Light Influences Time-of-Day Differences in the Expression of Clock Genes and Redox Genes Involved in Glutathione Homeostasis in the Lens

Abstract

Purpose

To determine whether light influences time-of-day differences in the expression of circadian clock and redox genes and the antioxidant glutathione (GSH) in cultured rat lenses.

Methods

Rat Wistar lenses (6 weeks) were cultured over a 24-hour period either in 12 hours of light and then 12 hours of dark (12-hour light/12-hour dark) or in constant darkness (12-hour dark/12-hour dark). Lenses were collected at 0 hour, after 12 hours, and then 24 hours after culture, and either quantitative PCR was performed to examine the expression of core clock genes and GSH-related redox genes or high-performance liquid chromatography was used to measure intracellular GSH levels. Lenses were collected at 10 AM, 2 PM, 6 PM, and 10 PM, fixed, sectioned, and labeled with the antibodies against the light-sensing melanopsin protein.

Results

Under 12-hour light/12-hour dark conditions, core clock genes and redox genes involved in GSH synthesis displayed time-of-day differences in their expression patterns which were not maintained under constant darkness. GSH levels remained constant under both lighting conditions. Melanopsin was localized to the epithelial cells at the anterior epithelium but absent from epithelial cells in the equatorial epithelium and fiber cells.

Conclusions

The lens possesses the ability to detect light via melanopsin localized exclusively in the anterior lens epithelium. This may act as a cue for the lens to drive day and night differences in the expression of clock genes and/or redox genes, ensuring that GSH levels are maintained at normal physiological levels to provide protection from oxidative stress across the light/dark cycle.

The circadian clock is a powerful endogenous cellular timekeeping mechanism that is highly conserved between species and allows organisms to fine tune their physiology and behaviors to specific times of day.¹ Light is the most important synchronizer of the circadian clock and is detected in the retina by melanopsin photoreceptors that are maximally sensitive to blue light.² Melanopsin communicates the presence of light to the suprachiasmatic nucleus (SCN) of the brain to set and reset the timing of the circadian clock via circadian rhythms generated by the rhythmic expression of clock genes that involve a transcriptional–translational feedback loop.² These loops have a positive arm (BMAL1 and CLOCK) and a negative arm (PER1–3, CRY1 and 2). BMAL1 and CLOCK form a complex in the nucleus that binds to target gene promoters, resulting in the transcription of specific genes, including genes of the negative arm of the clock.³ PER and CRY proteins heterodimerize to repress the transcriptional activity of BMAL1 and CLOCK, creating a negative feedback loop that drives rhythmic protein synthesis and degradation, thereby generating an endogenous 24-hour cycle. BMAL1 and CLOCK have also been shown to regulate the transcription of nuclear factor-erythroid 2-related factor 2 (NRF2) which in turn drives the expression of antioxidant genes,⁴ including those involved in maintaining glutathione (GSH) levels, the principal antioxidant in the lens.⁵

The lens of the eye is positioned directly within the pathway of light and as a result contains high levels of GSH to counteract oxidative stress.⁶ These high concentrations of GSH are maintained by a combination of GSH uptake, intracellular synthesis of GSH, regeneration of GSH from oxidized glutathione (GSSG), and export of glutathione, followed by its degradation into constituent amino acids to ensure glutathione turnover.⁷ Emerging evidence in the lens supports a link between antioxidant homeostasis and the circadian clock with antioxidants and antioxidant enzymes displaying daily cycles in their expression levels.^8–10 Maintaining GSH homeostasis is challenging, particularly for the avascular tissues of the eye such as the lens, which is solely reliant on the aqueous humor for nutrients, GSH, and the amino acids required for GSH synthesis. The aqueous humor is secreted in a circadian manner, with its secretion higher during the day than at night.¹¹ This suggests that delivery of GSH and GSH precursor amino acids to the lens is also not constant, and that GSH levels in the lens may display circadian behavior.

Recent work by our group examined the in vivo expression of core clock proteins, NRF2, and enzymes involved in GSH synthesis (glutamate–cysteine ligase catalyzing subunit [GCLC] and glutamine synthetase [GS]) and GSH regeneration (GR) every 4 hours over a 24-hour period in rat lenses.¹² We revealed time-of-day differences in the expression of BMAL1, CRY2, and redox proteins such as GCLC, GS, and GR, with these enzymes generally peaking at the start of the night (6 PM).¹² Moreover, we discovered time-of-day differences in GSH levels in the rat lens, such that GSH levels were highest at the start of night, which represents the active phase of the rat when high GSH levels may be required to counteract oxidative stress induced by cellular metabolism.¹² Although we have not yet directly linked the clock to regulation of GSH levels, Chhunchha and colleagues¹³ demonstrated that knockdown of BMAL1 in human lens epithelial cells resulted in loss of the rhythmic expression of NRF2.¹³ This in turn reduced the expression of one of its target genes, peroxiredoxin 6 (PRX6), which is important for the detoxification of H₂O₂ to H₂O. Furthermore, the synthesis and release of melatonin, which acts as an antioxidant in the lens,¹⁴ has been shown to exhibit circadian behaviors, with levels highest at night and lowest during the day in rabbit and rat lenses.^15,16 Human lens epithelial cells express melanopsin, and activation of melanopsin with blue light was shown to be responsible for the regulation of melatonin synthesis and the circadian fluctuations of melatonin levels in the lens.¹⁷ Collectively, these studies provide accumulating evidence for the use of a circadian clock to regulate lens antioxidant defense systems; in particular, the presence of melanopsin in the lens raises the possibility that the lens can directly detect light to drive its own circadian rhythms and regulate GSH levels in the lens.

