) Protein semi-quantitative analysis of TLR4 protein. (C) Protein semi-quantitative analysis of p-P65 protein. (D) Protein semi-quantitative analysis of p-P65/P65. (E) Protein semi-quantitative analysis of p-iκBα protein. (F) Protein semi-quantitative analysis of p-iκBα/iκBα. Data are presented as mean ± SEM (n=3). *P<0.05, **P<0.01 and ***P<0.001 vs. control group. #P<0.05, ##P<0.01 and ###P<0.001 vs. LPS group. M-Exos, milk-derived exosomes; TLR4, toll-like receptor 4; LPS, lipopolysaccharides; Con, control.
M-Exos inhibit the LPS-induced activation of the PI3K/AKT signaling pathway in RAW 264.7 cells
The PI3K/AKT signaling pathway is key in regulating the proliferation and apoptosis of macrophages. This pathway is also associated with the development of inflammation (23). The activation state of the PI3K/AKT signaling pathway in RAW264.7 cells was therefore analyzed in the present study. Compared with the control group, LPS stimulation significantly increased the expression levels of the phosphorylated proteins PI3K and AKT (Fig. 6). Conversely, the expression levels of the phosphorylated proteins PI3K and AKT significantly decreased following co-culture with M-Exos (P<0.05). These findings demonstrated that M-Exos may control the advancement of the PI3K/AKT signaling pathway and regulate the progression of inflammation.
Figure 6.
Effects of M-Exos on the expression of PI3K/AKT signaling pathway and apoptosis related proteins in RAW264.7 cells. (A) Western blot analysis of PI3K/AKT signaling pathway and apoptosis related proteins. (B) Protein semi-quantitative analysis of p-PI3K protein. (C) Protein semi-quantitative analysis of p-PI3K/PI3K. (D) Protein semi-quantitative analysis of p-AKT protein. (E) Protein semi-quantitative analysis of p-AKT/AKT. (F) Protein semi-quantitative analysis of Bax protein. (G) Protein semi-quantitative analysis of Bcl-2 protein. (H) Protein semi-quantitative analysis of Bcl-2/Bax. Data are presented as mean ± SEM (n=3). *P<0.05, **P<0.01 and ***P<0.001 vs. control group. #P<0.05, ##P<0.01 and ###P<0.001 vs. LPS group. M-Exos, milk-derived exosomes; LPS, lipopolysaccharides; Con, control.
M-Exos reduce LPS-induced apoptosis in RAW 264.7 cells
LPS has been reported to stimulate RAW 264.7 cells to secrete certain inflammatory factors, leading to the occurrence of abnormal apoptosis. Proteins associated with apoptosis are also regulated by the NF-κB and PI3K/AKT signaling pathways (28,29). The ratio of Bcl-2/Bax protein expression levels in the LPS group was significantly decreased compared with the control group (P<0.05; Fig. 6). These findings indicated that LPS stimulation resulted in increased apoptosis. However, the co-culture with M-Exos reversed this trend. Therefore, M-Exos could inhibit the apoptosis of RAW 264.7 cells induced by LPS. M-Exos inhibited LPS-induced apoptosis in RAW 264.7 macrophages by restoring Bcl-2/Bax ratio and modulating NF-κB/PI3K/AKT pathways, demonstrating therapeutic potential against LPS-induced inflammation.
Effects of M-Exos on the inflammation of DSS-induced colitis in mice
The body weight of mice in each treatment group was measured and these results showed that the weight of mice in the control group increased steadily and gradually over time (Fig. 7A). By contrast, the weight of mice consuming DSS began to decline on the 3rd day of treatment. By the 7th day, the average weight of mice in the DSS group had decreased by ~10% compared with their weight at the beginning of the experiment, while the weight of mice in the Exos group, which received treatment concurrently, decreased by ~5%, demonstrating a significant improvement in body weight loss compared with the DSS group. Furthermore, the colon length of mice administered with 3% DSS was significantly reduced compared with the control group, whereas the Exos group exhibited a notable increased in colon length, counteracting the shortening caused by DSS (P<0.05; Fig. 7B and C). Based on weight loss, the presence of sticky stools and occult blood in the stool, the DAI scores of DSS-fed mice were significantly increased compared with the control, while those of M-Exos-fed mice were significantly decreased compared with the DSS group (P<0.05; Fig. 7D). To investigate the secretion of intestinal inflammatory factors, the levels of certain inflammatory factors in the serum of mice were measured. The serum levels of IL-6 and TNF-α in the DSS group and the expression levels of IL-6 and TNF-α in colon tissue were also significantly increased compared with the control (Fig. 7E-H). By contrast, the Exos group exhibited a significant decrease in both the secretion and transcription of the aforementioned inflammatory factors compared with the DSS group (P<0.05). To summarize, M-Exos could effectively reduce inflammation levels in a mouse colitis model.
