Skip to main content
NCBI home page
Journal of Cancer Research and Clinical Oncology logoLink to Journal of Cancer Research and Clinical Oncology
. 2009 Jun 2;135(11):1543–1550. doi: 10.1007/s00432-009-0601-9

Involvement of Akt1/protein kinase Bα in tumor conditioned medium-induced endothelial cell migration and survival in vitro

Ming Li Tu 1, Han Qin Wang 2,3,✉, Long Ju Chen 2,3, Jin Chang Lu 1, Fei Jiang 1, Jiang Hong Liang 4, Da Guo Xu 2, Dong Sheng Li 2
PMCID: PMC12160271  PMID: 19488783

Abstract

Purpose

Endothelial cell migration and survival might be called “major angiogenic responses”. Tumor conditioned medium (CM) has been widely used to stimulate endothelial cells to form capillary-like structures in angiogenesis models in vitro. However, the molecular events triggered by tumor CM are not fully understood. Here, we examined the effects of the CM from human lung carcinoma cell lines A549 and SPC-A-1 on cultures of primary human umbilical veins endothelial cells (HUVECs).

Methods

After treatment of HUVECs with the CM, cell migration was assessed by wound-healing assay, cell viability was evaluated by XTT assay, and apoptosis and cell death of HUVECs was analyzed by flow cytometry. Phosphorylation of Akt was assessed by Western blotting. To dissect the direct role of Akt, small interfering RNA (siRNA) against Akt1 was used.

Results

Both A549 and SPC-A-1 CM significantly stimulated cell migration. However, only A549 CM promoted cell viability and inhibited low serum-induced apoptosis and cell death of HUVECs, but SPC-A-1-CM showed no effects on survival of HUVECs. Meanwhile, A549 CM was found to be able to induce much more phosphorylation of Akt compared to SPC-A-1 CM treated group. The inhibitor of PI3K (wortmaninn) or Akt1 siRNA blocked A549 CM-induced migration and survival of HUVECs.

Conclusion

These results indicated that the angiogenic effects of A549 CM are largely mediated through activation of the PI3K-Akt in endothelial cells, and that the Akt1 is crucial in this process, which may provide a therapeutic target for decreasing tumor angiogenesis.

Keywords: Conditioned medium, Akt, Endothelial cell, Migration, A549

Introduction

Tumor angiogenesis is a complex process in which new blood vessels are formed in response to interaction between tumor cells and endothelial cells, growth factors, and extra cellular matrix components (Folkman 1995; Risau 1997; Carmeliet 2003). In vitro, the use of conditioned medium (CM) from tumor cells as an inducer to stimulate endothelial cells to form capillary-like structures is common in angiogenesis analysis (Kargiotis et al. 2008). The angiogenic response to CM begins with vascular leakage and the deposition of a provisional matrix consisting of blood-derived components; the activation of proteases eventually degrades the extracellular matrix, releasing endothelial cells, and the migration and proliferation of endothelium results in the formation of an initial capillary network. However, the mechanisms of CM-induced endothelial cell survival and migration, and the chemotactic signaling pathways involved in the process remain elusive.

Several important signaling pathways, including mitogen-activating protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) and phosphoinositol 3-kinase (PI3K)/Akt, have been found to be induced by angiogenic growth factors in endothelial cells (Shaulian and Karin 2002). Activation of these pathways can promote the migration, proliferation, differentiation, and survival of endothelial cells (Jung et al. 2002). Evidence supporting the role of PI3K-Akt in such pathways in endothelial cells includes blockade of PI3K with inhibitors and overexpression of dominant-negative constructs for Akt; however, there is little direct genetic evidence supporting a role of Akt in regulating angiogenesis by tumor CM.