In this study, we extended our previous in vivo studies and examined whether, in the absence of the retina and SCN, cultured rat lenses were able to maintain time-of-day differences in the expression of clock, redox genes, and GSH levels under 12-hour light/12-hour dark conditions. We also examined the role of light as a cue in maintaining these expression patterns by culturing lenses under constant dark conditions. Finally, we mapped melanopsin expression in the different regions of the rat lens to determine its localization in relation to the pathway of light. Taken together, this study provides insight into the role of light as a cue to drive clock and redox rhythms in the lens, independently of the retina and SCN, ensuring the maintenance of high GSH levels in the young lens.

Methods

Reagents

Phosphate-buffered saline (PBS) was prepared from PBS tablets (Sigma-Aldrich, St. Louis, MO, USA), and M199 media was purchased from Sigma-Aldrich. Primers for Bmal1, Clock, Per1 to Per3, Cry1 and Cry2, Nrf2, Gclc, Gclm, Gs, Gr, and β-actin were synthesized by Integrated DNA Technologies (Coralville, IA, USA). Primers were reconstituted in RNase/DNase distilled water to yield a 100-µM stock solution, which was diluted to 20 µM for use in PCR reactions. The rabbit anti-mouse melanopsin antibody was obtained from Abcam (Cambridge, UK). The goat anti-rabbit Alexa Fluor 488 and donkey anti-goat Alexa Fluor 488 secondary antibodies, the membrane marker wheat germ agglutinin (WGA) conjugated to Alexa Fluor 594, and 4′,6-diamidino-2-phenylindole (DAPI) were obtained from Life Technologies (Carlsbad, CA, USA). All solutions, unless otherwise stated, were purchased from Sigma-Aldrich.

Animals

Male Wistar rats at 6 weeks of age were supplied by the Vernon Jansen Unit located at the University of Auckland Grafton Campus. All animals were treated in accordance with protocols approved by the University of Auckland Animal Ethics Committee (ethics no. R001413) and in compliance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Animals were euthanized by CO₂ asphyxiation. Rats were housed in a 12-hour/12-hour light/dark cycle with the lights turned on at 6 AM and the lights turned off at 6 PM.

Lens Culture

Whole rat eyes were dissected at 5 AM and immediately placed in pre-warmed PBS solution. Under a dissecting microscope, lenses were carefully excised using sharpened microdissection scissors, taking extreme care to avoid any contact with the lens surface.¹⁸ Lenses were then gently transferred using glass lens loops into 24-well culture plates containing 2 mL of M199 medium (without phenol red) supplemented with 1% penicillin. The plates were incubated at 37°C for 1 hour in the dark within a humidity-controlled CO₂ incubator. These precautions were employed to minimize mechanical trauma and maintain lens integrity by preventing increased permeability. Lenses were then removed under low ambient light conditions and assessed for transparency. Clear lenses were then placed in 2 mL of fresh M199 media with 1% penicillin and then returned to the incubator and exposed to either a 12-hour light/12-hour dark cycle (Fig. 1A) or 24 hours of continuous darkness (Fig. 1B) on a dark surface. The light intensity during the light phase was approximately 360 lux, which is within the range used by Abe et al.¹⁶ in their study of melatonin synthesis in the lens. Lenses were then cultured for 0 hours (6 AM), 12 hours (6 PM), or 24 hours (6 AM the following day) under each lighting condition, after which, lenses were assessed for transparency and the media used to perform a lactate dehydrogenase assay (see below). Only clear lenses with low levels of lactate dehydrogenase (LDH) in the media were selected for further analysis.

Figure 1.

Schematic depicting the lens collection points under the two different lighting conditions.

LDH Assay to Determine Membrane Integrity

At the end of the culture period, an LDH assay (Roche Diagnostics, Indianapolis, IN, USA) was performed on the culture media to determine cell viability and membrane integrity of the lenses. The standard dilutions of the LDH assay were prepared via the use of type III bovine heart L-LDH (14 mg protein/mL; Sigma-Aldrich) in 50-mM EDTA (pH 8.0). Then, 100-µL LDH standards and samples were added to a clear 96-well plate and measured in triplicate. The reaction solution, which contained catalyst solution (diaphorase/NAD+ mixture) and dye solution (iodotetrazolium chloride and sodium lactate) in a 1:45 ratio, was prepared before use; 100 µL of the reaction solution mixture was loaded into each well. The plate was then placed in the dark at room temperature for 15 minutes. The EnSpire 2300 MultiMode Microplate Reader (PerkinElmer, Waltham, MA, USA) was used to measure absorbance at a wavelength of 490 nm. The data are presented as the concentration of LDH protein in the media (unit/mL) (Supplementary Fig. S1). An arbitrary measurement of three times above the baseline (0.0036 unit/mL × 3 = 0.0109 unit/mL) was set as a cut-off threshold based on previous work comparing LDH levels in healthy versus damaged lenses.¹⁸ This threshold is based on prior experimental experience where it was demonstrated that opaque or deliberately damaged lenses exhibited at least a threefold increase in LDH levels compared to clear lenses. Accordingly, we have applied this threshold to exclude lenses from further analysis. Although somewhat arbitrary, this threshold provided a consistent and conservative measure to ensure that only lenses with intact membranes were included in our analyses.

