VAB-8/KIF26, LIN-17/Frizzled, and EFN-4/Ephrin, control distinct stages of posterior neuroblast migration downstream of the MAB-5/Hox transcription factor in Caenorhabditis elegans

Abstract

Hox transcription factors are involved in neuronal and neural crest development and differentiation, including migration, but the genetic programs employed by Hox genes to regulate terminal differentiation remain to be defined. In C. elegans, the Antennapedia-like Hox factor MAB-5 is both necessary and sufficient to induce posterior migration of the Q lineage neuroblasts and neurons downstream of canonical Wnt signaling. Q lineage fluorescence-activated cell sorting and RNA seq in mab-5 loss-of-function and gain-of-function backgrounds revealed genes with expression in the Q lineage dependent upon MAB-5. Here, the roles of three mab-5 target genes in QL lineage posterior migration are delineated, vab-8/KIF26, lin-17/Fz, and efn-4/Ephrin. First, live, time-lapse imaging of QL.a and QL.ap posterior migration revealed that this migration occurs in three distinct stages: QL.a migration posterior to QL.p; after QL.a division, posterior migration of QL.ap to a region immediately anterior to the anus; and final migration of QL.ap posterior to the anus to the final position where it differentiates into the PQR neuron. vab-8 affected each of the three stages, lin-17 affected stages two and three, and efn-4 was required for the third stage of posterior QL.ap migration. Thus, different MAB-5 target genes control distinct stages of posterior migration. mab-20/Semaphorin, a known interaction partner with efn-4, also affected only the third stage similar to efn-4. Suppression of mab-5 gof posterior migration confirmed that these genes act downstream of mab-5 in posterior migration. Possibly, VAB-8/KIF26 trafficks distinct molecules to the plasma membrane that mediate distinct stages of migration, including LIN-17/Fz and EFN-4. Surpisingly, failure of stages two and three led to the premature extension of a posterior dendritic protrusion, which normally forms after QL.ap had migrated to its final position and PQR differentiation begins. This suggests a link between migration and differentiation, where differentiation is delayed while migration proceeds. In sum, this works delineates a transcriptional program downstream of mab-5/Hox that controls posterior neuroblast migration, in response to Wnt signaling.

Introduction

The migration of neurons and neural crest cells is pivotal in development and organization of the nervous system. Hox genes have been broadly implicated in nervous system development, including segmental specification, compartmentalization, axon guidance, and cell migration (Philippidou and Dasen 2013). In C. elegans, Hox genes have been implicated in a wide variety of terminal neuronal differentiation events (Feng et al. 2021; Kratsios and Hobert 2024; Smith and Kratsios 2024). In migration of the Q neuroblasts in C. elegans, the MAB-5/Antennapedia Hox factor is both necessary and sufficient for posterior migration but does not obviously affect deeper aspects of neuronal fate or differentiation (Chalfie et al. 1983; Kenyon 1986; Salser and Kenyon 1992; Harris et al. 1996; Whangbo and Kenyon 1999; Korswagen et al. 2000; Herman 2003; Eisenmann 2005; Ji et al. 2013; Josephson et al. 2016; Paolillo et al. 2024). The bilateral Q neuroblasts undergo identical patterns of division, migration, and neuronal differentiation, but QL on the left migrates posteriorly and QR on the right migrates anteriorly (Sulston and Horvitz 1977; Chalfie and Sulston 1981; Middelkoop and Korswagen 2014; Josephson et al. 2016; Rella et al. 2016). Initial migration is of QL and QR is independent of Wnt signaling and is regulated by receptors UNC-40/DCC and PTP-3/LAR, which are active in QL but not QR, leading to posterior QL versus anterior QR migrations (Sundararajan and Lundquist 2012; Sundararajan et al. 2014). The second stage of Q migration is Wnt-dependent and relies on EGL-20/Wnt activation of expression of the mab-5/Hox gene in QL lineage but not QR lineage via canonical Wnt signaling in QL (Chalfie et al. 1983; Kenyon 1986; Salser and Kenyon 1992; Harris et al. 1996; Whangbo and Kenyon 1999; Korswagen et al. 2000; Herman 2003; Eisenmann 2005; Ji et al. 2013; Josephson et al. 2016).

As a determinant of posterior migration, MAB-5 is necessary and sufficient for posterior migration of QL descendants, which migrate anteriorly in mab-5 loss-of-function (lof) mutants. QR descendants migrate posteriorly in mab-5 gain-of-function (gof) conditions (Tamayo et al. 2013; Josephson et al. 2016). MAB-5 has a dual role in posterior migration of QL descendants (Josephson et al. 2016). MAB-5 first inhibits anterior migration of the QL descendants. It does so by inducing expression of CWN-1/Wnt in QL descendants which acts with EGL10/Wnt in autocrine, non-canonical manner to inhibit anterior migration (Paolillo et al. 2024). While anterior migration is inhibited, MAB-5 reprograms QL descendants to migrate to the posterior (Josephson et al. 2016; Paolillo et al. 2024). To identify genes regulated by MAB-5 in the Q lineage, fluorescence activated cell sorting of Q lineage cells and RNA seq was employed in wild-type, mab-5 loss-of-function (lof), and mab-5 gain-of-function conditions (Paolillo et al. 2024). cwn-1/Wnt was downregulated in mab-5 lof and upregulated in mab-5 gof, and was shown to be required downstream of MAB-5 to inhibit anterior migration of QL descendants (Paolillo et al. 2024).

Among other genes with reduced Q lineage expression in mab-5 lof were the atypical, conserved Kinesin vab-8/KIF26, lin-17/Fz, and efn-4/Ephrin (Paolillo et al. 2024). vab-8 expression was also increased in mab-5 gof. vab-8 has previously been implicated in anterior-posterior cell migration and axon guidance (Wightman et al. 1996; Wolf et al. 1998; Lai and Garriga 2004; Levy-strumpf and Culotti 2007; Watari-Goshima et al. 2007), lin-17 encodes a Frizzled Wnt receptor involved in canonical Wnt signaling to activate mab-5 expression in QL and other cell polarity and neural morphogenesis events (Wu and herman 2007; Kirszenblat et al. 2011; Kidd et al. 2015; Chien et al. 2017; Lu and Mizumoto 2019; Knop et al. 2024; So et al. 2024), and efn-4 encodes an Ephrin secreted guidance molecule involved in axon guidance and cellular repulsion, including acting with MAB-5 in prevention of male tail ray cell fusion (Wang et al. 1999; Chin-Sang et al. 2002; Hahn and Emmons 2003; Ikegami et al. 2004; Schwieterman et al. 2016). vab-8, lin-17, and efn-4 mutants each showed defects in posterior migration of the QL descendant neuron PQR. Furthermore, each suppressed mab-5 gof indicating that they were required downstream of MAB-5 to drive posterior migration. Transgenic expression of vab-8 and efn-4 in the Q lineage rescued PQR migration defects, suggesting that they act cell-autonomously in the Q cells for posterior migration. Combined with the RNA-seq expression analyses, these genetic results indicate that vab-8, lin-17, and efn-4 are transcriptional targets of MAB-5/Hox in the Q lineage that are required for MAB-5-dependent posterior migration.

To understand the cellular nature of these mutant effects on PQR migration, live, time-lapse imaging of QL lineage development was conducted. It was shown previously that in wild-type, after QL division to form QL.a and QL.p (the anterior and posterior daughters), QL.a migrates posteriorly over QL.p to reside in a position posterior to QL.p (Josephson et al. 2016). In this work, further migration of QL.a was analyzed. After migration to the posterior of QL.p, QL.a underwent division to form QL.aa and QL.ap. QL.aa undergoes programmed cell death, and QL.ap will differentiate into PQR. After division, QL.ap extended a posterior lamellipodial protrusion and migrated posteriorly to a position just anterior to the anus. Here, QL.ap paused for approximately one hour and extended a lamellipodial protrusion to the posterior across the anus. QL.ap then followed this lamellipodial protrusion and migrated posterior to the anus. At this point, QL.ap reaching its final position and began differentiation into the PQR neuron, as evidenced by the extension of a posterior dendritic protusion tipped with a growth cone, which will form the posterior ciliated dendrite of the PQR neuron. This work defined three stages of QL.a and QL.ap migration: the first stage was the migration of QL.a to the posterior of QL.p where it divided; the second stage was migration of QL.ap posteriorly to a region immediately anterior to the anus; and the third stage migration of QL.ap posterior to the anus, where it began differentiation into PQR.

vab-8 mutants displayed failures of each of the three stages of migration, lin-17 displayed failures of the second and third stages, and efn-4 displayed failure of only the third stage. This indicated that the three stages were independently controlled by distinct programs downstream of MAB-5. Suppression of mab-5 gof indicated that lin-17 acts both upstream of mab-5 in canonical Wnt signaling, and downstream of mab-5 in posterior migration. mab-20/Semaphorin, which acts with efn-4 n prevention of male tail ray cell fusion, showed an identical phenotype to efn-4 suggesting that their interaction is conserved in posterior Q L lineage migration. mab-20 expression was not affected by mab-5, suggesting that MAB-20 is a constitutively-expressed cofactor that acts with EFN-4 in posterior migration. Double mutant analysis and transgenic rescue indicated that these genes might all act in a common pathway in posterior migration.