Three members of the Akt family (Akt1, Akt2, and Akt3) have been identified and they are, in general, broadly expressed. Akt1 is vital for the regulation of vascular permeability, angiogenic responses and subsequent vascular maturation (Somanath et al. 2006). Akt1 affects several regulatory pathways of the vascularization response, including pro- as well as antiangiogenic components. Surprisingly, Akt1 and Akt2 are not essential for embryonic vasculogenesis since Akt1- and Akt2-deficient mice are viable (Cho et al. 2001; Chen et al. 2001). A recent study showed that chronic but not short-term overexpression of Akt1 in cardiac tissues suppresses angiogenesis (Shiojima et al. 2005). Chen et al. (2005) also found that the lack of Akt1 causes an enhancement of angiogenesis. Hence, to understand how various effects of Akt are reconciled in the regulation of endothelial cell functions, especially, the roles of individual Akt isoforms in angiogenic effects of tumor cells are required.

Lung cancer is a highly aggressive and challenging cancer that currently is the leading cause of cancer death throughout the world. Non-small cell lung cancer (NSCLC) accounts for about 75–80% of all lung cancer, and has a low 5-year survival rate (8–14%) (Shimada et al. 2007). The molecular mechanisms that control the development and progression in NSCLC cell line are not fully understood. A549 and SPC-A-1 are NSCLC cell line with the same origin but different metastatic potential (Huang et al. 2005). The experiments presented here were designed to examine the effect of A549 and SPC-A-1-derived CM on migration and apoptosis of endothelial cells. The results here demonstrated that both A549 and SPC-A-1 CM enhanced migration of endothelial cells. We further found that only A549 CM played an antiapoptotic role in cultured endothelial cells challenged by serum deprivation. Moreover, the results demonstrated that the effects were largely explained by activation of the PI3K-Akt pathway, and supporting a role of Akt1 in regulating CM-initiated endothelial cell functions. Importantly, we identified a novel mechanism of tumor angiogenesis mediated by the crosstalk between tumor cells and endothelial cells via the PI3K-Akt signaling pathways.

Materials and methods

Preparation of tumor conditioned medium (CM)

Human lung adenocarcinoma A549 cell line was purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). SPC-A-1 cell line was purchased from cell bank of Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China). Cells were cultured in DMEM/F12 (Gibco, Grand Island, NY, USA) supplement with 10% heat-inactivated fetal bovine serum (FBS, Gibco, Grand Island, NY, USA).

To prepare conditioned medium, A549 and SPC-A-1 cells were seeded in a 10 cm dish at a density of 2 × 105 cells/cm2 and incubated in 10%FBS/DMEM/F12 for 1–2 days to 70% confluence. Then the cells were washed 3 times with PBS, and the medium was changed to serum-free DMEM/F12 for 24 h. Subsequently, the cells continually were incubated in DMEM/F12 medium with 5% FBS for another 24 h to generate the conditioned medium. The medium was collected, filtered with 0.2 μm a filter, known as CM, and stored in −80°C.

Vascular endothelial cell culture

Endothelial cells were isolated from fresh human umbilical veins as previously described (Wang et al. 2006), and cultured in DMEM/F12 that supplemented with 20% heat-inactivated FBS, 100 mM HEPES (Sigma, Saint Louis), 100 U/mL penicillin, 100 μg/mL streptomycin, 2 mM glutamine, 4 ng/mL bFGF (Sigma) and 5 U/mL heparin (Sigma), referred to here as complete medium. Cells were assessed for endothelial cells phenotype by morphology, the typical monolayer cobblestone growth pattern, and expression of Von Willebrand factor antigen (DukoCytomation, Glostrup, Denmark). Cells between passages 2 and 4 were used in all experiments.

When human umbilical veins endothelial cells (HUVECs) reached confluence, growth factor was withdrawn from the complete medium,and the cells were made quiescent for overnight in a low serum (5%FBS). Cells were then treated with the indicated CM, and further cultured in 5%FBS served as control. In some experiments, the inhibitor wortmannin (100 nM) was added before the CM.