Primer Selection and Validation

The primer sequences for each of the target clock and redox gene were searched from published papers for primers previously used in Rattus norvegicus.^19–23 We used Primer-BLAST (Basic Local Alignment Search Tool; https://www.ncbi.nlm.nih.gov/tools/primer-blast/; National Center for Biotechnology Information, Bethesda, MD, USA) to confirm the sequence alignment, melting temperature (T_m), guanine–cytosine (GC) content, and self 3′-complementarity to ensure that the most appropriate primer sequences were selected for each target gene. We tested and confirmed the primer efficiency to fall between 90% and 100% in our experimental setup (data not shown), and we used the same primer sets in our previous work.¹²

Real-Time Polymerase Chain Reaction

Total RNA was isolated using TRIzol (Life Technologies) from lenses collected after 0 hours (n = 8 lenses), 12 hours (n = 8 lenses), and 24 hours (n = 8 lenses) for each lighting condition. Genomic DNA was removed from total RNA before complementary DNA (cDNA) synthesis by incubation with 10 U/µL recombinant DNase I (Roche Diagnostics). Total lens cDNA was synthesized from 1 µg total of the SuperScript III/RNaseOUT enzyme mix (Life Technologies) for cDNA amplification. A control reaction (no cDNA synthesis) was also conducted in the absence of the SuperScript III/RNaseOUT enzyme. Synthesized cDNA or control reaction (0.5–1 µL) were added to separate PCR mixtures containing final concentrations of 5 µL PowerUp SYBR Green PCR Master Mix (Applied Biosystems, Waltham, MA, USA) and 3 µL RNase-free water to a final volume reaction mixture of 10 µL and 2 µM sense and antisense primers (Table). The mixture was placed in a MicroAmp EnduraPlate Optical 384-Well Clear Reaction Plate (Applied Biosystems) and then centrifuged at 1000 rpm for 1 minute. The PCR plate was then placed in a QuantStudio 12K Flex Real-Time PCR System (Applied Biosystems). The conditions for the quantitative PCR (qPCR) consisted of a hot start (95°C) for 10 minutes, then 40 cycles of denaturation at 95°C for 15 seconds, followed by a combined annealing/extension at 60°C for 1 minute. The relative quantity of mRNA for Bmal1, Clock, Per1 to Per3, and Cry1 and Cry2 and GSH redox genes Nrf2, Gclc, Gclm, Gs and Gr were determined using the comparative threshold cycle (Ct), and the target gene levels of expression were normalized to the β-actin levels as an endogenous control within each group.

Table.

Primer Sequences for Target Genes

Gene Name (GenBank Accession No.)	Primer Sequence (5′–3′)	Spans Multiple Exons	Amplicon Size (bp)
β-actin (NM_001101.5)	Forward: AGCCATGTACGTAGCCATCCReverse: TCTCAGCTGTGGTGGTGAAG	Yes	171
Bmal1 (NM_024362)	Forward: CCGATGACGAACTGAAACACCTReverse: TGCAGTGTCCGAGGAAGATAGC	Yes	215
Clock (NM_021856)	Forward: TCTCTTCCAAACCAGACGCCReverse: TGCGGCATACTGGATGGAAT	No	110
Cry1 (NM_198750)	Forward: TGCTCCTGGAGAGAATGTCCReverse: TGACTCTCCCACCAACTTCA	Yes	271
Cry2 (NM_133405)	Forward: GGATAAGCACTTGGAACGGAAReverse: ACAAGTCCCACAGGCGGT	Yes	155
Per1 (NM_001034125)	Forward: ACACCCAGAAGGAAGAGCAAReverse: GCGAGAACGCTTTGCTTTAG	Yes	164
Per2 (NM_031678)	Forward: GAGAGAGGAACAGGGCTTCCReverse: TTGACACGCTTGGACTTCAG	Yes	195
Per3 (NM_023978)	Forward: ATAGAACGGACGCCAGAGTGTReverse: CGCTCCATGCTGTGAAGTTT	Yes	104
Nrf2 (NM_031789)	Forward: GTTGAGAGCTCAGTCTTCACReverse: CAGAGAGCTATCGAGTGACT	No	56
Gclc catalytic subunit (NM_012815)	Forward: ATCTGGATGATGCCAACGAGTCReverse: CCTCCATTGGTCGGAACTCTACT	Yes	129
Gclm regulatory subunit (NM_017305.2)	Forward: GGCGATGTTCTTGAAACTCTGReverse: CAGAGGGTTGGGTGGTTG	No	65
Gs (NM_012962.1)	Forward: GCAGGAACTGAGCAGGGTGReverse: GCTTCAGCACAAAGTGGCTAG	Yes	169
Gr (NM_053906.2)	Forward: GGGCAAAGAAGATTCCAGGTTReverse: GGACGGCTTCATCTTCAGTGA	No	101

Quantification of GSH and GSSG Levels in Lenses Using Liquid Chromatography–Tandem Mass Spectrometry