A surprising finding was that upon migration failures of the second and third stages, the cells immediately extended a posterior dendritic process, one to two hours earlier than wild-type. This suggests a balance of migration and differentiation in QL.ap, such that when migration fails, differentiation begins.

In sum, this work has defined a three-step posterior migration process of QL.a and QL.ap controlled by MAB-5/Hox. It delineates a developmental pathway controlling cell migration from a Wnt ligand and canonical Wnt signaling, to a terminal differentiation factor, to molecules involved in interactions of the cell with the surrounding extracellular environment. MAB-5 drives the expression of VAB-8/KIF26, which mediates each of the three stages. MAB-5 might maintain the expression of LIN17/Fz in the QL lineage, which mediates the second and third stages. Finally, MAB-5 drives expression of EFN-4/Ephrin, which is key to the third stage. Given the molecular functions of these molecules, a tempting model is that distinct receptors or receptor complexes mediate each step by modifying QL.a or QL.ap interaction with the extracellular environment, and that VAB-8 is required for the trafficking of these receptors or complexes to the cell surface at each step, mediating the function of MAB-5 /Hox as a terminal differentiation factor in posterior QL lineage development.

Results

MAB-5/Hox regulates the expression of vab-8, lin-17/Fz, and efn-4/Ephrin in the QL neuroblast lineage

Previously, Q neuroblasts at the time of mab-5 expression in QL were sorted by fluorescence-activated cell sorting (FACS) and subjected to RNA-seq (Paolillo et al. 2024). Q cell transcriptomes from wild-type, two mab-5 loss-of-function (lof) mutants (gk670 and e1239) and two mab-5 gain-of-function (gof) conditions (e1751 and lqIs221) were analyzed for differential expression (PAOLILLO et al. 2024). Among the genes with expression significantly affected by mab-5 after correction for multiple testing were vab-8, efn-4, and lin-17. vab-8 expression was significantly reduced in both lof mutants and significantly increased in both gof conditions (Table 1). lin-17/Fz and efn-4/Ephrin were significantly reduced in the gk670 lof mutant but not significantly affected in other lof or gof conditions (Table 1). efn-4 was reduced with p value significance in e1239 lof (p = 0.00904969), but this did not survive correction for multiple testing (q = 0.2812659). All three genes were significantly enriched in Q cells compared to whole-animal (Table 1). These results indicate that vab-8, lin-17, and efn-4 are expressed in the Q cells and that their expression might require MAB-5/Hox function, presumably in the QL lineage although this cannot be established from these studies. vab-8 showed a paired response (down in lof, up in gof), but efn-4 and lin-17 were only affected in lof conditions.

Table 1.

mab-5-dependent Q cell expression of candidate genes.

gk670 lof vs wild type	Log2(FC)	p-value	P-Adj (q- value)
efn-4	−1.3187655	2.49E-06	0.0007293	*
vab-8	−1.5960205	1.43E-08	1.31E-05	*
lin-17	−1.1287251	6.62E-04	3.62E-02	*
mab-20	−0.2976426	0.44559032	0.80373368	ns
e1239 lof vs wild type
efn-4	−1.0840528	0.00904969	0.2812659	ns
vab-8	−1.957639	1.01E-07	0.0001517	*
lin-17	−0.58567531	0.175745343	0.7899871	ns
mab-20	−0.7631037	0.09780806	0.67518559	ns
e1751 gof vs wild type
efn-4	−0.0356306	0.91395471	0.9749122	ns
vab-8	1.06637539	0.00105495	0.0420146	*
lin-17	0.156495231	0.659561038	0.8889923	ns
mab-20	−0.4109351	0.34070904	0.71924823	ns
lqIs221 gof vs wild type
efn-4	0.11188834	0.73522122	0.9790178	ns
vab-8	1.43153159	3.31E-05	0.004217	*
lin-17	−0.35149935	0.35679139	0.8991374	ns
mab-20	−0.54631	0.21602263	0.81102639	ns
Enrichment in Q cells
efn-4	1.99286731	2.55E-07	4.25E-06	*
vab-8	1.77179746	0.00019876	0.0001517	*
lin-17	2.994018727	2.61E-08	5.77E-07	*
mab-20	2.72859827	0.00023302	0.00151461	ns

^*q<0.05

Data taken from Paolillo et al., 2024

vab-8 and efn-4/Ephrin control posterior migration of the QL descendant PQR neuron

The PQR neuron is a descendant of the QL neuroblast (PQR is the QL.ap cell in the QL lineage) (Figure 1A) (Sulston and Horvitz 1977). After QL divides, the anterior daughter QL.a migrates posteriorly over the posterior daughter QL.p and then divides (Middelkoop and Korswagen 2014; Josephson et al. 2016). The anterior daughter QL.aa undergoes programmed cell death. The posterior daughter, QL.ap, migrates posteriorly past the anus to reside in the region of the phasmid ganglia in the tail and differentiates into the PQR neuron (Figure 1A–C). The QL.p descendants do not migrate and differentiate into PVM and SDQL near the place of birth (Figure 1A and B). mab-5 is required for PQR posterior migration. In mab-5 mutants, PQR migrates anteriorly similar to AQR (Chapman et al. 2008; Josephson et al. 2016). AQR is the equivalent neuron from the QR lineage (QR.ap) (Figure 1A and B) and migrates anteriorly to reside near the anterior deirid ganglion in the head (Figure 1A–C). The QR.p descendants also migrate anteriorly and differentiate into AVM and SDQR neurons (Figure 1A and B).

Figure 1. Q neuroblast migration and migration defects.

A) The Q neuroblast lineage in the L1 larva. Hours represent time after hatching. B) Schematic of migration of the QL and QR lineages. QL on the left migrates over the V5 seam cell in the first stage of migration and divides into QL.a and QL.p. In the second stage, QL.a continues posterior migration and divides into QL.aa and QL.ap. QL.ap migrates into the tail of the animal and differentiates into the PQR neuron. QL.p does not migrate and differentiates into the PVM and SDQL neurons. On the right, QR migrates anteriorly over V4 and divides. Both QR.a and QR.p migrate anteriorly and differentiate into AQR, AVM, and SDQR. C-G) Composite fluorescent/DIC micrographs showing the position of AQR, PQR, and URX neurons in different genotypes using the lqIs244[Pgcy-32::gfp] −32::gfp] transgene. The scale bar in A represents 10μm. C) A wild type animal with PQR posterior to the anus (position 5 in Table 2) and AQR near the anterior deirid (position 1 in Table 2). D) A vab-8(ev411) animal with a PQR that failed to migrate anteriorly (position 4 in Table 2; paradigm 1 in Table 4). E) An efn-4(bx80) animal with a PQR that failed to complete full migration, residing immediately anterior to the anus (paradigm 2 in Table 4). The inset is a magnified view of the tail region. F) A lin-17(e1456) mutant with a failed posterior PQR migration (paradigm 1 in Table 4). G) A mab-20(ev574) mutant with a failed PQR migration immediately anterior to the anus (paradigm 2 in Table 4).

The positions of AQR and PQR were determined in vab-8 and efn-4 mutants (see Materials and Methods). AQR migration was unaffected in vab-8, lin-17, and efn-4 (Table 2). In contrast, PQR displayed significant failure of posterior migration in vab-8, lin-17, and efn-4 (Table 2 and Figure 1D and E). In vab-8(ev411) and vab-8(e1017), 52% and 62% of PQR failed to migrate to the normal position posterior to the anus. In efn-4(bx80) and efn-4(e36), 71% and 81% failed to migrate posteriorly. A small number of PQR neurons migrated anteriorly in vab-8 mutants (0–6%, positions 1–3), but the vast majority failed to migrate posteriorly (position 4) (Table 2). This suggests that vab-8 and efn-4 primarily affect the ability of PQR to migrate to the posterior.

Table 2.

AQR and PQR migration defects in mutants.