Wound-healing assay

The wound-healing assay was run as previously described (van Nieuw Amerongen et al. 2003; Oberringer et al. 2008). Briefly, 2 × 105 cells were seeded into six-well plates and incubated for 24–48 h to reach confluence, and then were made quiescent for overnight in a low serum (5%FBS). A scratch wound was made with a sterile 20 μL pipette tip, and the debris was removed by washing with serum-free medium. The cells were further cultured in fresh 5%FBS/DMEM/F12 or the indicated CM and photographed immediately (0 h). After 12 h of incubation, the migration of cells across the wound was evaluated by phase-contrast microscopy. The migrated distance of cells was calculated by measuring the distance from the wound edge to the maximally migrated cell in several distinct border zones. The percentage of closure was calculated as migratory distance from both sides versus the distance to the middle of the wound. The experiments were repeated thrice with similar results.

Cell viability assay

The effects of CM on HUVEC growth and survival were assessed by a 2,3-bis [2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide inner salt assay (XTT, Sigma). HUVECs were seeded (4 × 104 per well) in 24-well plates and incubated at 37°C, 5% CO2 for 24–48 h. The medium was then replaced by basal medium only with 5%FBS. After overnight starvation, cells were treated with the indicated CM or the fresh 5%FBS/DMEM/F12. Twenty-four hours later, the viable cells (a net result of both cell growth and cell death) from each condition were measured by XTT at UV 490 nm, as described by the manufacturer’s protocol. The UV readings of solvent-treated controls were normalized to 100%, and the readings from CM-treated cells were expressed as % controls.

Cell apoptosis assay

After the indicated treated, quantification of apoptosis was performed using two methodologies.

Nuclear staining with Hoechst 33258

The Hoechst 33258 (Sigma) reagent is taken up by the nuclei of the cells. In brief, HUVECs were washed with serum-free DMEM/F12 and then stained nuclei with 1 mL of serum-free DMEM/F12 containing 1 mg/mL Hoechst 33258 for 20 min at 37°C in the dark. Apoptotic cells with condensed and fragmented nuclei immediately were observed under a fluorescent microscope (Olympus IX70, Japan). The experiment was repeated 3 times independently.

Annexin-V-FITC labeling and fluorescence-activated cell sorting analysis (FACS)

For FACS analysis, cells were exposed to FITC-conjugated annexin V and the fluorescent dye propidium iodide (PI). Briefly, floating apoptotic cells were collected in phosphate buffered saline (PBS). Adherent cells were collected by trypsinization. All cells were stained with the annexin-V-fluos staining kit (Roche Molecular Biochemicals, Mannheim, Germany) for 15 min at 20°C. Following staining of annexin-V and propidium iodide (PI), the cells were analyzed by EPICS XL system II flow cytometry (Beckman Coulter, Epics, XL).

Western blot analysis

Cells lysates were harvested for Western blot as previously described (Wang et al. 2007). The protein concentrations were determined by the method of Bradford with BSA as a standard (Beckman Coulter, DU800, USA). Proteins (30 μg/lane) were immunoblotted with antibodies against phosphorylated Akt (Ser473) and total Akt (Cell Signaling Technology, Beverly, Mass, USA) and β-actin (Santa Cruz Biotechnology, Santa Cruz, CA, USA). After incubation with peroxidase or alkaline phosphatase-conjugated secondary antibodies (Jackson Immunoresearch, West Grove, PA, USA), the signals were detected by enhanced chemiluminescence (Santa Cruz Biotechnology, Santa Cruz, CA, USA) or nitroblue tetrazolium-bromochloroindolyl phosphate (Bio Basic, Mississauga, ON, Canada).