Liquid chromatography–tandem mass spectrometry (LC-MS/MS) was used to quantify GSH and GSSG from lenses collected at 0 hours (n = 8 lenses), 12 hours (n = 8 lenses), or 24 hours (n = 8 lenses) after culture for each lighting condition. Post-incubation, lenses were weighed, immediately homogenized in 10-mM EDTA, and centrifuged at 13,000 rpm at 4°C for 20 minutes, and the supernatant was collected and snap frozen for analysis. To measure GSH and GSSG levels, a calibration curve was first prepared with known concentrations ranging from 0 to 900 µM for GSH and 0 to 150 µM for GSSG. Lens samples were diluted by a factor of three to ensure that GSH levels were within the calibration curve range. Calibration curve standards and lens samples were immediately added to 5-mM monobromobimane (mBBr) to derivatize GSH thiols. As a secondary internal control of stable isotopically labeled (SIL) GSH (¹³C₂, ¹⁵N) and GSSG (¹³C₂, ¹⁵N) were also prepared simultaneously and added to the mBBr to derivatize SIL–GSH. The secondary internal control was then added to each calibration curve standard and lens sample. These mixtures were then passed through a Strata-X-C solid-phase extraction cartridges (Phenomenex, Torrance, CA, USA) which had been previously conditioned with methanol and 0.1% formic acid. Samples were then eluted with 5% NH₄OH from the cartridges, vacuum concentrated, and reconstituted with a mixture of 5% acetonitrile, 0.1% heptafluorobutyric acid (HFBA) in H₂O. For each calibration standard and sample, LC separations were performed by injecting 10 µL through a Synergi Hydro-RP C18 4-µm 150 × 2-mm column (Phenomenex) attached to a 0.2-µm inline filter (Phenomenex). The flow rate was constant at 0.4 µL/min with the set-up in gradient mode using mobile phase A made up of 0.1% HFBA in H₂O and mobile phase B made up in 80% ACN, 0.1% HFBA, and 20% H₂O. The retention time of GSH–mBBr and SIL–GSH–mBBr was 4.87 minutes; for GSSG and SIL–GSSG, it was 4.66 minutes. Samples and standards were then directed into a 6460A Triple Quadrupole mass spectrometer (Agilent Technologies, Santa Clara, CA, USA) with parameters previously described for GSH–mBBr, SIL–GSH–mBBr, GSSG, and SIL–GSSG.²⁴ The results were then analyzed using Agilent MassHunter software with the calibration curves of known concentrations. Lens dilutions were accounted for in the final concentrations.

Immunohistochemistry

Eyes were dissected at 10 AM, 2 PM, 6 PM, or 10 PM. Lenses were collected (n = 4 lenses for each time point), fixed in 0.75% paraformaldehyde, cryoprotected, and cryosectioned in an axial orientation using standard protocols developed in our laboratory.²⁵ Sections were incubated in blocking solution (3% w/v bovine serum albumin and 3% v/v normal goat/donkey serum) for 1 hour and labeled with melanopsin antibodies (1:200) diluted in blocking solution and then goat anti-rabbit Alexa Fluor 488 (1:100) for 2 hours. To highlight cell morphology, cell membranes were labeled with Wheat Germ Agglutinin (WGA) Alexa Fluor 594 (1:50) in PBS, and, to highlight epithelial and fiber cell nuclei, sections were stained with DAPI (1:10,000). Sections were then washed and mounted with VECTASHIELD HardSet aqueous mount (Vector Laboratories, Burlingame, CA, USA) and viewed using an FV1000 confocal laser scanning microscope (Olympus Corporation, Tokyo, Japan). To facilitate comparisons among datasets, the same pinhole size and gain were used. Specific emission filter sets were used to detect signals from Alexa Fluor 488, WGA Alexa Fluor 594, and DAPI fluorophores.

Retinal sections were used as a positive control for melanopsin staining. The anterior eye tissues (cornea, iris, and lens) were removed, and the posterior eye cups were fixed in 4% paraformaldehyde (PFA) for 30 minutes at room temperature, cryoprotected, and then cryosectioned. Retinal sections were incubated in blocking buffer containing 6% normal goat serum (NGS), 1% bovine serum albumin (BSA), and 0.5% Triton X-100 in 1× PBS for 1 hour at room temperature. Sections were then labeled with melanopsin antibodies and DAPI as described above and imaged using a confocal microscope.

Statistical Analysis

All numerical values and graphs are displayed as mean ± standard error of the mean (SEM) unless otherwise stated. A Mann–Whitney U test was conducted to determine statistical significance for qPCR analysis of each target gene and GSH/GSSG levels in the lenses. Statistically significant P values were displayed as *P < 0.05, **P < 0.01, ***P < 0.001, or ****P < 0.0001.

Results

Differences in the Expression of the Positive Arm Clock Gene Bmal1 Under Light/Dark Conditions Compared to Dark/Dark Conditions

Lenses were cultured in either 12-hour light/12-hour dark conditions or 12-hour dark/12-hour dark conditions (i.e., constant darkness) for 24 hours. Following the collection of lenses at 0 hours (reference point for normalization), 12 hours, or 24 hours post-culture, RNA extraction and qPCR was performed. The data are expressed as relative expression, which was calculated using the internal control (β-actin) and then the values were normalized so that the expression at the 0-hour time point was assigned as 1.0.

The relative expression of the clock core component genes associated with the positive arm of the circadian clock, including Bmal1 and Clock, was first investigated (Fig. 2). Under 12-hour light/12-hour dark conditions, Bmal1 expression changed between the light period (6 AM–6 PM) and the dark period (6 PM–6 AM), with Bmal1 expression being significantly decreased during the dark relative to the light period (P = 0.0205) (Fig. 2A). To determine if the time-of-day difference in Bmal1 expression was maintained in the absence of light, lenses were cultured under constant darkness. Here, it was revealed that Bmal1 expression did not significantly change over the 24-hour culture period (Fig. 2B), suggesting that light may be an important cue for driving time-of-day differences in Bmal1 expression.

Figure 2.