	AQR2						PQR2
Genotype1	1	2	3	4	5		1	2	3	4	5
Candidate Screens
wild-type	100	0	0	0	0		0	0	0	0	100
efn-4(bx80)	100	0	0	0	0		0	0	1	70	29
efn-4(e36)	100	0	0	0	0		0	0	0	81	19
vab-1(e2)	100	0	0	0	0		0	0	0	0	100
vab-8(ev411)	100	0	0	0	0		1	0	1	50	48
vab-8(e1017)	100	0	0	0	0		1	1	5	55	38
lin-17(e1456)	100	0	0	0	0		1	3	4	54	38
lin-17(n671)	100	0	0	0	0		10	4	8	48	30
lin-17(lq202)	100	0	0	0	0		16	9	7	36	32
mab-20(ev574)	100	0	0	0	0		2	0	1	50	47
mab-20(bx24)	100	0	0	0	0		0	0	0	55	45
mab-20(bx61)	100	0	0	0	0		0	0	0	4	96
mab-20(ev778)	100	0	0	0	0		0	0	0	36	64
mom-2(or77)M+	100	0	0	0	0		0	0	0	19	81
egl-20(mu39)	100	0	0	0	0		29	16	9	8	38
cwn-2(ok895)	100	0	0	0	0		0	0	0	9	91
cwn-1(ok546)	100	0	0	0	0		0	0	0	1	99
lin-44(n1792)	100	0	0	0	0		0	0	0	0	100
Suppression experiments
Pegl-17::mab-5	0	0	0	5	95		0	0	0	0	100
mab-5(e1751)	1	1	0	16	82		0	0	1	99	100
efn-4(bx80); Pegl-17::mab-5	0	0	0	81*	19		0	0	0	66	34
vab-8(ev411); Pegl-17::mab-5	2	2	7	72*	17		0	0	1	72	27*
vab-8(e1017); Pegl-17::mab-5	0	1	9	75*	15		0	0	4	79	17*
lin-17(e1456); Pegl-17::mab-5	0	0	0	75*	25		0	0	0	72	28*
lin-17(n671); Pegl-17::mab-5	0	0	0	85*	15		0	0	0	90	10*
lin-17(lq202); Pegl-17::mab-5	0	0	0	68*	32		0	0	0	69	31
mab-20(ev574); Pegl-17::mab-5	0	0	0	67*	33		0	0	0	68	32*
mab-20(ev574); mab-5(e1751)	0	0	0	72*	28		0	0	0	72	28*
Rescue experiments
Pegl-17::efn-4 3	100	0	0	0	0		0	0	0	0	100
efn-4(bx80); Pegl-17::efn-4 3,4	100	0	0	0	0		0	0	0	50	50*
Pegl-17::vab-8A 3	100	0	0	0	0		0	0	0	0	100
vab-8(ev411); Pegl-17::vab-8A 3,4	100	0	0	0	0		0	0	0	35	65*
Pegl-17::vab-8C 5	100	0	0	0	0		0	0	0	0	100
vab-8(e1017); Pegl-17::vab-8C4, 5	100	0	0	0	0		0	0	0	46	54*
Pegl-17::mab-20 3	100	0	0	0	0		0	0	0	0	100
mab-20(ev574); Pegl-17::mab-20 3,4	100	0	0	0	0		0	0	0	27	73*
Double mutants
efn-4(bx80); vab-8(ev411)	100	0	0	0	0		0	0	11	80	9
efn-4(bx80); vab-8(e1017)	100	0	0	0	0		1	0	7	87	5
lin-17(e1456); vab-8(ev411)	100	0	0	0	0		4	1	12	79	4
lin-17(n671); vab-8(ev411)	100	0	0	0	0		8	4	6	58	24
lin-17(lq202); vab-8(ev411)	100	0	0	0	0		11	10	11	48	20
lin-17(e1456); efn-4(bx80)	100	0	0	0	0		2	0	1	76	21
lin-17(n671); efn-4(bx80)	100	0	0	0	0		4	5	5	78	8
lin-17(lq202); efn-4(bx80)	100	0	0	0	0		7	8	10	65	10
efn-4(bx80); mab-20(ev574)	100	0	0	0	0		0	0	0	88	12
vab-8(ev411); mab-20(ev574)	100	0	0	0	0		0	0	0	70	30
cwn-2(ok895); mom-2(or77)M+	100	0	0	0	0		0	0	0	33	67
Compensation
mab-20(ev574); Pegl-17::efn-4 4,5	100	0	0	0	0		0	0	0	17	83*
efn-4(bx80); Pegl-17::mab-20 4,5	100	0	0	0	0		0	0	0	36	64*

¹For each genotype, 100 animals were scored on three separate occasions for a total of 300 animals.

²Numbers are average percentages from three replicates of cells at each position rounded to the nearest whole number.

³Three independent transgenes were scored with similar effects.

⁴Number of WT PQRs compared against the single mutant of the respective candidate.

⁵One transgene was scored.

^*p<0.05

vab-8(e1017) causes a premature stop codon predicted to affect all vab-8 isoforms and is likely a null (Wolf et al. 1998; Watari-Goshima et al. 2007). vab-8(ev411) alters the splice donor sequence of intron three and is predicted to affect only the vab-8A long isoform (Levy-Strumpf and Culotti 2007), indicating that the long isoform of vab-8 is required for PQR migration. efn-4(bx80) is a deletion of exon 2 (Chin-Sang et al. 1999; Hahn and Emmons 2003), and efn-4(e36) is a premature stop codon in exon 2 (Chin-Sang et al. 2002). Both are predicted to be null for efn-4.

lin-17/Fz might act both upstream and downstream of mab-5 in PQR migration

lin-17 has been shown previously to affect PQR migration (Chapman et al. 2008; Josephson et al. 2016). lin-17(e1456), lin-17(n671), and lin-17(lq202) displayed 62%, 70%, and 62% defective PQR migration (Table 2 and Figure 1F) with most defective PQR failing to migrate to the posterior (position 4). However, each also showed significant anterior migration of PQR (8% for e1456, 23% for n671, and 32% for lq202). lin-17 acts in canonical Wnt signaling that activates mab-5 expression in QL (Harris et al. 1996; Sawa et al. 1996; Maloof et al. 1999; Whangbo and Kenyon 1999). The anterior migration of PQR in lin-17 might be due to the role of lin-17 in canonical Wnt signaling upstream of mab-5 in QL, and the failure of PQR to migrate posteriorly might be due to a distinct role in posterior PQR migration. mab-5 gof suppression experiments described below are consistent with this hypothesis.

lin-14(e1456) alters the splice acceptor sequence of intron 8 (Sawa et al. 1996), and given its weaker PQR phenotype might be hypomorphic. lin-17(n671) introduces a premature stop codon in exon 9 and is likely null (Sawa et al. 1996). lin-17(lq202) was found as a spontaneous mutation affecting PQR migration and is a 75-bp in-frame deletion in exon 8 that removes a portion of the second transmembrane domain (see Materials and Methods). PQR migration defects resemble those of lin-17(n671) and therefore lin-17(lq202) is a likely null.

vab-8, lin-17, and efn-4 suppress mab-5 gof

In mab-5(e1751) gof mutants, mab-5 is ectopically expressed in QR and QL, and the lqIs220 and lqIs221 transgenes drive mab-5 expression in both QL and QR using the egl-17 promoter (Salser et al. 1993; Tamayo et al. 2013; Paolillo et al. 2024). In each case, both AQR and PQR migrate posteriorly (Table 2 and Figure 2A). Double mutants of vab-8, lin-17, and efn-4 with the mab-5 duplication allele mab-5(e1751) were lethal and could not be constructed.

Figure 2. Suppression of mab-5 gain-of-function by vab-8, efn-4, and lin-17.

A] Composite fluorescent/DIC micrographs showing the positions of AQR and PQR as described in Figure 1. The scale bar in A represents 10μm. A) An animal harboring the lqIs220[Pegl-17::mab-5(+)] transgene that drives mab-5 expression in both QL and QR lineages. Both AQR and PQR migrated posteriorly behind the anus (position 5 in Table 2). B) In a vab-8(e1017); lqIs220 animal, both AQR and PQR failed to migrate behind the anus and stayed in position 4, paradigm 1. C) AQR and PQR failed to fully migrate posteriorly in an efn-4(bx80); lqIs220 mutant and resided immediately anterior to the anus (position 4, paradigm 2). D) AQR and PQR failed to migrate posteriorly in a lin-17(n671); lqIs220 animal (position 4, paradigm 1). E) AQR and PQR failed to fully migrate to the posterior and resided immediately anterior to the anus in a mab-20(ev574); lqIs220 animal (position 4, paradigm 2).

In lqIs220[Pegl-17::mab-5], 95% of AQRs migrated posteriorly to the tail similar to PQR, with no AQR migrating anteriorly (Table 2 and Figure 2A). In vab-8(ev411); Pegl-17::mab-5 and vab-8(e1017); Pegl-17::mab-5 double mutants, 17% and 15% of AQR migrated posteriorly to the tail, compared to 95% in Pegl-17::mab-5 alone (Table 2 and Figure 2B). The majority of AQRs that failed to migrate posteriorly remained near the birth position (position 4). Similarly, 27% and 17% of PQR migrated posteriorly in the double mutants, with the remaining PQR residing at the Q cell birth position 4. These data indicate that vab-8 is required for ectopic MAB-5 to drive posterior migration of both AQR and PQR and suggest that VAB-8 acts downstream of MAB-5. Notably, some AQR neurons migrated anteriorly in vab-8; lqIs220[Pegl-17::mab-5] double mutants (Table 2). This suggests that vab-8 might also control the direction of AQR migration downstream of MAB-5. This is consistent with the low level of anterior PQR migration seen in vab-8 mutants alone (Table 2).