Figure 7.
Effects of M-Exos on the inflammation of DSS-induced colitis in mice. (A) Body weight. (B) Representative colon images. (C) Colon length. (D) DAI. Concentration of (E) IL-6 and (F) TNF-α in serum measured using ELISA. Gene expression levels of (G) IL-6 and (H) TNF-α measured using reverse transcription-quantitative PCR. Data are presented as mean ± SEM (n=5). **P<0.01 and ***P<0.001 vs. control group. #P<0.05 and ###P<0.001 vs. DSS group. M-Exos, milk-derived exosomes; DAI, disease activity index; DSS, dextran sodium sulfate.
Discussion
Purified M-Exos were extracted using a protocol combining the isoelectric-point precipitation protein method with ultra-high-speed refrigerated centrifugation. The pH of the defatted milk solution was adjusted to 4.6 using a diluted hydrochloric acid solution to reach the isoelectric point of casein (30), thereby precipitating and removing protein. NTA is an emerging nanoscale identification technology whereby particles are tracked and analyzed using high-speed cameras and software (31). The results of the present study demonstrated that the particle-size distribution of M-Exos was narrow, which indicated a relatively uniform size, suggesting their possible utilization for subsequent research. Western blotting is a commonly used method for the identification of M-Exos. In the present study, the expression of Exo-related marker proteins, including the transmembrane proteins CD63 and CD81 and the membrane-transport complex protein TSG101, were detected in the extracted nanoparticles. Therefore, the nanoparticles were those of M-Exos. A cup-shaped saucer structure was observed using TEM, which confirmed the successful extraction of M-Exos and demonstrated that the particle-size distribution was consistent with that detected by NTA. These findings indicated that the M-Exos extracted in the present study met the three-step identification criteria established by the International Society for Extracellular Vesicles (32). Consequently, M-Exos have the potential to be utilized for subsequent research and applications.
The inflammatory response is a vital mechanism for combating infection and injury. This process is precisely regulated to enable the body to resist pathogens and restore tissue homeostasis. Macrophages, innate immune cells with a tissue residence, serve a pivotal role in the regulation of inflammation (33). It has been reported that M-Exos can enhance macrophage activity, stimulate cell proliferation and suppress the inflammatory response to pathogens (34). Matic et al (35) demonstrated that M-Exos exhibit stability under both normal oxygen levels and hypoxia. In the presence of sufficient oxygen, the proliferation of RAW 264.7 cells is markedly enhanced, whereas cisplatin-induced apoptosis is effectively inhibited (36). The administration of M-Exos under hypoxic conditions has been demonstrated to markedly diminish the production of ROS by RAW264.7 cells, thereby facilitating the restoration of cellular activity (37).
In the present study, macrophages were polarized to a pro-inflammatory phenotype using 1 µg/ml of LPS. These results demonstrated a notable decline in cell viability within the LPS-induced inflammatory model group, which suggested that LPS stimulation may potentially induce macrophage apoptosis. Concurrently, the co-culture of M-Exos with RAW 264.7 cells demonstrated the capacity to effectively restore and enhance cell viability, which indicated that M-Exos could reverse the LPS-induced decline in macrophage viability. The optimal concentration of M-Exos for cell viability recovery was 100 µg/ml. This concentration was subsequently used to investigate the impact of M-Exos concentration on the macrophage inflammatory response.
NO is a primary mediator of the oxidative stress response and has the potential to participate in the inflammatory response by exacerbating inflammation (36). The activation of macrophages by LPS has been reported to enhance the development of pro-inflammatory macrophages and increase the production of NO. An excess of NO release reacts with superoxide anion to generate peroxynitrite, which further encourages the production of inflammatory factors such as IL-6 and TNF-α (37). The outcomes of this process are damage to local tissue and an exacerbated inflammatory response (37). The release of inflammatory factors further leads to increased oxidative stress, which in turn diminishes the management of the GSH antioxidant system. Consequently, there is a disruption in the intracellular redox system, which heightens the inflammatory response (38). The results of the present study demonstrated that LPS stimulation increased NO levels. The addition of M-Exos to RAW 264.7 macrophages significantly inhibited the production of NO and the increase in expression levels of pro-inflammatory factors TNF-α and IL-6, thereby restoring intracellular GSH. The expression of iNOS directly determines the secretion of NO and thus serves as an important indicator for detecting oxidative stress in inflammatory reactions (39,40). COX-2 is an inducible enzyme that serves a crucial role in inflammatory reactions by catalyzing the conversion of arachidonic acid into prostaglandins (41). Therefore, the inflammatory response can be effectively controlled through the reduction or inhibition of iNOS and COX-2 activation. The results of the present study experiment demonstrated that the expression levels of iNOS and COX-2 in cells of the M-Exos-treated group were significantly lower compared with those of the LPS-treated group. This indicated that M-Exos served an anti-inflammatory role by restricting the expression of iNOS and COX-2.