siRNA transfection

For mRNA ‘knock-down’ studies, a small interfering RNA specifically targeting Akt1 was constructed and chemically synthesized by GenePharma (Shanghai, China). The following short RNA oligonucleotids were used: GCACCUUCAUUGGCUACAATT (sense), UUGUAGCCAAUGAAGGUGCCA (anti-sense). The siRNA was evaluated for sequence specificity by a BLAST search and did not show homology to other known genes. HUVECs were transfected with a final concentration of 40 pM siRNA molecules using the oligofectamine reagent (Invitrogen, Carlsbad, CA, USA) for 5 h. According to the manufacturer’s instructions, siRNA transfection efficiency was observed by uptake of fluorescein conjugated scrambled siRNA sequence. The express siRNA against Akt1 was named as siAkt1. The scramble siRNA was named as siSCR.

Semi-quantitative RT-PCR

Total RNA was isolated from HUVECs with the agent of TRIzol(Invitrogen Life Technologies). The first strand cDNA synthesis was performed using the AmpliTaq RNA-PCR kit (Fermentas) in a 20 μL volume with the reverse primer for priming. Obtained cDNA were amplified using specific primers included: Akt1 forward, 5′-ATG AGC GAC GTG GCT ATT GTG AAG-3′; Akt1 reverse, 5′-GAG GCC GTC AGC CAC AGT CTG GAT G-3′; Akt2 forward, 5′-ATG AAT GAG GTG TCT GTC ATC AAA GAA GGC-3′; Akt2 reverse, 5′-TGC TTG AGG CTG TTG GCG ACC-3′. Cycling conditions were 26 cycles of denaturation, annealing, and extension for Akt1 and Akt2 (94°C for 60 s, 58°C for 60 s and 72°C for 30 s, respectively). The primers for β-actin (internal control) included 5′-ACG GAT TTG GTC GTA TTG GG-3′ (sense) and 5′-TGA TTT TGG AGG GAT CTC GC-3′ (antisense) that amplify a 230 bp fragment of β-actin cDNA. After pre-denaturation at 94°C for 5 min, PCR were performed for 22 cycles: denaturation at 94°C 60 s, followed by annealing for 30 s at 56°C and finally extension for 60 s at 72°C. Finally, PCR products were separated by a 2% agarose gel electrophoresis and visualized by ethidium bromide staining. Each experiment was done in triplicate.

Statistical analysis

All experiments were performed at least in triplicate and mean ± SD were determined. Statistical significance was assessed by ANOVA followed by an unpaired Student’s t test. P values of <0.01 and <0.05 were considered significant.

Results

A549 and SPC-A-1 CM enhance HUVEC migration

In angiogenesis, vascular endothelial cells migrate before new blood vessel formation. To study the effects of A549 and SPC-A-1 CM on endothelial cell migration, HUVECs were made quiescent by growth factor withdrawal and reduction of serum (5%) for overnight, and then cells were exposed to the indicated CM or cultured in the present of 5%FBS served as control. Next, the confluent monolayers of cells was wounded, and recovery of these monolayers depends on HUVEC migration (van Nieuw Amerongen et al. 2003). Cell migration was measured after 12 h, compared to the control, the A549 and SPC-A-1 CM treated-cells migrated much further. As shown in Fig. 1, the percentage of wound closure increased 170% in the A549 group, and increased 160% in the SPC-A-1 group compared to the control. We concluded that the CMs stimulated migration of HUVECs.

Fig. 1.

Fig. 1

Open in a new tab

Treatment with A549 and SPC-A-1 CM enhanced endothelial migration. a Confluent monolayer of HUVECs were wounded. Subsequently, the cells were stimulated by A549 and SPC-A-1 CM or treated with 5%FBS medium (Control). Photographs were taken respectively after wounding 0 h and 12 h (40×). b Graphic representation of wound closure was explained in the Materials and methods section. The wound closure following 12 h of control treatment was normalized to 100%, and the wound closure from A549 and SPC-A-1 CM-treated cells was adjusted to the % controls (*P < 0.05 vs. control)