In vab-8; lqIs220[Pegl-17::mab-5] double mutants, the percent of PQRs in the wild-type position 5 were significantly lower than the vab-8 single mutants (27% and 17% compared to 48% and 38%) (Table 2). The nature of this interaction is not understood, but it is possible that MAB-5 transgenic expression can inhibit PQR posterior migration in the absence of VAB-8.

The efn-4(bx80); lqIs220[Pegl-17::mab-5] double mutant showed a significant reduction in the number of AQRs that migrated posteriorly behind the anus (19% compared to 95% for lqIs220 alone) (Table 2). Cells that failed to migrate posteriorly all remained immediately anterior to the anus in position 4, and none migrated anteriorly (Table 2 and Figure 2C). PQR migration defects resembled efn-4 single mutants (Table 2). Thus, efn-4 likely acts downstream of mab-5 specifically in PQR posterior migration.

lin-17 mutants alone displayed a failure of PQR posterior migration as well as significant anterior PQR migration (Table 2). lin-17; lqIs220[Pegl-17::mab-5] double mutants displayed no anterior PQR migration (Table 2), suggesting that ectopic mab-5 rescued lin-17 anterior PQR migration. This is consistent with the known role of lin-17 in canonical Wnt signaling that activates mab-5 expression in QL.

lin-17; lqIs220[Pegl-17::mab-5] double mutants displayed a failure of posterior AQR migration (25% and 33% in the posterior compared to 95% in lqIs220[Pegl-17::mab-5] alone) (Table 2). Thus, lin-17 suppressed mab-5 gof for posterior AQR migration. PQR posterior migration defects were increased in two of the three lin-17; lqIs220[Pegl-17::mab-5] double mutants compared to lin-17 single mutants (28% and 10% compared to 38% and 30%) (Table 2). lin-17(lq202); lqIs220[Pegl-17::mab-5] did not display significantly increased PQR defects. Similar to vab-8, it is possible that transgenic mab-5 expression can inhibit posterior PQR migration in the absence of lin-17. In any event, these results suggest that lin-17 acts both upstream and downstream of mab-5: lin-17 participates in canonical Wnt signaling upstream of mab-5 to activate its expression; and lin-17 acts downstream of mab-5 to drive posterior migration.

Overall, these results suggest that vab-8, lin-17, and efn-4 are potential transcriptional targets of mab-5, and act downstream of mab-5. In the absence of these genes, mab-5 is incapable of fully executing its role as a determinant of posterior migration of PQR.

vab-8 and efn-4 can act cell-autonomously in the Q cells

Transgenes were constructed that drive vab-8 and efn-4 cDNA expression in the Q lineages using the egl-17 promoter (see Materials and Methods). The long isoform vab-8A partially but significantly rescued vab-8(ev411) (48% to 65% wild-type PQR), and the short isoform vab-8C partially but significantly rescued the posterior PQR migration of vab-8(e1017) (38% to 54% wild-type PQR) (Table 2). Pegl-17::efn-4 also partially but significantly rescued efn-4(bx80) (29% to 50% wildtype PQR) (Table 2). These results suggest that vab-8 and efn-4 can act cell autonomously. However, the rescue was incomplete. This could be due to the transgenic expression of these genes, which would not duplicate any fine-scale timing or levels of expression that might be required for full rescue. It is also possible that they also have non-autonomous roles outside of the Q cells. In any event, vab-8 and efn-4 can at least partially act cell-autonomously in the Q cells and their intracellular expression is necessary for migration.

Neither Pegl-17::vab-8 transgenes or Pegl-17::efn-4 alone caused any defects in AQR or PQR migration (Table 2). This indicates that while vab-8 and efn-4 are required for posterior PQR migration, they are not sufficient to cause posterior AQR migration as is mab-5. Possibly, multiple, redundant pathways act downstream of MAB-5 to drive posterior migration, including VAB-8 and EFN-4.

In vivo live imaging uncovers distinct stages of QL.ap (PQR) migration

In the first 4–5 hours of larval development, Q neuroblasts undergo the initial Wnt and MAB-5-independent stage of migration (Chapman et al. 2008; Middelkoop and Korswagen 2014; Josephson et al. 2016). QL protrudes and migrates posteriorly above the V5 seam cell, and QR protrudes and migrates posteriorly over the V4 seam cell. Each then undergo their first division to produce QX.a and QX.p. It is at this point that Wnt signaling and MAB-5 control QL.a/p migration (Chapman et al. 2008; Middelkoop and Korswagen 2014; Josephson et al. 2016). QL.p does not normally migrate, but QL.a migrates posteriorly over QL.p. The first migration of QL.a has been previously described with live imaging (Middelkoop and Korswagen 2014; Josephson et al. 2016).

To define QL.ap migration, live imaging of early L1 larvae immobilized in a Vivoverse Vivocube microfluidic chamber was conducted (see Materials and Methods). Embryos were isolated and allowed to hatch in M9 media without food overnight, resulting in early L1 arrest. These arrested L1s were placed on food and allowed to develop for 4–5 hours before imaging. Using this protocol, QL.a cells had already migrated posterior to QL.p (Figure 3A). QL.a underwent an asymmetric cell division after ~30–45 minutes to produce QL.aa and QL.ap (Figure 3B). QL.aa underwent programmed cell death. QL.ap extended a lamellipodial protrusion to the posterior and at ~60 minutes had migrated to a position just posterior to the anus (Figure 3B and C). At this point, QL.ap extended a broad lamellipodia protrusion to the posterior, and remained in this position for ~60 minutes (Figure 3C). At ~120 minutes, the QL.ap cell body migrated posteriorly past the anus. After this migration, differentiation into the PQR neuron began, including extension of a posterior dendritic growth cone (Norris et al. 2009; Kirszenblat et al. 2011) (Figure 1E). All 50 wild-type animals imaged displayed this pattern (Table 3). In summary (Figure 3E), posterior migration of QL.ap resembled the initial migration of the Q neuroblasts (Chapman et al. 2008): the cell extended a lamellipodial protrusion in the direction of migration, paused, and then translocated in the direction of lamellipodial protrusion. The QL.a lineage undergoes three such saltatory migrations (Figure 3F): migration posteriorly over QL.p; QL.ap migration to a position immediately posterior to the anus; and QL.ap migration posterior to the anus.

Figure 3. Time-lapse imaging of QL.a and QL.ap migration in wild-type.

Fluorescent micrographs of animals immobilized in the Vivoverse Vivocuble live imaging module are shown. The animals harbor the ayIs9[Pegl-17::gfp] transgene that is expressed in the Q cells and descendants. The scale bar in A represents 10μm. A-D are of the same animal imaged four times over a two-hour period starting at 4–5 hours post-feeding. The times indicate when the images were taken relative to the beginning of the imaging session. A) At 4–5 hours post-feeding, QL.a had migrated posteriorly over QL.p (migration 1). B) 30 minutes later, QL.a had divided to form QL.aa and QL.ap. QL.aa will undergo programmed cell death, and QL.ap has extended a posterior lamellipodial protrusion. C) 60 minutes after imaging began, QL.ap had migrated to a position immediately anterior to the anus, and extended a robust posterior lamellipodial protrusion (migration 2). D) Between 60 and 120 minutes after imaging began, QL.ap, migrated posterior to the anus (migration 3). E) After QL.ap migrated posterior to the anus at 120 minutes, it extended a posterior dendritic protrusion as it differentiated into the PQR neuron. This micrograph is of a different animal than those shown in A-D. F) A schematic showing the three distinct posterior migrations undertaken by QL.a and QL.ap as it migrates posterior to the anus to form the PQR neuron.

Table 3.

Migration failures in live imaging of animals.

	Migration failure stage
Genotype	1	2	3	1 and 2	1 and 3	1 and WT	No defective stage	N
wild-type	0	0	0	0	0	0	50	50
vab-8(ev411)	25	5	12	3	2	20	14	46
lin-17(e1456)	0	2	11	0	0	0	20	33
efn-4(bx80)	0	0	21	0	0	0	19	40
mab-20(ev574)	0	0	14	0	0	0	5	19

vab-8 is necessary for all three stages of QL.ap migration

vab-8 mutants had incomplete posterior migration of PQR (Table 2 and Figure 1D). Live imaging as described above was used to analyze QL.a lineage migration in vab-8(ev411) animals. When imaging began in vab-8(ev411), all QL.a had divided to form QL.aa and QL.ap (Figure 4A). In wild-type, this division occurred after imaging began. vab-8 might affect the timing of QL.a division. Alternatively, vab-8 might affect the response of the Q cells to feeding after starvation used in this protocol.