TLR4 is found in almost all cell lines, with a particularly high abundance in cells involved in host defense functions, such as macrophages (42). NF-κB is a principal transcriptional regulator of the mammalian immune system. NF-κB facilitates the migration of immune cells into inflammatory tissues, induces the expression of iNOS in response to stimulation and produces certain anti-apoptotic proteins to prevent apoptosis (43). Upon recognition of LPS by TLR4, the IKKβ subunit within the intracellular heterotrimeric complex IκB kinase is activated and phosphorylated, subsequently phosphorylating IκBα. Following the degradation of IκBα, which leads to the phosphorylation and proteasome degradation of IκB, NF-κB translocates into the nucleus where NF-κB induces the expression of IL-6, TNF-α and other inflammatory cytokines (21,43). The present results indicated that M-Exos could reduce TLR4 expression levels, NF-κB pathway activation and signal transduction by inhibiting IκBα phosphorylation and nuclear translocation of the NF-κB-p65 subunit in LPS-primed macrophages. Furthermore, the secretion of IL-6, TNF-α and NO was inhibited by the NF-κB signaling pathway (44).
PI3K is a cell-membrane-bound enzyme with serine/threonine kinase and phosphatidylinositol kinase activities. Upon binding to TLR4, LPS induces the phosphorylation of PI3K, leading to its activation (45). This activates downstream protein kinases, thereby initiating downstream signaling pathways. The PI3K/AKT signaling pathway is a common downstream signaling pathway, which serves an important regulatory role in a range of cellular processes, including cell proliferation, apoptosis, metabolism and migration (23). Upon activation, AKT phosphorylates various target proteins such as the Bcl-2 family of proteins, thereby exerting a wide range of effects on cells, including the promotion of cell survival and inhibition of apoptosis (46,47). AKT can also facilitate activation of IκB kinase, leading to IκB degradation (48). This results in the release of NF-κB from the cytoplasm for nuclear translocation, thereby exacerbating the overactivation of the TLR4/NF-κB signaling pathway. In the present study, following stimulation with LPS, the TLR4 receptor on the surface of the macrophages was activated. This caused phosphorylation of the downstream proteins P65 and IκBα, which increased the expression levels of p-PI3K and p-AKT proteins. Ultimately, these phenomena manifested as the upregulation of the expression of a range of inflammatory cytokines.
The activation of the TLR4/NF-κB and PI3K/AKT inflammatory signaling pathways results in the creation of an abnormal physiological and metabolic environment within cells, ultimately leading to apoptosis (28). It has been reported that in inflammatory diseases, therapeutic agents can exert anti-inflammatory effects by downregulating TLR4 expression levels and inhibiting the PI3K/AKT signaling pathway (29). The results of the present study showed that M-Exos reduced the phosphorylation levels of PI3K and AKT in LPS-induced RAW 264.7 cells, which indicated that M-Exos regulated inflammation by inhibiting activation of the PI3K/AKT signaling pathway. This may be related to certain exosome components, such as specific miRNAs and proteins. Notably, M-Exos are enriched in immune-related miRNAs, which impact immunity and regulate inflammatory signaling pathways (49). In a murine colitis model, miR-146b alleviated intestinal inflammation and improved the intestinal epithelial barrier via the NF-κB pathway, providing beneficial effects in preventing colitis (50). It has been reported that M-Exos-derived miR-155 and miR-148 can regulate the expression of intestinal cytokines and the T cell immune response (51).
M-Exos also contain various proteins that participate in the regulation of signaling pathways (52). CD63 and Alix influence the activation of the NF-κB signaling pathway by modulating the interaction between M-Exos and TLR4 receptors (53). Heat shock proteins (HSPs), such as HSP70 and HSP90, regulate the PI3K/AKT signaling pathway, enabling cells to adapt to environmental stress, suppress apoptosis and exert anti-inflammatory effects (53). In summary, M-Exos exert anti-inflammatory effects by regulating the TLR4/NF-κB and PI3K/AKT signaling pathways through their specific miRNAs and proteins. miRNAs control the activity of signaling pathways by regulating the expression of target genes, while proteins affect various stages of signal transduction by directly interacting with receptor cells (49-52). The synergistic effect of these components helps M-Exos to alleviate inflammatory reactions (8).