Relative expression of Bmal1 and Clock in rat lenses cultured under 12-hour light/12-hour dark condition or constant darkness over a 24-hour period. Lenses were incubated under either a 12-hour light/12-hour dark cycle or 24-hour dark cycle at 37°C. Lenses were collected at 6 AM (0 hours of culture), 6 PM (12 hours of culture), and 6 AM the next day (24 hours of culture). Each vertical bar and vertical line represents the mean ± SEM (n = 8 lenses for each time point for each lighting condition). The period with lights on is represented by the white horizontal bar, and the period with lights off is represented by the black horizontal bar. In light/dark conditions, lights were on from 6 AM to 6 PM and lights were off from 6 PM to 6 AM. In the dark/dark conditions, lights were off at all times. The relative expression of genes was calculated using the internal control (β-actin). The values were normalized so that the expression at the 0-hour time point was assigned as 1.0. A relative expression of 1.0 indicates no change observed relative to the 0-hour time point, relative expression below 1 indicates a reduction in relative gene expression, and relative expression changes greater than 1 indicates an increase in relative gene expression. (A & C) Bmal1 & Clock expression under light/dark conditions. (B & D) Bmal1 & Clock expression under dark/dark conditions. Significant differences are indicated by *P < 0.05.

Under 12-hour light/12-hour dark conditions, Clock expression did not significantly change between the light period (6 AM–6 PM) and the dark period (6 PM–6 AM) (Fig. 2C). Under constant darkness, Clock expression was not significantly different 12 hours versus 24 hours post-culture (Fig. 2D). However, Clock expression 12 hours and 24 hours post-culture was significantly increased relative to the 0-hour time point (indicated by the dotted line in the figure) (Supplementary Table S1), which suggests that Clock expression may have shown signs of dysregulation under constant dark conditions.

Differences in Expression of Negative Arm Clock Component Genes Cry2 and Per2 Under Light/Dark Conditions Compared to Dark/Dark Conditions

The clock core component genes associated with the negative arm of the circadian clock, Cry1, Cry2, and Per1 to Per3 (Fig. 3), were next investigated for time-of-day differences in expression under light/dark and dark/dark conditions. Under 12-hour light/12-hour dark conditions, none of the negative arm components showed changes in their expression between the light period (6 AM–6 PM) and the dark period (6 PM–6 AM), except for Cry2 (Fig. 3C) and Per2 (Fig. 3G). Cry2 expression changed between the light period and dark period with expression significantly increased under dark conditions relative to light conditions (P = 0.0499) (Fig. 3C), the opposite observed for Bmal1 expression (Fig. 2A). Under constant darkness, Cry2 expression did not significantly change over the 24-hour culture period (Fig. 3D). Under 12-hour light/12-hour dark conditions, Per2 expression also changed between the light period and dark period, with expression significantly increased under dark conditions relative to light conditions (P < 0.0001) (Fig. 3G). Under constant darkness, Per2 expression remained unchanged over the 24-hour culture period (Fig. 3H). This indicates that Cry2 and Per2, the negative arms of the clock, exhibit higher expression during the night relative to day, the opposite expression observed for Bmal1, the positive arm of the clock. It also appears that light is an important cue for Cry2 and Per2, as in constant darkness the time-of-day differences in expression pattern for these clock genes was not maintained.

Figure 3.

Relative expression of Cry1 and Cry2 and Per1 to Per3 in rat lenses cultured under 12-hour light/12-hour dark conditions or constant darkness over a 24-hour period. Lenses were incubated under either a 12-hour light/12-hour dark cycle or 24-hour dark cycle at 37°C. Lenses were collected at 6 AM (0 hours of culture), 6 PM (12 hours of culture), and 6 AM the next day (24 hours of culture). Each vertical bar and vertical line represents the mean ± SEM (n = 8 lenses for each time point for each lighting condition). The period with lights on is represented by the white horizontal bar, and the period with lights off is represented by the black horizontal bar. In the light/dark conditions, lights were on from 6 AM to 6 PM and lights were off from 6 PM to 6 AM. In the dark/dark conditions, lights were off at all times. The relative expression of genes was calculated using the internal control (β-actin). The values were normalized so that the expression at the 0-hour time point was assigned as 1.0. (A, C, E, G, I) Cry1, 2 & Per1–3 expression under light/dark conditions. (B, D, F, H, J) Cry1, 2 and Per1–3 expression under dark/dark conditions. Significant differences are indicated by *P < 0.05, ****P < 0.0001.

Differences in the Expression of Nrf2 and GSH-Related Genes Under Light/Dark Conditions Compared to Dark/Dark Conditions

Having revealed time-of-day differences in the expression of certain clock genes, we next investigated the expression of Nrf2 and GSH-related genes linked to GSH synthesis (Gclc, Gclm, Gs) and GSH regeneration (Gr) (Fig. 4). Under 12-hour light/12-hour dark conditions, Nrf2 expression changed between the light and the dark period, with Nrf2 expression significantly decreased during the dark period relative to the light period (P < 0.0001) (Fig. 4A). Under constant darkness, Nrf2 expression appeared to increase over time, but this was not significant, suggesting that time-of-day differences in Nrf2 expression were unable to be maintained in the absence of light (Fig. 4B). It should be noted that Nrf2 at 12 hours and 24 hours post-culture was significantly increased relative to the 0-hour time point (indicated by the dotted line in the figure) (Supplementary Table S1), which suggests that Nrf2 expression may be showing signs of dysregulation under constant dark conditions.

Figure 4.