Figure 4. Time-lapse imaging of QL.a and QL.ap migration in vab-8(ev411).

Fluorescent micrographs of L1 vab-8(ev411) animals immobilized and imaged over time lapse as described in Figure 3. A-C are the same animal; D and E are the same animal; and F and G are the same animal. The scale bar in A represents 10μm. A) At 4–5 hours after feeding and at the beginning of imaging, QL.a failed to migrate completely posteriorly to QL.p. QL.a had also divided prematurely, one hour earlier than wild-type. B) 60 minutes later, QL.ap executed the second migration. C) By 120 minutes after imaging, QL.ap reached the normal position posterior to the anus, despite failing in the first migration over QL.p. D) 4–5 hours after feeding when imaging began, QL.a had already migrated posterior to QL. and divided. A thinner, dendritic protrusion with growth cone emanated posteriorly from QL.ap. E) 60 minutes later, QL.ap failed to execute the second migration and instead continued to extend a dendritic protrusion with a growth cone to the posterior. F) 60 minutes after imaging, a QL.ap cell executed the second migration. G) At 120 minutes after imagijg, the QL.ap failed to complete the third stage of migration and resided immediately posterior to the anus. A posterior dendritic protrusion also emanated from QL.ap at this time. H) A schematic diagram illustrating failures at each of the three steps of migration. Migration 2 and 3 failure was accompanied by premature extension of a posterior dendritic protrusion.

In 25/46 animals, QL.a had not completely migrated posterior to QL.p before division (Table 4 and Figure 4A). Of the 25/46 QL.a that failed to completely migrate over QL.p before dividing, at 60 minutes, QL.ap had not reached the position immediately anterior to the anus after the second stage but was in a more anterior position (Figure 4B). By 120 minutes, 20/25 QL.ap completed stage three of posterior migration to the normal position of QL.ap posterior to the anus (Figure 4A–C and Table 4 (1 and WT)). This suggests that deficits in migration can be compensated in later migration steps. However, 5/25 did not complete full migration and stopped near the beginning point of the second stage (3/5) (Table 3 (1 and 2)), or the third stage (2/5) (Table 3 (1 and 3)). No failures at both the second and third stages were observed. Thus, the absence of vab-8 might cause premature timing of QL.a division and/or affect the ability of QL.a to complete the first stage of migration before dividing.

Table 4.

Location of PQR migration failure in position 4

	Position 4
Genotype1	1st paradigm2	2nd paradigm2	non-position 4
vab-8(ev411)	30	22	48
vab-8(e1017)	48	26	26
efn-4(bx80)	0	70	30
lin-17(e1456)	64	9	27
lin-17(n671)	55	21	24
lin-17(lq202)	45	23	32
mab-20(ev574)	0	50	50
efn-4(bx80); vab-8(ev411)	41	51	8
efn-4(bx80); vab-8(e1017)	51	42	7
efn-4(bx80); lin-17(e1456)	10*	75	15
efn-4(bx80); lin-17(n671)	53	40	7
efn-4(bx80); lin-17(lq202)	48	40	12
vab-8(ev411); lin-17(e1456)	52	20	28
vab-8(ev411); lin-17(lq202)	72*	7	21
vab-8(ev411); lin-17(n671)	69*	16	15
efn-4(bx80); mab-20(ev574)	0	88*	12
vab-8(ev411); mab-20(ev574)	23	52*	25
mom-2(or77)M+	3	16	81
egl-20(mu39) 3	14	15	71
cwn-2(ok895)	1	8	91
cwn-1(ok546)	0	0	100
lin-44(n1792)	0	0	100
cwn-2(ok895); mom2(or77)M+	2	31	67

¹For each genotype, 100 animals were scored on three separate occasions for a total of 300 animals.

²Numbers are average percentages from three replicates of cells at each position rounded to the nearest whole number.

^*p<0.05

³100 animals with PQR in position 4 or 5 were scored.

In vab-8 animals in which QL.a is divided posterior to QL.p, the second and third stages sometimes failed. 5/46 QL.ap failed to complete only the second stage (Figure 4D and E and Table 4), and 12/46 failed to complete only the third stage and resided immediately to the anterior of the anus (Figure 4F and G and Table 4). These results suggest that VAB-8 is required for all three stages of QL.a migration (Figure 4H).

Migration failure resulted in the premature extension of a posterior dendritic process.

After QL.ap has completed the third and final stage of migration behind the anus, at 120 minutes, it begins to differentiate into the PQR neuron, including posterior extension of a thin dendritic process tipped with a growth cone (Norris et al. 2009; Kirszenblat et al. 2011) (Figure 1E). In vab-8(ev411) mutants with failures of stages two and three of migration, QL.ap immediately extended a thin posterior dendritic process instead of the broad lamellipodial protrusion of migrating cells (compare Figure 3C and Figure 4G). Failure at stage two resulted in dendritic extension ~120 minutes before wild-type (Figure 4D and E). In Figure 4D, a dendritic protrusion is seen as soon as imaging begins, and by 60 minutes in Figure 4E, the dendritic growth cone had reached posterior to the anus. In Figure 4F, QL.ap is beginning the second stage of migration 60 minutes after imaging began, and shows the posterior lamellipodial protrusion characteristic of migrating cells. At 120 minutes in Figure 4G, the QL.ap stopped migrating and began extension of a posterior dendritic process past the anus ~60 minutes before wild-type. These results suggest that failure to migrate results in premature extension of a posterior dendritic process (Figure 4H), possibly indicating premature differentiation into the PQR neuron.

lin-17 is required for the second and third stages of migration, but not the first.

Similar to vab-8(ev411) mutants, QL.a had already divided when imaging began in lin-17(e1456) (Figure 5A). However, all QL.a had migrated posteriorly to QL.p to the normal position of the beginning of stage 2 (n = 33) (Table 3 and Figure 5A and C). In lin-17 mutants, migration defects were noted at the second (2/33) (Figure 5A and B and Table 4) and third (11/33) stages of migration (Figure 5C–E and Table 3). Accompanying migration failure was premature extension of a posterior dendrite. In Figure 5B, the second stage failed and QL.ap extended a posterior dendrite at 60 minutes after imaging began. In Figure 5D, QL.ap had completed stage 2 at 60 minutes, but failed in stage three migration and extended a posterior dendritic process past the anus (Figure 5E). lin-17(e1456) displayed stage two and three migration failures, and similar to vab-8(ev411), extended posterior dendritic processes prematurely, one to two hours earlier than wild-type depending on where the migration failed.

Figure 5. Time-lapse imaging of QL.a and QL.ap migration in lin-17(e1456).

Fluorescent micrographs of L1 lin-17(e1456) animals immobilized and imaged over time lapse as described in Figure 3. A and B are the same animal; and C-E are the same animal. The scale bar in A represents 10μm. A) At the start of imaging at 4–5 hours postfeeding, QL.ap completed the first stage of migration and had migrated posterior to QL.p. B) At 60 minutes after imaging began, QL.ap failed in the second stage of migration and prematurely extended a posterior dendritic protrusion. C) At the beginning of imaging 4–5 hous after feeding, QL.ap had completed the first stage of migration and resided posterior to QL.p. D) After 60 minutes, QL.ap completed the second stage of migration and resided immediately anterior to the anus. E) After 120 minutes, QL.ap failed in the third stage of migration and prematurely extended a posterior dendritic protrusion. F) A schematic summarizing the migration failures and premature dendritic protrusion in lin-17(e1456) mutants.

efn-4 is necessary for the third and final step of QL.ap migration

Live time-lapse imaging of efn-4(bx80) L1 larvae was conducted as described above (n = 40). At the beginning of the imaging process, all 40 QL.a had undergone the posterior migration over QL.p and divided into QL.aa and QL.ap (Figure 6A and Table 4)). However, all QL.a had fully migrated posterior to QL.p before dividing. The second step of migration also occurred normally in all efn-4(bx80) mutants (Figure 6B and Table 4), where QL.ap resided immediately anterior to the anus. At this point, 21/40 QL.ap failed to extend the broad posterior lamellipodial protrusion seen in wild-type and instead, a posterior dendritic process emanated from QL.ap (Figure 6C and Table 4). These QL.ap failed to execute stage three migration posterior to the anus. efn-4 was required for the third and final migration of QL.ap behind the anus, and when this migration did not occur, a posterior dendritic process formed prematurely, similar to vab-8(ev411) and lin-17(e1456). This phenotype is consistent with the final position of incomplete migration of PQR neurons in efn-4 at a position immediately anterior to the anus (Figure 1E), whereas vab-8 and lin-17 show PQR neurons at this position as well as positions further to the anterior consistent with earlier migration failures. vab-1 encodes the sole member of the Eph receptor tyrosine kinase in C. elegans (George et al. 1998). However, vab-1(e2) mutants displayed no defects in PQR migration (Table 2). Thus, EFN-4 might utilize a distinct receptor in PQR migration.