In the present study, following treatment with M-Exos, the expression levels of certain key proteins within the TLR4/NF-κB and PI3K/AKT inflammatory signaling pathways were markedly diminished, thereby considerably reducing the expression levels of the pro-apoptotic protein Bax. By contrast, the expression levels of the anti-apoptotic protein Bcl-2 were increased. Future research should include a more in-depth analysis of how specific miRNAs and proteins in M-Exos exert anti-inflammatory effects by regulating target genes, in order to enhance the current understanding of the anti-inflammatory mechanisms of M-Exos. In addition, the present study used a UC mouse model to demonstrate that M-Exos reversed inflammation and the adverse consequences of colon shortening in UC mice. Colon length is an important index to evaluate colitis diseases (54), indicating that M-Exo intervention could alleviate colitis caused by DSS. Currently, commonly used anti-inflammatory drugs in clinical practice include non-steroidal anti-inflammatory drugs, corticosteroids and plant-derived anti-inflammatory compounds. However, long-term use of certain anti-inflammatory drugs (e.g. aspirin, ibuprofen and acetaminophen) can lead to side effects such as gastrointestinal damage, renal function damage and metabolic disorder, while others face significant limitations in bioavailability and stability in vivo (55,56).
M-Exos are food-derived, easy to prepare and exhibit high biocompatibility and low immunogenicity while demonstrating anti-inflammatory properties (57). M-Exos have emerged as ideal candidates for anti-inflammatory therapies, particularly in chronic inflammatory conditions requiring long-term treatment. Additionally, M-Exos can serve as drug delivery vehicles to transport anti-inflammatory molecules, miRNAs or small-molecule drugs directly to inflammation sites. This targeted approach improves bioavailability, reduces adverse effects and allows for synergistic anti-inflammatory effects with co-administered therapeutics (57). It has previously been demonstrated that feeding mice a diet rich in M-Exos can promote cell proliferation via the mTOR-AKT signaling pathway. This diet can also alleviate growth inhibition caused by nutritional deficiencies and fulfill the dietary needs of malnourished individuals (58). Furthermore, M-Exos have the potential to support the maturation of the immune system and enhance the proliferation of immune cells (59). Consequently, in the treatment of inflammation-related diseases, M-Exos could potentially be utilized as part of an adjuvant immunomodulatory therapy in conjunction with nutritional interventions.
With further research into the molecular mechanisms and clinical applications of M-Exos, these substances hold promise as a component of therapeutic strategies for inflammatory diseases, particularly in conditions such as LPS-induced systemic inflammatory response syndrome, lung injury, UC and wound healing. Proteomics and micronutrient analysis should be used to further investigate M-Exos, as these techniques can offer additional insights into their effects on the immune system and nutrition.
In conclusion, M-Exos were extracted by protein isoelectric-point precipitation and ultracentrifugation. An inflammatory model of RAW 264.7 cells was established by LPS stimulation. The effects of M-Exos on LPS-induced inflammation and oxidative stress in RAW 264.7 cells, in addition to the regulation of associated signal pathways, were investigated. M-Exos inhibited the secretion and expression of the pro-inflammatory factors IL-6 and TNF-α in RAW 264.7 cells. M-Exos reduced the level of NO, as well as the expression levels of the oxidative stress factors iNOS and COX-2. Additionally, M-Exos improved the function of antioxidant enzymes, inhibited the initiation of the inflammatory TLR4/NF-κB and PI3K/AKT signaling pathways and inhibited apoptosis by regulating Bcl-2/Bax levels. Overall, the present study contributed to the current understanding of M-Exos in anti-inflammatory, anti-oxidative and anti-apoptotic processes, thereby providing valuable insights into the potential applications.
Acknowledgements
Not applicable.
Funding Statement
Funding: The present study was supported by Postgraduate Research & Practice Innovation Program of Jiangsu Province (grant no. KYCX24_2650).
Availability of data and materials
The data generated in the present study may be requested from the corresponding author.
Authors' contributions
XC and CD conceived and designed the study. XC performed data collection. XC, QS, RZ, YS, ZL and NL performed analysis and interpretation of results. XC and CD undertook draft manuscript preparation. All authors read and approved the final version of the manuscript. XC and RZ confirm the authenticity of all the raw data.