Effects of A549 and SPC-A-1 CM on the viability of HUVECs

Stimulation of vascular endothelial cell growth and survival by tumor cell-derived angiogenic factors is essential for angiogenesis. Following 24 h of the CM-treatment, the morphology of HUVECs was observed with phase-contrast microscopy, and cell viability was determined by XTT assay. As shown in Fig. 2, the HUVECs shrank, became rounded, and the phase became bright in the control and SPC-A-1 CM treated groups. However, most of HUVECs showed normal morphology in the A549 CM treated group. We then investigated the effects of the indicated CM on the cell viability, as shown in Fig. 2, A549 CM showed an enhancement of cell viability compared with the control (148 ± 43%), but there was not significantly difference between SPC-A-1 CM group and control group.

Fig. 2.

Fig. 2

Open in a new tab

HUVEC viability was determined by XTT assay. a Cell morphology was observed in the control, A549 and SPC-A-1 CM, original magnification 40×. b Cell viability was determined by an XTT assay, the data shown were the percentages of the control values ± SD. (*P < 0.05 vs. control)

A549 CM inhibits apoptosis of HUVECs

Human umbilical veins endothelial cells underwent apoptosis in low serum condition. HUVECs also underwent apoptosis in SPC-A-1 CM, but the apoptosis and cell death of HUVECs were inhibited when cells were exposed to A549 CM (Fig. 3).

Fig. 3.

Fig. 3

Open in a new tab

A549 CM enhanced endothelial cell survival. HUVECs were exposed to 5%FBS medium (control) and incubated with A549 and SPC-A-1 CM for 24 h. a The cells were harvested and stained with Hoechst. Arrowheads indicated apoptotic cells with fragmented or condensed DNA by fluorescence microscopy (40×). b Representative dot plots of flow cytometric analyses. The cells were stained with annexin V and propidium iodide (PI) and were analyzed by flow cytometry. c Representative histogram of flow cytometric analyses. Bars represent the mean ± SD of three experiments. *P < 0.05 versus control

Akt is activated in HUVECs

To investigate the mechanism, HUVECs were made quiescent by growth factor withdrawal and reduction of serum (to 5%) for overnight before treatment with control, A549 and SPC-A-1 CM. As shown in Fig. 4a, b, the time-dependent changes of Akt phosphorylation under different conditions all peaked at 15–30 min, meanwhile, A549 CM was found to be able to induce much more phosphorylation of Akt.

Fig. 4.

Fig. 4

Open in a new tab

Akt activation in response to control, A549 and SPC-A-1 CM. a Quiescen HUVECs were stimulated with different CM for 15–60 min. Cell lysates were analyzed for Akt activation by Western blot analysis of total and Ser473-phosphorylated Akt (P-Akt) using specific antibodies. Unstimulated cells were parallel control (0 min). b Protein bands were quantified by densitometry, and P-Akt level was calculated for each time point, after normalization to Akt in same sample. Unstimulated basal expression was set as unity. *P < 0.05 and **P < 0.01 versus unstimulated cells (0 min). c Confluent monolayers of HUVECs were pretreated with wortmannin for 20 min, subsequently, the cells were stimulated with A549 CM or treated with vehicle for 30 min. Cell lysates were analyzed for Akt activation by Western blot analysis

Human umbilical veins endothelial cells revealed a more pronounced Akt activation in response to A549 CM, prior to treatment with A549 CM, cells were incubated with wortmannin, a specific PI3K inhibitor, for 20 min at dose of 100 nmol/L, the A549 CM induced-Akt phosphorylation was obviously inhibited (Fig. 4c). Consistently, the cell migration and viability were significantly decreased in the presence of wortmannin, and the percentage of apoptosis was significantly increased (Fig. 5).

Fig. 5.