Figure 6. Time-lapse imaging of QL.a and QL.ap migration in efn-4(bx80) and mab-20(ev574).

Fluorescent micrographs of L1 animals immobilized and imaged over time lapse as described in Figure 3. A- C are the same efn-4(bx80) animal; and D and E are the same mab-20(ev574) animal. The scale bar in A represents 10μm. A) At 4–5 hours after feeding, QL.a in efn-4(bx80) had migrated posterior to QL.p and divided. B) After 60 minutes, QL.ap had completed the second stage of migration and resided immediately anterior to the anus. C) After 120 minutes, QL.ap had failed to complete the third migration and extended a premature posterior dendritic process. D) In a mab-20(ev754) animals 60 minutes after imaging, QL.ap had completed the second migration and resided immediately anterior to the anus. E) After 120 minutes, QL.ap failed to execute the third migration and prematurely extended a posterior dendritic process. F) A schematic diagram of the third migration failure in efn-4 and mab-20 mutants.

Final PQR position reflects the stage of migration failure

The results above indicate three stages of QL.a migration. vab-8 affects all three, lin-17 affects stages 2 and 3, and efn-4 affects only stage 3. Stage 3 failures resulted in QL.ap residing immediately anterior to the anus, as opposed to stage 1 and 2 failures, which resulted in more anterior QL.ap. These positions were reflected in the final positions of PQR in mutants. In efn-4 mutants, which only displayed stage 3 failures, misplaced PQR were always immediately anterior to the anus (Figure 1E). In vab-8 and lin-17 mutants, misplaced PQR were sometimes at a more anterior location (Figure 1D and F). PQR position relative to proximity to the anus was scored. PQR neurons that failed to migrate posteriorly but resided in a more anterior position relative to the anus were designated paradigm 1, and those that were located immediately anterior to the anus were designated paradigm 2 (Table 4). efn-4 mutants displayed all paradigm 2 (Table 4), consistent with failure of migration stage 3. lin-17 and vab-8 displayed both paradigms 1 and 2 (Table 4), consistent with failures at stages 1, 2 and, 3.

The wnts egl-20, mom-2, and cwn-2 were required for posterior PQR migration

As lin-17 encodes a Frizzled Wnt receptor, PQR migration was scored in Wnt mutants. Previous studies showed that in egl-20/Wnt mutants, PQR migrated anteriorly due to its role in acutely inhibiting anterior migration of QL descendants and activating mab-5 in the QL lineage (Paolillo et al. 2024). cwn-2/Wnt acted downstream of mab-5 along with egl-20/Wnt to acutely inhibit anterior QL descendant migration (Paolillo et al. 2024). In the egl-20(mu39) hypomorph, 54% of PQRs migrated anteriorly (Table 2 positions 1–3), with the remaining 47% residing at the place of birth or at the normal PQR position in the tail (Table 2 positions 4 and 5). The position of PQRs that did not migrate anteriorly was scored relative to the anus (paradigms 1 and 2 in Table 4). egl-20(mu39) showed 14% migration failure at paradigm 1 and 15% at paradigm 2 (Table 4). cwn-1 mutants alone displayed no defects. Thus, in addition to inhibiting anterior migration and activating mab-5 expression, egl-20 is also involved in posterior QL.ap migration.

lin-44 was previously shown to repel posteriorly-migrating AQR and PQR in egl-20 cwn-2; cwn-1; lin-44 quadruple mutants (Josephson et al. 2016). Alone, lin-44 mutants displayed no defects in PQR migration (Table 2 and 4). mom-2 was previously shown to have weak defects in posterior PQR migration. This was confirmed, with mom-2 mutants showing 3% paradigm 1 and 16% paradigm 2 PQR posterior migration defects (Table 2 and 4). cwn-2 mutants showed 1% paradigm 1 and 8% paradigm 2 posterior migration defects. cwn-2; mom-2 double mutants showed an additive increase in paradigm 2 defects (31%) (Table 4). These results indicate that the Wnts EGL-20, MOM-2, and CWN-2 are required for to complete stages 2 and 3 of posterior PQR migration, consistent with the lin-17 phenotype.

vab-8, lin-17, and efn-4 do not genetically synergize in PQR migration

Double mutants of vab-8, lin-17, and efn-4 showed no synergistic genetic interactions in PQR migration (Table 1). The number of PQRs at position 4 resembled the single mutants alone or the predicted additive effect. While there were fewer cells at wild-type position 5 in double mutants, this could be an additive effect of cells that migrated anteriorly in vab-8 and lin-17 single mutants. The lack of synergistic genetic interactions suggest that these genes act in the same pathway or in independent pathways.

Double mutants of efn-4 with vab-8 and lin-7 had failures in both paradigm 1 and 2, similar to lin-17 and vab-8 alone (Table 4). One exception was lin-17(e1456); efn-4(bx80), which had significantly fewer cells in paradigm 1 compared to lin-17(e145). The nature of this interaction is not understood. These results suggest a step-wise migration process wherein where earlier migration failures (paradigm 1) take precedence over later migration failures (paradigm 2). Double mutants of vab-8 and lin-17 resembled additive effects of single mutants and did not display genetic synergy. However, vab-8(ev411); lin-17(lq202) did display significant enhancement of paradigm 1 failure compared to the predicted additive effect. In sum, these double mutant analyses showed no consistent evidence of genetic synergy and are consistent with efn-4, vab-8, and lin-17 acting in the same or independent pathway.

mab-20/Semaphorin acts in the Q lineage downstream of mab-5 to control QL.ap migration

efn-4 and mab-20 are both known to interact in a variety of different developmental contexts such as male tail morphogenesis and epiboly and ventral closure during embryogenesis (Roy et al. 2000; Chin-Sang et al. 2002; Hahn and Emmons 2003; Nakao et al. 2007). AQR and PQR migration was scored in four mab-20 mutants. All four mab-20 mutants displayed failure of PQR posterior migration, with misplaced cells residing in position 4 (Table 2 and Figure 1G). ev754 and bx24 showed 50% and 55% of PQR in position 4. ev574 is predicted to be a null allele as it contains a deletion of 1479 bp, deleting the first exon Culotti el. al, 2000. bx61 and ev778 showed fewer defects (4% and 36%), suggesting that they might be hypomorphic. Misplaced PQR neurons resided immediately anterior to the anus, similar to efn-4 mutants (paradigm 2, Table 4). Indeed, live time-lapse imaging of mab-20(ev574) revealed failure of the third stage of QL.ap migration and premature extension of a posterior dendritic process, similar to efn-4 (Table 3 and Figure 6). These data indicate that mab-20 is required for the third stage of QL.ap migration, similar to efn-4.

mab-20 cDNA expression driven by the egl-17 promoter partially but significantly rescued mab-20(ev574) PQR migration defects (47% to 73% wild-type PQR position) (Table 1). While the rescue was partial, similar to vab-8 and efn-4 rescue, these data suggest that mab-20 can act at least in part cell autonomously in the Q lineage to control QL.ap migration.

mab-20 was expressed in the Q lineage (Paolillo et al. 2024), but expression was not significantly affected by mab-5 lof or gof mutation (Table 1). However, mab-20 significantly suppressed the posterior migration of AQR in mab-5 gof backgrounds, with significantly more AQR in position 4 compared to mab-5(e1751) and lqIs220 gof (Table 2). Furthermore, PQR migration in double mutants resembled mab-20 mutants alone, with significantly more PQR neurons in position 4 compared to the mab-5 gof alone (Table 2).

mab-20; vab-8 and mab-20; efn-4 double mutants showed additive but not synergistic defects in PQR migration (Table 2). For example, vab-8(ev411) showed 50% of PQR in position 4, mab-20(ev574) showed 50%, and vab-8(ev411); mab-20(eb574) showed 70%. Together, these data suggest that MAB-20 acts with EFN-4, LIN-17, and VAB-8 act together to control the third stage of QL.ap migration.

efn-4 and mab-20 can partially compensate for each other

The ability of efn-4 transgenic expression to rescue mab-20 mutants, and vice versa was tested. mab-20(ev574); Pegl-17::efn-4 animals displayed 83% of PQR in wild-type position 5, compared to 47% in mab-20(ev574) alone (Table 2). efn-4(bx80); Pegl-17::mab-20 animals displayed 64% wild-type position 5 compared to 29% in efn-4(bx80) alone (Table 2). These data indicate that transgenic expression of one gene can partially compensate for loss of the other, consistent with them acting in a common pathway.