Ethics approval and consent to participate
All animal experimental protocols were approved by the Animal Ethics Committee of Jiangnan University [approval no. 20230830c1201005(355); Wuxi, China].
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
References
- 1.Karin M, Clevers H. Reparative inflammation takes charge of tissue regeneration. Nature. 2016;529:307–315. doi: 10.1038/nature17039. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Panigrahy D, Gilligan MM, Serhan CN, Kashfi K. Resolution of inflammation: An organizing principle in biology and medicine. Pharmacol Ther. 2021;227(107879) doi: 10.1016/j.pharmthera.2021.107879. [DOI] [PubMed] [Google Scholar]
- 3.Grosso G, Laudisio D, Frias-Toral E, Barrea L, Muscogiuri G, Savastano S, Colao A. Anti-inflammatory nutrients and obesity-associated metabolic-inflammation: State of the art and future direction. Nutrients. 2022;14(1137) doi: 10.3390/nu14061137. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Han R, Xiao Y, Bai Q, Choi CHJ. Self-therapeutic metal-based nanoparticles for treating inflammatory diseases. Acta Pharm Sin B. 2023;13:1847–1865. doi: 10.1016/j.apsb.2022.07.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Khan IT, Nadeem M, Imran M, Ayaz M, Ajmal M, Ellahi MY, Khalique A. Antioxidant capacity and fatty acids characterization of heat treated cow and buffalo milk. Lipids Health Dis. 2017;16(163) doi: 10.1186/s12944-017-0553-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Khan IT, Nadeem M, Imran M, Ullah R, Ajmal M, Jaspal MH. Antioxidant properties of milk and dairy products: A comprehensive review of the current knowledge. Lipids Health Dis. 2019;18(41) doi: 10.1186/s12944-019-0969-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Hess JM, Stephensen CB, Kratz M, Bolling BW. Exploring the links between diet and inflammation: Dairy foods as case studies. Adv Nutr. 2021;12 (Suppl 1):S1–S13. doi: 10.1093/advances/nmab108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Zhong Y, Wang X, Zhao X, Shen J, Wu X, Gao P, Yang P, Chen J, An W. Multifunctional milk-derived small extracellular vesicles and their biomedical applications. Pharmaceutics. 2023;15(1418) doi: 10.3390/pharmaceutics15051418. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Betker JL, Angle BM, Graner MW, Anchordoquy TJ. The potential of exosomes from cow milk for oral delivery. J Pharm Sci. 2019;108:1496–505. doi: 10.1016/j.xphs.2018.11.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Kim NH, Kim J, Lee JY, Bae HA, Kim CY. Application of milk exosomes for musculoskeletal health: Talking points in recent outcomes. Nutrients. 2023;15(4645) doi: 10.3390/nu15214645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.van Herwijnen MJC, Driedonks TAP, Snoek BL, Kroon AMT, Kleinjan M, Jorritsma R, Pieterse CMJ, Hoen E, Wauben MHM. Abundantly present miRNAs in milk-derived extracellular vesicles are conserved between mammals. Front Nutr. 2018;5(81) doi: 10.3389/fnut.2018.00081. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Taketoshi H, Kosuke M, Hajime N, Yasunari Y, Tsukasa M, Naohito A. Isolation of bovine milk-derived microvesicles carrying mRNAs and microRNAs. Biochem Biophys Res Commun. 2010;396:528–533. doi: 10.1016/j.bbrc.2010.04.135. [DOI] [PubMed] [Google Scholar]
- 13.Ngu A, Wang S, Wang H, Khanam A, Zempleni J. Milk exosomes in nutrition and drug delivery. Am J Physiol Cell Physiol. 2022;322:C865–C874. doi: 10.1152/ajpcell.00029.2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ghorbani S, Talebi F, Chan WF, Masoumi F, Vojgani M, Power C, Noorbakhsh F. MicroRNA-181 variants regulate T cell phenotype in the context of autoimmune neuroinflammation. Front Immunol. 2017;8(758) doi: 10.3389/fimmu.2017.00758. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Yu Z, Teng Y, Yang J, Yang L. The role of exosomes in adult neurogenesis: Implications for neurodegenerative diseases. Neural Regen Res. 2024;19:282–288. doi: 10.4103/1673-5374.379036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Reif S, Elbaum-Shiff Y, Koroukhov N, Shilo I, Musseri M, Golan-Gerstl R. Cow and human milk-derived exosomes ameliorate colitis in DSS murine model. Nutrients. 