Fig. 5

Open in a new tab

Wortmannin inhibited A549 CM-induced migration and survival of HUVECs. Cells were incubated with control buffer (5%FBS medium + DMSO), A549 CM plus DMSO, or A549 CM plus wortmannin (WT; 100 nmol/L). a Wound-healing assay. Quantification of the endothelial wound repair was done. b XTT assay. The number of viable cells was determined by XTT assay. c Flow cytometry. The apoptotic rates of HUVECs were evaluated by flow cytometry. Bars represent the mean ± SD of three experiments. *P < 0.05 versus control. # P < 0.05 versus A549 CM + DMSO

siRNA against Akt1 block A549 CM-induced migration and survival of HUVECs

Akt is a major downstream target of PI3K. We showed that activation of Akt in HUVECs was inhibited by wortmannin (Fig. 4c). Recent studies showed that absence of Akt1 in vascular endothelial cells resulted in a nearly 70% reduction in basal Akt activity (Chen et al. 2005). Therefore, we generated siRNA specific to Akt1 to examine the role of Akt1 in migration and apoptosis of HUVECs. By using a validated Akt1 siRNA target sequence, RT-PCR results showed that we were able to knock down Akt1 mRNA level expression in HUVECs by 80%, and Akt2 mRNA level was unchanged. Nonsilencing siSCR had no effect on Akt1 expression (Fig. 6a). Furthermore, Western Blot results indicated that HUVECs transfected with Akt1 siRNA showed a marked reduction of Akt protein expression levels compared to control cells (Fig. 6b).

Fig. 6.

Fig. 6

Open in a new tab

Effects of siRNA-mediated Akt1 knockdown on endothelial cell migration and apoptosis. HUVECs were transfected with the indicated concentrations of siRNA targeted against Akt1 (siAkt1) or a random sequence (siSCR). 48 h after transfection, cells were harvested. a RT-PCR analysis showed a reduction of mRNA level of Akt1. Cycling conditions: 26 cycles for Akt1 and Akt2, 22 cycles for β-actin. A single graph from triplicate determinations showing identical results was shown. b Protein levels were analyzed by Western Blot with anti-Akt antibody or β-actin antibody. A single graph from three independent experiments was shown. HUVECs were transfected with 30 nM siRNA targeting Akt1 (siAkt1) or a nonsilencing siSCR for 24 h and then low serum (5%)- and growth factor-starved for 12 h. The siAkt1- or siSCR-transfected cells were exposed to A549 CM. c Quantification of the endothelial wound repair was assessed by wound-healing assay. d The number of viable cells was determined by XTT assay. e Apoptotic cells were assessed by FACS analysis. Results were shown for percentage of unstimulated control siRNA-transfected cells

Next, we performed wound-healing assay of HUVECs transfected with Akt1 and control siRNA, as illustrated in Fig. 6c, cells transfected with Akt1-specific siRNA displayed a much slower A549 CM-mediated wound-healing rate compared to control cells. Also, cell viability was determined by XTT assay and cell apoptosis was examined by FCAS. As shown in Fig. 6d, e, Akt1 knockdown using siRNA, the number of viable cells significantly decreased, and the percentage of apoptosis cells was significantly increased. The results demonstrated that down-regulation of Akt1 expression was sufficient to impair A549 CM-mediated migration and survival of HUVECs.

Discussion

The formation of a vasculature by vasculogenesis and angiogenesis is essential for embryonic development (Mazure et al. 1997), tissue remodeling in adults and the unrestrained growth of tumors (Gerber et al. 1998). Our studies here demonstrated that tumor CM from A549 cells could inhibit apoptosis, increase viability and enhance migration of HUVECs. Also, we provided the direct evidence that A549 CM-induced changes in endothelial cells were Akt1 dependent.