Materials and Methods

Genetics

All experiments were carried out at 20°C using standard C.elegans techniques (Brenner 1974; Sulston and Hodgkin 1988). Mutations used in this study were as follows: LGI: lin-17(e1456, n671, lq202), mab-20(ev574, bx24, bx61, ev778), lin-44(e1792). LGII: lqIs244 [Pgcy-32::cfp], ayIs9 [Pegl-17::gfp], cwn-1(ok546). LGIV: efn-4(bx80, e36), egl-20(mu39), cwn-2(ok895). LGV: vab-8(ev411), vab-8(e1017), mom-2(or77)/nT1. LGX: lqIs220 [Pegl-17::mab-5::gfp]. lqIs402, lqIs403, and lqIs404 were generated by integrating the lqEx1353[Pegl-17::efn-4] transgene. lqIs413, lqIs414, lqIs415 were generated by integrating lqEx1367[Pegl-17::mab-20]. lqIs416, lqIs417and lqIs418 were generated by integrating lqEx1371[Pegl-17::vab-8L]. lqIs419 was generated by integrating lqEx1376[Pegl-17::vab-8S]. Wormbase was used for C. elegans informatics in the design, planning, and execution of experiments (Sternberg et al. 2024).

lin-17(lq202) was isolated as a spontaneous mutant with PQR migration defects during an unrelated cross with the lqIs244 transgene. The following sequence is deleted in lin-17(lq202): TCTTCATCTCCTCCCTCCCATACCTCACGCCACTCTTCATCGATGCTCCGATCCGAT CCTGCCACGCACTTGGAA.

Expression plasmid construction

Plasmids with cDNAs driven by the egl-17 promoter were synthesized by Vectorbuilder (Chicago, IL USA). Sequences of the plasmids are included as Supplemental Files. pEL1174: Pegl-17::efn-4cDNA. pEL1177: Pegl-17::vab-8LcDNA. pEL1178: Peg-l17::vab-8ScDNA. pEL1179: Pegl-17::mab-20cDNA.

Scoring AQR and PQR position

To score the location of PQR and AQR, the lqIs244[Pgcy-32::cfp] transgene was used as a marker as described previously (Paolillo et al. 2024): position 1 was the normal position of AQR in the anterior deirid in the head; position 2 was between the pharynx and the vulva; position three was around the vulva anterior to Q cell birthplace; position 4 was the Q cell birthplace; and position 5 was the normal position of PQR posterior to the anus. For those cells that fail migration in position 4, paradigm 1 was near the Q cell birthplace anterior from the anus, and paradigm 2 was immediately anterior to the anus. Significance of difference was determined by Fisher’s exact test.

L1 synchronization, immobilization, and time-lapse imaging

The ayIs9[Pegl-17::gfp] transgene was crossed into all the mutant strains and to observe Q lineage migration. Gravid hermaphrodites were washed from plates seeded with OP50 using M9 and bleached using standard protocols to collect embryos (Paolillo et al. 2024). Eggs were allowed to hatch in M9 overnight without food at 20°C. Starved L1s were placed on a plate with OP50 E.coli and collected 4–5 hr later for the imaging process. L1s were washed along with OP50 and loaded into the vivoVerse Vivocube (Austin, TX USA) microfluidic chip following manufacturer instructions (Mondal et al. 2016; Laing et al. 2019). Immobilized animals were examined under a fluorescence compound microscope. This approach using the Vivocube microfluidic chip did not involve the usage of any paralytic, and the animals were able to freely feed on the E. coli that were washed off with the worms. While the L1 larvae could still move slightly in the microfluidic channel, the QL.a and QL.ap migration could be examined over the course of hours.

Discussion

MAB-5 controls three distinct stages in posterior QL.a and QL.ap migration

The Antennapedia-like Hox gene mab-5 is a determinant of posterio Q neuroblast lineage posterior migration (Josephson et al. 2016). MAB-5 acts by first inhibiting anterior migration of QL descendants and then promoting posterior migration (Josephson et al. 2016). Both of these events likely require transcriptional changes driven by MAB-5 in the QL lineage. described here are the first known transcriptional targets downstream of mab-5 that direct posterior migration of QL.a and QL.ap. Q lineage FACS sorting and RNA seq in mab-5 mutants revealed that expression of vab-8, lin-17, and efn-4 is dependent on mab-5 function. Work here demonstrates that these three genes mediate posterior migration downstream of mab-5: mutations in each cause failure in posterior migration of QL.a and/or QL.ap; mutations suppress posterior migration driven by mab-5 ectopic expression; and vab-8 and efn-4 act at least in part cell-autonomously in the Q lineage.

Live time-lapse imaging of QL.a and QL.ap migration in wild-type and vab-8, lin-17, and efn-4 mutants revealed three distinct stages of migration after division of QL to form QL.a and QL.p. First, QL.a migrates posteriorly over QL.p, which does not migrate, to reside to the posterior of QL.p. After QL.a divides to form QL.aa and QL.ap, the second stage involves posterior migration of QL.ap to a position immediately anterior to the anus. The third stage involves posterior migration of QL.ap posterior to the anus, the final position, where differentiation into the PQR neurons begins, as evidenced by posterior extension of then dendritic process tipped with a growth cone. Each distinct migration involves the posterior extension of a lamellipodial protrusion, followed by posterior translocation of the cell body. This saltatory migration pattern is similar to the early migration of QL and QR. The third stage of QL.ap migration is particularly striking, wherein QL.ap extends a broad posterior lamellipodial protrusion posterior into the WT location, with the cell body undergoing somal translocation in the next hour. Strikingly, vab-8, lin-17, and efn-4 affect distinct stages. vab-8 is required for all three stages, lin-17 is required for stages 2 and three, and efn-4 is required only for the third and final stage of QL.ap migration.

vab-8 controls all three stages of migration downstream of mab-5

vab-8 expression in the Q lineage showed a paired response to mab-5. Expression was reduced in mab-5 lof and increased in mab-5 gof. vab-8 encodes a conserved, atypical kinesin-like KIF26 molecule with long and short isoforms (Wightman et al. 1996; Wolf et al. 1998). The long isoform contains the kinesin motor domain. The short isoform is missing the motor domain. vab-8(e1017) introduces a premature stop codon that affects all isoforms. vab-8(ev411) is a 5’ splice site mutation in the 3^rd intron and is predicted to affect only the long isoform. This suggests that the long isoform is required for PQR migration. However, transgenic expression of the short isoform can partially but significantly rescue vab-8(e1017), suggesting that the short isoform is also sufficient for PQR migration. These transgenic studies also indicate that vab-8 acts at least in part cell-autonomously in the Q lineage to control PQR posterior migration.

vab-8(ev411) showed defects in all three stages of QL.a and QL.ap migration. In some cases, cells that displayed defects in stages 1 or 2 eventually reached their proper final destination behind the anus. This suggests that the three migration stages are independent and that deficits in migration in one stage can be accommodated in a later stage. Consistent with a role in all three stages, the final position of PQR varied in vab-8, from near the birth position (paradigm 1, reflective of stage 1 and 2 failures) to immediately anterior to the anus (paradigm 2, reflective of failure at the third stage of migration). vab-8 suppressed ectopic mab-5 gof in AQR and PQR, suggesting it acts downstream of mab-5. vab-8 has been shown to control CAN cell and ALM mechanosensory neuron posterior migration (Wightman et al. 1996; Wolf et al. 1998). In ALM, the VAB-8 long isoform is required for the cell surface localization of the SAX-3 receptor (Watari-Goshima et al. 2007), and acts with Frizzled and Neurexin to regulate delivery of synaptic components (Balseiro-Gomez et al. 2022). VAB-8 is also involved in gap junction formation and maintenance (Meng et al. 2016). In QL.a migration, VAB-8 might be involved in the translocation of transmembrane or secreted molecules to the cell surface that drive posterior migration. Thus, MAB-5/Hox might drive posterior migration of QL.a by driving expression of VAB-8, which alters the cell surface interactions on QL.a such that posterior migration can occur.