2020;12(2589) doi: 10.3390/nu12092589. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Ocansey DKW, Zhang L, Wang Y, Yan Y, Qian H, Zhang X, Xu W, Mao F. Exosome-mediated effects and applications in inflammatory bowel disease. Biol Rev Camb Philos Soc. 2020;95:1287–1307. doi: 10.1111/brv.12608. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Yurakova TR, Gorshkova EA, Nosenko MA, Drutskaya MS. Metabolic adaptations and functional activity of macrophages in homeostasis and inflammation. Biochemistry (Mosc) 2024;89:817–138. doi: 10.1134/S0006297924050043. [DOI] [PubMed] [Google Scholar]
- 19.Nomura F, Akashi S, Sakao Y, Sato S, Kawai T, Matsumoto M, Nakanishi K, Kimoto M, Miyake K, Takeda K, Akira S. Cutting edge: Endotoxin tolerance in mouse peritoneal macrophages correlates with down-regulation of surface toll-like receptor 4 expression. J Immunol. 2000;164:3476–3479. doi: 10.4049/jimmunol.164.7.3476. [DOI] [PubMed] [Google Scholar]
- 20.Bongartz H, Bradfield C, Gross J, Fraser IDC, Nita-Lazar A, Meier-Schellersheim M. IL-10 dependent adaptation allows macrophages to adjust inflammatory responses to TLR4 stimulation history bioRxiv (Preprint): 2024.03.28.587272, 2024. [Google Scholar]
- 21.Zusso M, Lunardi V, Franceschini D, Pagetta A, Lo R, Stifani S, Frigo AC, Giusti P, Moro S. Ciprofloxacin and levofloxacin attenuate microglia inflammatory response via TLR4/NF-kB pathway. J Neuroinflammation. 2019;16(148) doi: 10.1186/s12974-019-1538-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Malemud CJ. Intracellular signaling pathways in rheumatoid arthritis. J Clin Cell Immunol. 2013;4(160) doi: 10.4172/2155-9899.1000160. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Vanhaesebroeck B, Guillermet-Guibert J, Graupera M, Bilanges B. The emerging mechanisms of isoform-specific PI3K signalling. Nat Rev Mol Cell Biol. 2010;11:329–341. doi: 10.1038/nrm2882. [DOI] [PubMed] [Google Scholar]
- 24.Li D, Yao S, Zhou Z, Shi J, Huang Z, Wu Z. Hyaluronan decoration of milk exosomes directs tumor-specific delivery of doxorubicin. Carbohydr Res. 2020;493(108032) doi: 10.1016/j.carres.2020.108032. [DOI] [PubMed] [Google Scholar]
- 25.Wolf T, Baier SR, Zempleni J. The intestinal transport of bovine milk exosomes is mediated by endocytosis in human colon carcinoma caco-2 cells and rat small intestinal IEC-6 cells. J Nutr. 2015;145:2201–2206. doi: 10.3945/jn.115.218586. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 27.Deng C, Hu Y, Conceicao M, Wood MJA, Zhong H, Wang Y, Shao P, Chen J, Qiu L. Oral delivery of layer-by-layer coated exosomes for colitis therapy. J Control Release. 2023;354:635–650. doi: 10.1016/j.jconrel.2023.01.017. [DOI] [PubMed] [Google Scholar]
- 28.Rex J, Lutz A, Faletti LE, Albrecht U, Thomas M, Bode JG, Borner C, Sawodny O, Merfort I. IL-1β and TNFα differentially influence NF-κB activity and fasl-induced apoptosis in primary murine hepatocytes during LPS-induced inflammation. Front Physiol. 2019;10(117) doi: 10.3389/fphys.2019.00117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Yuan X, Juan Z, Zhang R, Sun X, Yan R, Yue F, Huang Y, Yu J, Xia X. Clemastine fumarate protects against myocardial ischemia reperfusion injury by activating the TLR4/PI3K/AKT signaling pathway. Front. Pharmacol. 2020;11(28) doi: 10.3389/fphar.2020.00028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Yelubaeva MY, Buralkhiev BA, Serikbayeva AD, Narmuratova MH, Kenenbay SY. Electrophoretic identification of casein in various types of milk. J Biol.Chem. 2017;17:348–352. [Google Scholar]
- 31.Tian MY, Hao DX, Liu Y, He J, Zhao ZH, Guo TY, Li X, Zhang Y. Milk exosomes: An oral drug delivery system with great application potential. Food Funct. 2023;14:1320–1337. doi: 10.1039/d2fo02013k. [DOI] [PubMed] [Google Scholar]