Relative expression of Nrf2 and GSH-related genes in rat lenses cultured under 12-hour light/12-hour dark conditions or constant darkness over a 24-hour period. Lenses were incubated under either a 12-hour light/12-hour dark cycle or 24-hour dark cycle at 37°C. Lenses were collected at 6 AM (0 hours of culture), 6 PM (12 hours of culture), and 6 AM (24 hours of culture). Each vertical bar and vertical line represents the mean ± SEM (n = 8 lenses for each time point for each lighting condition). The period with lights on is represented by the white horizontal bar, and the period with lights off is represented by the black horizontal bar. In the light/dark conditions, lights were on from 6 AM to 6 PM and lights were off from 6 PM to 6 AM. In the dark/dark conditions, lights were off at all times. The relative expression of genes was calculated using the internal control (β-actin). The values were normalized so that the expression at the 0-hour time point was assigned as 1.0. (A, C, E, G, I) Nrf2, Gclc, Gclm, Gs and Gr expression under light/dark conditions. (B, D, F, H, J) Nrf2, Gclc, Gclm, Gs and Gr expression under dark/dark conditions. Significant differences are indicated by *P < 0.05, **P < 0.01, ****P < 0.0001.

Gclc and Gclm are both genes involved in the first step of GSH synthesis, and their expression has also been shown to be regulated by Nrf2.^26–29 Under 12-hour light/12-hour dark conditions, both Gclc and Gclm showed differences in their expression between the light and dark periods, with Gclc (P = 0.0104) (Fig. 4C) and Gclm (P = 0.003) (Fig. 4E) being significantly decreased in the dark period relative to the light period. Under constant darkness, Gclc showed no differences in its expression between the 12-hour versus 24-hour culture periods (Fig. 5D). However, Gclm expression significantly decreased between the 12-hour and 24-hour cultures (P = 0.0413) (Fig. 4F), similar to what was seen under light/dark conditions (Fig. 4E) and suggesting that light may not be an important determinant in Gclm expression. Gs is involved in the second step of GSH synthesis, and under light/dark conditions Gs expression was significantly decreased in the dark period relative to the light period (P = 0.0148) (Fig. 4G); however, under constant darkness, Gs expression remained constant between 12 hours and 24 hours post-culture (Fig. 4H). GR, which is involved in the regeneration of GSH, showed no significant changes in expression under either lighting condition (Figs. 4I, 4J).

Figure 5.

Measurement of intracellular GSH and GSSG levels from rat lenses cultured under 12-hour light/12-hour dark conditions or constant darkness over a 24-hour period. Lenses were incubated under either a 12-hour light/12-hour dark cycle or 24-hour dark cycle at 37°C. Lenses were collected at 6 PM (12 hours of culture) and 6 AM the next day (24 hours of culture). Each vertical bar and vertical line represents the mean ± SEM (n = 8 lenses for each time point for each lighting condition). (A) GSH levels under 12-hour light/12-hour dark conditions. (B) GSH levels under constant darkness. (C) GSSG levels under 12-hour light/12-hour dark conditions. (D) GSSG levels under constant darkness.

These results indicate that Nrf2 and genes involved in GSH synthesis, but not regeneration, exhibit time-of-day differences in their expression pattern, with expression highest during the day relative to the night. Similar to the core clock genes, light appears to act as an important cue to regulate this time-of-day expression pattern.

Intracellular GSH Levels Remain Constant Under Light/Dark Conditions and Dark/Dark Conditions

Given that there appears to be time-of-day differences in the expression of certain clock genes, Nrf2 and GSH synthesis enzymes, we next investigated whether this resulted in changes in intracellular GSH levels under different lighting conditions (Fig. 5). Lenses were cultured across a 24-hour period in either 12-hour light/12-hour dark conditions or in constant darkness for 24 hours. Lenses were collected after 12 hours or 24 hours of culture, and reduced GSH (Figs. 5A, 5B) and GSSG (Figs. 5C, 5D) levels were measured using LC-MS/MS.

Intracellular GSH levels did not appreciably change for 12-hour light/12-hour dark conditions (Fig. 5A) or constant darkness (Fig. 5B), with GSH concentrations being maintained around 2 to 2.3mmol/g for both lighting conditions. Intracellular GSSG levels also did not change under 12-hour light/12-hour dark conditions (Fig. 5C) or constant darkness (Fig. 5D). As expected, GSSG levels were much lower than GSH levels (∼100-fold lower), with GSSG levels being maintained around 0.017 to 0.024 mmol/g for both lighting conditions.

Taken together, it appears that, whereas genes involved in GSH synthesis exhibited time-of-day differences in their expression, GSH (and GSSG) levels in the lens did not change appreciably over the course of 24 hours. Moreover, GSH and GSSG levels were maintained in the absence of light, indicating that, at least over this time period, the lens can still maintain its GSH levels.

Rat Lenses Express Melanopsin in Epithelial Cells Positioned in the Direct Pathway of Light

Given that light does appear to influence the expression of clock and redox genes in cultured lenses, we next determined whether rat lenses have the capability for detecting light directly through the expression of the light-sensing protein melanopsin. First, we tested the specificity of the melanopsin antibody by using retinal sections as a positive control for melanopsin staining (Supplementary Fig. S2). We showed that melanopsin-positive cells were labeled in the ganglion cell layer (GCL), consistent with the location of known intrinsically photosensitive retinal ganglion cells (Supplementary Fig. S2A). Higher magnification images confirmed expected morphology through staining of the soma and dendrites (Supplementary Fig. S2B), validating that the antibody correctly labeled melanopsin-expressing cells. Next, we collected rat lenses at 10 AM and fixed and cryosectioned them in an axial orientation. Sections were then labeled with WGA to highlight the structures of the lens and DAPI to highlight the nuclei and melanopsin antibodies. A series of lens images were captured extending from the anterior pole of the lens (Fig. 6A) to the lens equator (Fig. 6D) and were tiled together to create an image montage (Fig. 6, left panel) revealing that melanopsin was expressed in the epithelium only and not in the lens fiber cells. Moreover, high-magnification images revealed differential localization of melanopsin to the epithelium, with labeling detected only in the central epithelium (Fig. 6A) and peripheral epithelium (Fig. 6B) but not in the germinative zone (Fig. 6C) or equatorial region (Fig. 6D).