Crosstalk between tumor cells and endothelial cells promotes tumor angiogenesis (Jung et al. 2002; Warner et al. 2008; Zeng et al. 2005). In vivo, the initiation of tumor angiogenesis depends on a delicate balance between angiogenic and anti-angiogenic factors. A549 and SPC-A-1 cells are human lung adenocarcinoma cell lines with the same origin but different metastatic potential (Huang et al. 2005). In the present study, we found that A549 CM and SPC-A-1 CM had a different effects on HUVECs. A549 CM could stimulate migration, inhibit apoptosis, and increase viability of endothelial cells, all of which are critical steps for angiogenesis. It is consistent with the high invasive ability of A549 cells. Contrary to our data, Ye and Yuan (2007), have reported that A549 CM decreased the viability of HUVECs and induced cell apopotosis in their study, in which A549 CM was prepared by incubating A549 cells in serum-free MEM for 72 h. By comparison, our A549 CM was generated by incubating starved A549 cells in 5% serum medium for 24 h, suggesting that treatment A549 cells with serum starvation and a low serum recovery maybe induce angiogenic factors secrete. The discrepancies are thought to be caused by difference in the preparation of tumor CM; and the CM-initiated endothelial cell function depends on a delicate balance between angiogenic and anti-angiogenic factors.

We further investigated the underlying molecular mechanisms by examining the effects of A549 CM on diverse signaling pathways related to migration and apoptosis. Of interest to us was a lot of evidence supporting a role for PI3K in promoting cell migration through receptor tyrosine kinases. The present study we found that A549, SPC-A-1 and control CM could induce a time-dependent manner of Akt phosphorylation in HUVECs, which was occurred as early as 15 min and gradually downregulated after 30 min. It was showed a short-time activation of Akt in HUVECs by the different CM. Comparing to the P-Akt level, A549 CM was found to induce much more phosphorylation of Akt. Therefore, the level of PI3K-mediated Akt phosphorylation and the efficacy of A549 CM-induced endothelial cell migration and survival were further observed. To block PI3K activity, we used specific PI3K inhibitor, wortmannin, which significantly inhibited A549 CM-stimulated cell migration and survival, as illustrated by the abolishment of Akt phosphorylation. The results indicate that Akt phosphorylation in HUVEC migration and survival is wortmannin-sensitive. It is necessary for us to further examine the potential link between HUVECs cultured with A549 CM and Akt, a major downstream effector of PI3K.

The Akt pathway might regulate angiogenic responses by several distinct and possibly counterbalancing mechanisms (Dummler and Hemmings 2007). Using endothelial cells isolated from Akt1−/− mice, a recent study showed that Akt1 accounted for approximately 70% of the total Akt activity (Chen et al. 2005). We raise the question of which effects of Akt1 will determine the course of the tumor angiogenic response. To address this question, we designed a siRNA targeted to the human Akt1 mRNA to selectively “knockdown” the expression of Akt1 in HUVECs. We decided to use siRNA rather than plasmid-based RNA interference techniques because preliminary experiments (and our past experience) showed that plasmid based methods had an unacceptably low transfection efficiency in endothelial cells. After optimizing conditions for siRNA transfection, we assayed the ability of this Akt1-specific siRNA silencing Akt1 expression by transfecting HUVECs. Also, the lack of Akt1 significantly decreased A549 CM-initiated migration and survival of HUVECs. These results show that PI3K signaling can transmit through Akt1, and Akt1 activation is required for A549 CM-induced endothelial cell activity.

In summary, our study provided the data supporting a role of Akt1 in regulating A549 CM-dependent prosurvival signaling in endothelial cells and had broad implications for understanding the physiology and importance of Akt. The results suggested that inhibition of Akt1 signaling may be an effective strategy to block not only tumor growth but also pathological angiogenesis mediated by tumor CM.

Acknowledgments

This research was supported by grants from the National Natural Science Foundation of China, No. 30770535.

Conflict of interest statement

None.