- 32.Lai JJ, Chau ZL, Chen SY, Hill JJ, Korpany KV, Liang NW, Lin LH, Lin YH, Liu JK, Liu YC, et al. Exosome processing and characterization approaches for research and technology development. Adv Sci (Weinh) 2022;9(e2103222) doi: 10.1002/advs.202103222. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Rodríguez-Morales P, Franklin RA. Macrophage phenotypes and functions: Resolving inflammation and restoring homeostasis. Trends Immunol. 2023;44:986–998. doi: 10.1016/j.it.2023.10.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Salehi M, Negahdari B, Mehryab F, Shekari F. Milk-derived extracellular vesicles: bomedical applications, current challenges, and future perspectives. J Agric Food Chem. 2024;72:8304–8331. doi: 10.1021/acs.jafc.3c07899. [DOI] [PubMed] [Google Scholar]
- 35.Matic S, D'Souza DH, Wu T, Pangloli P, Dia VP. Bovine milk exosomes affect proliferation and protect macrophages against cisplatin-induced cytotoxicity. Immunol Invest. 2020;49:711–725. doi: 10.1080/08820139.2020.1769647. [DOI] [PubMed] [Google Scholar]
- 36.Tsai CF, Chen GW, Chen YC, Shen CK, Lu DY, Yang LY, Chen JH, Yeh WL. Regulatory effects of quercetin on M1/M2 macrophage polarization and oxidative/antioxidative balance. Nutrients. 2021;14(67) doi: 10.3390/nu14010067. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Torregrosa Paredes P, Esser J, Admyre C, Nord M, Rahman QK, Lukic A, Rådmark O, Grönneberg R, Grunewald J, Eklund A, et al. Bronchoalveolar lavage fluid exosomes contribute to cytokine and leukotriene production in allergic asthma. Allergy. 2012;67:911–919. doi: 10.1111/j.1398-9995.2012.02835.x. [DOI] [PubMed] [Google Scholar]
- 38.Zhang M, Hu W, Cai C, Wu Y, Li J, Dong S. Advanced application of stimuli-responsive drug delivery system for inflammatory arthritis treatment. Mater Today Bio. 2022;14(100223) doi: 10.1016/j.mtbio.2022.100223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Malik R, Paudel KR, Manandhar B, De Rubis G, Shen J, Mujwar S, Singh TG, Singh SK, Gupta G, Adams J, et al. Agarwood oil nanoemulsion counteracts LPS-induced inflammation and oxidative stress in RAW264.7 mouse macrophages. Pathol Res Pract. 2023;251(154895) doi: 10.1016/j.prp.2023.154895. [DOI] [PubMed] [Google Scholar]
- 40.Izadparast F, Riahi-Zajani B, Yarmohammadi F, Hayes AW, Karimi G. Protective effect of berberine against LPS-induced injury in the intestine: A review. Cell Cycle. 2022;21:2365–2378. doi: 10.1080/15384101.2022.2100682. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Wang R, Wang N, Han Y, Xu J, Xu Z. Dulaglutide alleviates LPS-induced injury in cardiomyocytes. ACS Omega. 2021;6:8271–8278. doi: 10.1021/acsomega.0c06326. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Fitzgerald KA, Kagan JC. Toll-like receptors and the control of immunity. Cell. 2020;180:1044–1066. doi: 10.1016/j.cell.2020.02.041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Stierschneider A, Wiesner C. Shedding light on the molecular and regulatory mechanisms of TLR4 signaling in endothelial cells under physiological and inflamed conditions. Front Immunol. 2023;14(1264889) doi: 10.3389/fimmu.2023.1264889. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Wu Z, Mehrabi Nasab E, Arora P, Athari SS. Study effect of probiotics and prebiotics on treatment of OVA-LPS-induced of allergic asthma inflammation and pneumonia by regulating the TLR4/NF-kB signaling pathway. J Transl Med. 2022;20(130) doi: 10.1186/s12967-022-03337-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Zhong J, Qiu X, Yu Q, Chen H, Yan C. A novel polysaccharide from Acorus tatarinowii protects against LPS-induced neuroinflammation and neurotoxicity by inhibiting TLR4-mediated MyD88/NF-κB and PI3K/AKT signaling pathways. Int J Biol Macromol. 2020;163:464–475. doi: 10.1016/j.ijbiomac.2020.06.266. [DOI] [PubMed] [Google Scholar]