Figure 6.

Melanopsin expression in the rat lens. Lenses were fixed in PFA, cryoprotected, and then sectioned in an axial orientation. Sections were stained with WGA (red), DAPI (blue), and melanopsin antibodies (green) and then viewed under a confocal microscope. (A–D) Representative image of an overview of an axial section from a rat lens taken from the anterior pole of the lens (A) and extending through to the lens equator (D). Boxes highlight areas from which high magnification shots were captured. (A’, A”) Melanopsin labeling at the anterior pole. (B’, B’’) Melanopsin labeling at the peripheral epithelium. (C’, C’’) Melanopsin labeling at the germinative zone. (D’, D’’) Melanopsin labeling at the lens equator. (A’–D’) Labeling with WGA, DAPI, and melanopsin antibodies. (A’’–C’’). Labeling with melanopsin antibodies alone.

Although the labeling of melanopsin was apparent only in the central epithelium, it is possible that melanopsin expression might change at different times of the day. To test this, lenses were not subjected to different lighting conditions during culture; instead, they were collected at four time points (10 AM, 2 PM, 6 PM, and 10 PM) to examine potential changes in melanopsin localization between daytime (10 AM and 2 PM) and nighttime (6 PM and 10 PM) periods (Fig. 7). For each time point, melanopsin in the central epithelium was always expressed and localized to the membrane (Figs. 7A–D, Figs. 7A’–D’), but melanopsin expression was undetectable at the equatorial epithelium (Figs. 7E–H, Figs. 7E’–H’), indicating that the localization of melanopsin does not change at different times of the day.

Figure 7.

Melanopsin expression in the rat lens epithelium at different times of the day. Lenses were collected at four different time points (n = 4 lenses for each time point), fixed in PFA, cryoprotected, and then sectioned in an axial orientation. Sections were stained with WGA (red), DAPI (blue), and melanopsin antibodies (green) and then viewed under a confocal microscope focusing on the central epithelium (A–D, A’–D’) or lens equator (E–H, E’–H’). (A–D) Labeling with WGA, DAPI, and melanopsin antibodies at the central epithelium. (A’–D’) Labeling with melanopsin antibodies alone at the central epithelium. (E–H) Labeling with WGA, DAPI, and melanopsin antibodies at the lens equator. (E’–H’) Labeling with melanopsin antibodies alone at the lens equator.

Discussion

Light is the most important synchronizer of the central circadian clock, but most peripheral clocks are not directly light sensitive but instead appear to entrain to environmental rhythms (e.g., rhythms in food intake) that are of critical importance for their own function. Given that the main function of the lens is to conduct light, it is relevant to determine whether the clock in the lens is an example of a peripheral clock that is directly light sensitive.

To test this, we first investigated the role light may play in regulating in vitro expression of core clock genes. We showed time-of-day differences in Bmal1 expression (Fig. 2A), a finding that was consistent with our previous in vivo study in which BMAL1 proteins levels were shown to peak during the day relative to night.¹² We also showed that Clock expression did not change (Fig. 2C), which was also consistent with what was previously reported in vivo in the lens¹² and similar to other studies that have demonstrated that CLOCK expression is stable during the 24-hour cycle and is constitutively expressed in the mouse SCN.³⁰ Although not evident among all Cry and Per isoforms, Cry2 and Per2 were shown to exhibit time-of-day differences in their expression during the light versus dark periods with lower expression during the day period and higher expression during the dark period (Figs. 3C, 3G). This is the opposite expression pattern seen for Bmal1 but consistent with the anti-phase rhythm of genes that form the positive versus the negative arm of the circadian clock.³¹ Although we did not observe that all Cry and Per isoforms exhibited differences in their expression under light versus dark lighting conditions, it must be remembered that we only were able to measure clock gene expression at three time points 12 hours apart. As a result, we might not have expected to see differences in the expression of every clock gene but rather just the genes that happened to be at quite different phases of their cycle at the time points assessed.

Comparing clock gene expression under light/dark conditions and constant darkness revealed a disruption in the rhythmic pattern under the latter (Fig. 2A vs. Fig. 2B; Fig. 3C vs. Fig. 3D; Fig. 3G vs. Fig. 3H). Peripheral clocks are generally expected to continue oscillating in the absence of a zeitgeber, but we observed no significant rhythmicity in clock gene expression under constant darkness. This may suggest that the lens clock is no longer cycling under these conditions. However, we interpret this with caution. It is possible that individual fiber or epithelial cells within the lens retain their circadian rhythms, but become desynchronized in the absence of light, resulting in an apparent loss of rhythmicity at the whole-lens level. This is consistent with findings in other peripheral tissues, where clocks rapidly desynchronize without external cues.³² At present, we cannot definitively conclude that the lens functions as an autonomous peripheral clock independent of input from the SCN and retina. However, our findings clearly indicate that clock gene expression in the lens is responsive to light.