A novel role of lin-17/Fz downstream of mab-5

lin-17 expression was reduced in one mab-5 lof condition, suggesting that it might be a mab-5 target in the Q lineage. lin-17 encodes a Frizzled Wnt receptor that has been shown to act in canonical Wnt signaling to activate mab-5 expression in QL (Chalfie et al. 1983; Kenyon 1986; Salser and Kenyon 1992; Harris et al. 1996; Whangbo and Kenyon 1999; Korswagen et al. 2000; Herman 2003; Eisenmann 2005; Ji et al. 2013; Josephson et al. 2016). Consistent with this, lin-17 mutants showed anterior migration of PQR to the head near the normal position of AQR. lin-17 mutants also showed failure in posterior PQR migration among PQR that did not migrate anteriorly. PQRs in paradigm 1 and paradigm 2 were observed, consistent with a role of lin-17 in stages 2 and 3 as revealed by live time-lapse imaging. In lin-17; mab-5 gof double mutants, anterior PQR migration was rescued, suggesting that lin-17 acts upstream of mab-5 to activate it in the QL lineage. However, posterior AQR and PQR migration defects resembling lin-17 mutants alone remained. This suggests that lin-17 acts downstream of mab-5 in posterior PQR migration. Thus, lin-17 acts both upstream and downstream of mab-5. Possibly, mab-5 is required for continued expression of lin-17 in the QL lineage to drive posterior migration. The Wnt genes egl-20, cwn-2, and mom-2 showed PQR migration defects, mostly paradigm 2. mom-2; cwn-2 double mutants showed an additive increase suggesting that Wnts might act redundantly to drive posterior migration with lin-17. The involvement of Wnts in posterior QL lineage migration is consistent with their known role in regulating distinct aspects of anterior QR lineage migrations, which also occurs in three distinct stages each controlled by different Wnt ligands (Mentink et al. 2014). Thus, both anterior QR lineage migration and posterior QL lineage migration each occurs in three distinct stages controlled by Wnts, although in QL.ap the second and third stages are predominantly affected.

efn-4/Ephrin controls the third stage of QL.ap migration downstream of mab-5

efn-4 expression in the Q lineage was reduced in one mab-5 lof condition. efn-4 and mab-5 act together in male tail morphogenesis, maintaining the repulsion between the Rn.a cells so the improper fusion of the male tail rays does not occur(Ikegami et al. 2012). efn-4 was necessary for posterior QL.ap migration. Final PQR position in paradigm 2 and live time lapse imaging showed that efn-4 mutants failed in the third and final stage of QL.ap migration, resulting in PQR positioned immediately anterior to the anus. No defects were observed in stages 1 or 2. Transgenic expression and suppression experiments indicated that efn-4 acts in the Q lineage downstream of mab-5 to mediate the third stage of QL.ap migration. Thus, mab-5 might drive expression of efn-4 in QL to drive posterior migration.

efn-4 encodes an Ephrin-family secreted molecule attached to the plasma membrane via a lipid glycosyl-phosphatidylinositol anchor (a type A Ephrin). VAB-1 encodes the sole Ephrin receptor tyrosine kinase (George et al. 1998; Wang et al. 1999), a mutant of which had no effect on PQR migration (Table 2). Thus, EFN-4 likely acts through another pathway. EFN-4 was shown to interact functionally and physically with the LAD-2/L1CAM receptor and did not interact physically with VAB-2/EphR (Dong et al. 2016). Thus, EFN-4 can act through non-EphR receptor pathways.

Results here suggest that EFN-4 can act cell-autonomously in the Q lineage. Ephrins are known to mediate both forward signaling (wherein they act as a ligand) and reverse signaling (wherein they act as a receptor) (Klein and Kania 2014; Kania and Klein 2016). Possibly, EFN-4 reverse signaling mediates posterior QL.ap migration. Such signaling would likely require a co-receptor on the QL.ap cell, as EFN-4 has no transmembrane domain and is an extracellular molecule with a GPI anchor. Ephrins are classically understood as mediating repulsive responses, resulting in collapse of the actin cytoskeleton in migrating cells or growth cones (Klein and Kania 2014; Kania and Klein 2016), a role consistent with EFN-4 in male tail development, ensuring that ray cells do not ectopically fuse with one another (Ikegami et al. 2004). Results here indicate that EFN-4 might be required for a migratory event. The cellular basis of EFN-4 function in QL.ap is not known, but it could be to mediate the formation of the broad lamellipodial protrusion that emanates posteriorly from QL.ap in the third stage of migration. It is also possible that EFN-4 prevents QL.ap interactions and adhesion with surrounding cells, allowing the broad lamellipodial protrusion to form and posterior migration to occur, a role more akin to repulsion. Future studies will be aimed at identifying co-receptors that act with EFN-4 as well as the cellular basis of EFN-4 function in posterior QL.ap migration.

mab-20/Semaphorin acts in the third stage of QL.ap migration

In male tail ray cell fusion, mab-20 acts through efn-4 to prevent ectopic ray cell fusion (Ikegami et al. 2012). MAB-20 belongs to the Semaphorin class of guidance cues (Roy et al. 2000) that, similar to Ephrins, are known for repulsive activity and actin cytoskeleton collapse (Alto and Terman 2017). mab-20 mutants displayed PQR migration defects and QL.ap third stage migration failure similar to efn-4. efn-4; mab-20 double mutants had additive effects, suggesting some distinct function of the molecules but consistent with them acting together. Indeed, transgenic expression of mab-20 partially rescued efn-4 and vice versa, to levels similar to rescue with the corresponding transgenes. This is consistent with EFN-4 and MAB-20 acting in a common pathway. While mab-20 expression is enriched in the Q lineage, its expression is not significantly affected by mab-5. Thus, mab-20 is likely not a transcriptional target of mab-5. However, mab-5 could likely encode a constitutively-expressed cofactor necessary for EFN-4 function in posterior migration. In other words, EFN-4 might be the impetus for posterior migration downstream of mab-5 but requires mab-20 to execute the program. EFN-4 and MAB-20 are both molecules with known repulsive effects, suggesting that similar repulsive mechanisms are involved in posterior QL.ap migration. They might mediate migration away from an anterior signal, or perhaps prevent adhesion of QL.ap with surrounding cell, allowing posterior migration to occur.

Failure of migration triggers premature dendritic extension

One of the striking findings of this study is that failure of migration is accompanied by premature extension of a dendritic protrusion, indicative of premature neuronal differentiation. For example, failures of the second stage of migration in vab-8 and lin-17 mutants resulted in immediate extension of a posterior dendrite, approximately two hours earlier than wild-type. Failure at the third stage of migration in vab-8, lin-17, efn-4, and mab-20 resulted in a dendritic protrusion approximately one to two hours earlier than wild type. This certainly suggests that the migratory program involving these genes was responsible for not only promoting posterior migration, but also inhibiting extension of a dendrite and possible premature neuronal differentiation. This suggests that there is a continuum between migration and dendritic extension. Possibly, when genes facilitating migration are present, they facilitate the extension of a migratory lamellipodium, which leads to migration. In the absence of these genes, the cell instead sends out a dendrite. EFN-4 activity and interactions are key to this developmental fulcrum. Given the timing of dendrite extension, it is unlikely a transcriptional program is involved. More likely is that EFN-4 interactions with the extracellular matrix or cell surface dictate a migratory versus dendrite developmental decision.

In vab-8 mutants with first stage failures, in other words a failure of QL.a migration, premature dendrite extensions were not observed. After the first migration, QL.a divides to form QL.aa and QL.ap, the latter QL.ap becoming PQR. This suggests that QL.a division must occur before QL.ap can extend a premature dendrite. As QL,ap will become PQR, this suggests that QL.ap has already begun to differentiate into PQR before reaching its final position, and migration failure results in premature dendritic extension.

A transcriptional program driving posterior QL.a migration downstream of MAB-5

Results here show that vab-8, lin-17, and efn-4 are transcriptional targets of MAB-5 in the Q lineage that are required for MAB-5 to drive posterior QL.a and QL.ap migration. VAB-8 is a conserved, atypical Kinesin involved in trafficking of transmembrane and/or extracellular molecules to the plasma membrane, it is possible that VAB-8 mediates translocation of distinct secreted or transmembrane molecules to the plasma membrane that mediate the distinct steps of QL.a and QL.ap migration. An as-yet unidentified molecule might be trafficked by VAB-8 to mediate the first migration of QL.a. This molecule could itself be a transcriptional target of MAB-5 or be a constitutively-expressed factor that requires VAB-8 to reach the plasma membrane. Translocation of LIN-17 by VAB-8 might trigger the second migration, and translocation of LIN-17 and EFN-4 might trigger the third stage. In any case, this work utilized Q cell sorting and RNA seq in mab-5 mutant backgrounds to identify potential MAB-5 transcriptional targets, and shows that VAB-8, LIN-17, and EFN-4 define a novel transcriptional program downstream of MAB-5 to drive posterior neuroblast migration, This work links cell surface molecule expression to a canonical Wnt signaling pathway involving EGL-20 mediated by a Hox factor. As a Hox terminal selector factor, MAB-5 might subtly alter the interaction of QL.a and QL.ap with the extracellular environment to achieve posterior migration without affecting deeper levels of neuron fate determination or differentiation.

Figure 7. A potential model of a transcriptional program downstream of MAB-5 in posterior QL.a and QL.ap migration.

MAB-5 expression in the QL lineage is activated by EGL-20/Wnt and canonical Wnt signaling. MAB-5 drives the expression of VAB-8/KIF26, LIN-17/Fz, EFN-4/Ephrin, and other unidentified factors In QL. After QL division, VAB-8 might traffick an unidentified factor to the plasma membrane to execute the first stage of QL.a posterior migration. After QL.a division, VAB-8 might traffick LIN-17 to the plasma membrane of QL.ap to execute the second stage of QL.ap migration. VAB-8 might then traffick EFN-4 and LIN-17 to the plasma membrane of QL.ap to execute the third and final stage of QL.ap migration.