- 46.Acosta-Martinez M, Cabail MZ. The PI3K/AKT pathway in meta-inflammation. Int J Mol Sci. 2022;23(15330) doi: 10.3390/ijms232315330. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.He C, Wang K, Xia J, Qian D, Guo J, Zhong L, Tang D, Chen X, Peng W, Chen Y, Tang Y. Natural exosomes-like nanoparticles in mung bean sprouts possesses anti-diabetic effects via activation of PI3K/AKT/GLUT4/GSK-3β signaling pathway. J Nanobiotechnology. 2023;21(349) doi: 10.1186/s12951-023-02120-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Zhong R, Xia T, Wang Y, Ding Z, Li W, Chen Y, Peng M, Li C, Zhang H, Shu Z. Physalin B ameliorates inflammatory responses in lipopolysaccharide-induced acute lung injury mice by inhibiting NF-κB and NLRP3 via the activation of the PI3K/AKT pathway. J Ethnopharmacol. 2022;284(114777) doi: 10.1016/j.jep.2021.114777. [DOI] [PubMed] [Google Scholar]
- 49.Zhou Q, Li M, Wang X, Li Q, Wang T, Zhu Q, Zhou X, Wang X, Gao X, Li X. Immune-related microRNAs are abundant in breast milk exosomes. Int J Biol Sci. 2012;8:118–123. doi: 10.7150/ijbs.8.118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Nata T, Fujiya M, Ueno N, Moriichi K, Konishi H, Tanabe H, Ohtake T, Ikuta K, Kohgo Y. MicroRNA-146b improves intestinal injury in mouse colitis by activating nuclear factor-κB and improving epithelial barrier function. J Gene Med. 2013;15:249–2460. doi: 10.1002/jgm.2717. [DOI] [PubMed] [Google Scholar]
- 51.Melnik BC, Schmitz G. Exosomes of pasteurized milk: Potential pathogens of Western diseases. J Transl. Med. 2019;17(3) doi: 10.1186/s12967-018-1760-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Yang M, Song D, Cao X, Wu R, Liu B, Ye W, Wu J, Yue X. Comparative proteomic analysis of milk-derived exosomes in human and bovine colostrum and mature milk samples by iTRAQ-coupled LC-MS/MS. Food Res. Int. 2017;92:17–25. doi: 10.1016/j.foodres.2016.11.041. [DOI] [PubMed] [Google Scholar]
- 53.Chang X, Wang SL, Zhao SB, Shi YH, Pan P, Gu L, Yao J, Li ZS, Bai Y. Extracellular vesicles with possible roles in gut intestinal tract homeostasis and IBD. Mediators Inflamm. 2020;2020(1945832) doi: 10.1155/2020/1945832. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Bacchi S, Palumbo P, Sponta A, Coppolino MF. Clinical pharmacology of non-steroidal anti-inflammatory drugs: A review. Antiinflamm Antiallergy Agents Med Chem. 2012;11:52–64. doi: 10.2174/187152312803476255. [DOI] [PubMed] [Google Scholar]
- 55.Yatoo MI, Gopalakrishnan A, Saxena A, Parray OR, Tufani NA, Chakraborty S, Tiwari R, Dhama K, Iqbal HMN. Anti-inflammatory drugs and herbs with special emphasis on herbal medicines for countering inflammatory diseases and disorders-A review. Recent Pat Inflamm Allergy Drug Discov. 2018;12:39–58. doi: 10.2174/1872213X12666180115153635. [DOI] [PubMed] [Google Scholar]
- 56.Liu J, Wang Y, Heelan WJ, Chen Y, Li Z, Hu Q . Mucoadhesive probiotic backpacks with ROS nanoscavengers enhance the bacteriotherapy for inflammatory bowel diseases. Sci Adv. 2022;8(8798) doi: 10.1126/sciadv.abp8798. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Sun D, Zhuang X, Xiang X, Liu Y, Zhang S, Liu C, Barnes S, Grizzle W, Miller D, Zhang HG. A novel nanoparticle drug delivery system: the anti-inflammatory activity of curcumin is enhanced when encapsulated in exosomes. Mol Ther. 2010;18:1606–1614. doi: 10.1038/mt.2010.105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Garcia-Martinez J, Salto R, Giron MD, Perez-Castillo IM, Bueno Vargas P, Vilchez JD, Linares-Perez A, Manzano M, Garcia-Corcoles MT, Rueda R, López-Pedrosa JM. Supplementation with a whey protein concentrate enriched in bovine milk exosomes improves longitudinal growth and supports bone health during catch-up growth in rats. Nutrients. 2024;16(7) doi: 10.3390/nu16223814. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Yang H, Wuren T, Zhai BT, Liu Y, Er D. Milk-derived exosomes in the regulation of nutritional and immune functions. Food Sci. Nutr. 2024;12:7048–7059. doi: 10.1002/fsn3.4323. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data generated in the present study may be requested from the corresponding author.