Having shown that light appears to influence the regulation of clock genes, we next investigated the effects of light on Nrf2 and GSH redox genes. Under 12-hour light/12-hour dark conditions, the expression of Nrf2, Gclc, and Gs was higher during the day than at night, but under constant darkness there was no change in their expression patterns (Figs. 4A, 4C, 4G). Nrf2 can be activated due to oxidative stress³³ and changes in nutrient availability,³⁴ but it has been shown to be regulated by BMAL1.⁴ Nrf2 can regulate Gclc and Gs^27,29 by binding to the antioxidant response element in their promoter regions; however, at this stage, we cannot tell whether the expression of these GSH synthesis enzymes is due directly or indirectly (via Nrf2) to a circadian cloc, or a non-circadian pathway triggered by light exposure. Gclm and Gr were both interesting as while they are also regulated by Nrf,^26,29 Gclm exhibited time-of-day differences in expression under light/dark conditions that were retained under constant darkness (Figs. 4E, 4F), which is often a feature of circadian-regulated genes. To our knowledge, Gclm is not known to be under direct circadian control, but because it is regulated by Nrf2 it could be regulated by the clock, indirectly explaining why time-of-day differences in Gclm expression were still evident under constant darkness. Finally, Gr showed no differences in its expression under light/dark conditions or under constant darkness (Figs. 4I, 4J), suggesting that GSH regeneration in the lens may not involve a circadian pathway and/or be triggered by light exposure. Regardless of whether the mechanism is circadian or not though, the finding that Nrf2, Gclc, Gclm, and Gs all displayed time-of-day differences with mRNA expression higher during the day is interesting and suggests that Nrf2 and GSH synthesis pathways are light regulated.

The discovery of melanopsin in the human lens¹⁷ suggests that the lens may be able to detect light itself via melanopsin to drive its own circadian rhythms and in turn regulate GSH levels. In this study, we showed that melanopsin expression was restricted to the membranes of epithelial cells in the anterior region of the lens but absent from epithelial cells at the lens equator and fiber cells (Fig. 6). This localized pattern was consistent during the day and night (Fig. 7), suggesting that melanopsin is primed to be able to respond to light at all times and to elicit a phototransduction signaling cascade, which in the retina involves stimulation of phospholipase C beta, the activation of transient receptor potential (TRP) cation channels, the influx of Ca²⁺, and membrane depolarization.³⁵ Further work will involve delineation of these downstream signaling pathways to determine whether melanopsin is functionally active in the lens and whether it can be used to drive clock and/or redox components in the lens to maintain GSH levels. In human lens epithelial cells, activation of lens melanopsin with blue light resulted in reduced melatonin levels compared to dark conditions,¹⁷ suggesting that lens melanopsin is functional and responsible for the regulation of melatonin levels in the lens.¹⁷ Although melatonin is mostly considered a hormone that regulates night and day cycles or sleep/wake cycles, in the lens melatonin acts as an antioxidant,¹⁴ indicating that other antioxidants such as GSH could also be regulated in a similar manner.³⁶

We measured intracellular GSH levels in cultured lenses and found that the GSH-to-GSSG ratio remained high, similar to what we have previously shown in vivo,¹² confirming that the lens intracellular environment is predominantly maintained in a reduced state. However, we could not detect time-of-day differences in intracellular GSH levels (Fig. 5A), which was at odds with our previous in vivo studies but may not be all too surprising. Under in vivo conditions, lenses were collected and examined every 4 hours over a 24-hour period (i.e., six time points); GSH levels were shown to fluctuate during the course of the day and night, peaking at 6 AM and 6 PM.¹² However, in this in vitro study, the logistics of dissecting many lenses in a timely manner limited the amount of time points that could be acquired (i.e., three time points); by examining GSH levels across either a 12-hour or 24-hour window, we may have missed peaks and troughs observed in our in vivo study. On the other hand, our findings might suggest that the observed time-of-day variation in GSH-related gene expression may function to maintain stable GSH levels across the light/dark cycle. This temporal regulation could serve to keep the lens in a primed state, ready to respond efficiently to oxidative stressors at any time of day. It should also be mentioned that, although we found time-of-day differences in the gene expression of enzymes involved in GSH synthesis, further work is required to ascertain whether these correlate to changes in the activity of these enzymes. Moreover, we should be cognizant of the fact that, while GSH synthesis pathways will influence intracellular levels, so, too, will GSH uptake pathways. It was noticed from our in vivo study that GSH levels in the aqueous humor decreased at night, suggesting that GSH uptake by the lens might be under circadian control, although GSH uptake transporters have yet to be identified in the lens.²⁵ Finally, it should be emphasized that GSH levels were measured from young rat lenses, and perhaps detectable GSH oscillations may occur when young lenses are exposed to oxidative stress and/or older lenses are examined. This would help to determine whether changes in the expression of genes related to GSH synthesis and uptake are able to directly influence GSH levels in the lens.

In conclusion, this study demonstrated that the rat lens expresses the light-sensing protein melanopsin and responds to light/dark cycles by modulating the expression of clock genes and redox-related genes involved in GSH synthesis. However, the direct relationship between changes in gene expression and intracellular GSH levels remains unclear and warrants further investigation. Future studies are needed to elucidate the functional link among lens melanopsin, the circadian clock, and GSH homeostasis, as well as to explore how lens-derived signals may interact with those from the retina and the SCN. Furthermore, given that both antioxidant capacity^6,32 and circadian rhythm regulation³³ decline with age, investigating GSH regulation in older rats may provide valuable insights into strategies for enhancing antioxidant defenses in the lens and potentially preventing age-related cataract formation.