Footnotes

M. L. Tu and H. Q. Wang contributed equally to this work.

References

  1. Carmeliet P (2003) Angiogenesis in health and disease. Nat Med 9:653–660. doi:10.1038/nm0603-653 [DOI] [PubMed] [Google Scholar]
  2. Chen WS, Xu PZ, Gottlob K, Chen ML, Sokol K, Shiyanova T, Roninson I, Weng W, Suzuki R, Tobe K et al (2001) Growth retardation and increased apoptosis in mice with homozygous disruption of the Akt1 gene. Genes Dev 15:2203–2208. doi:10.1101/gad.913901 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chen J, Somanath PR, Razorenova O, Chen WS, Hay N, Bornstein P, Byzova TV (2005) Akt1 regulates pathological angiogenesis, vascular maturation and permeability in vivo. Nat Med 11:1188–1196. doi:10.1038/nm1307 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cho H, Thorvaldsen JL, Chu Q, Feng F, Birnbaum MJ (2001) Akt1/PKBalpha is required for normal growth but dispensable for maintenance of glucose homeostasis in mice. J Biol Chem 276:38349–38352. doi:10.1074/jbc.C100462200 [DOI] [PubMed] [Google Scholar]
  5. Dummler B, Hemmings BA (2007) Physiological roles of PKB/Akt isoforms in development and disease. Biochem Soc Trans 35:231–235. doi:10.1042/BST0350231 [DOI] [PubMed] [Google Scholar]
  6. Folkman J (1995) Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat Med 1:27–31. doi:10.1038/nm0195-27 [DOI] [PubMed] [Google Scholar]
  7. Gerber HP, McMurtrey A, Kowalski J, Yan M, Keyt BA, Dixit V, Ferrara N (1998) Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3′-kinase/Akt signal transduction pathway. Requirement for Flk-1/KDR activation. J Biol Chem 273:30336–30343. doi:10.1074/jbc.273.46.30336 [DOI] [PubMed] [Google Scholar]
  8. Huang Y, Yang HJ, Jin Y, Li HM, Fu SB (2005) 13q14 aberration is related to the metastatic potential of human NSCLC. Yi Chuan 27:531–534 [PubMed] [Google Scholar]
  9. Jung YD, Ahmad SA, Liu W, Reinmuth N, Parikh A, Stoeltzing O, Fan F, Ellis LM (2002) The role of the microenvironment and intercellular cross-talk in tumor angiogenesis. Semin Cancer Biol 12:105–112. doi:10.1006/scbi.2001.0418 [DOI] [PubMed] [Google Scholar]
  10. Kargiotis O, Chetty C, Gondi CS, Tsung AJ, Dinh DH, Gujrati M, Lakka SS, Kyritsis AP, Rao JS (2008) Adenovirus-mediated transfer of siRNA against MMP-2 mRNA results in impaired invasion and tumor-induced angiogenesis, induces apoptosis in vitro and inhibits tumor growth in vivo in glioblastoma. Oncogene 27:4830–4840. doi:10.1038/onc.2008.122 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  11. Mazure NM, Chen EY, Laderoute KR, Giaccia AJ (1997) Induction of vascular endothelial growth factor by hypoxia is modulated by a phosphatidylinositol 3-kinase/Akt signaling pathway in Ha-ras-transformed cells through a hypoxia inducible factor-1 transcriptional element. Blood 90:3322–3331 [PubMed] [Google Scholar]
  12. Oberringer M, Meins C, Bubel M, Pohlemann T (2008) In vitro wounding: effects of hypoxia and transforming growth factor beta1 on proliferation, migration and myofibroblastic differentiation in an endothelial cell-fibroblast co-culture model. J Mol Histol 39:37–47. doi:10.1007/s10735-007-9124-3 [DOI] [PubMed] [Google Scholar]
  13. Risau W (1997) Mechanisms of angiogenesis. Nature 386:671–674. doi:10.1038/386671a0 [DOI] [PubMed] [Google Scholar]
  14. Shaulian E, Karin M (2002) AP-1 as a regulator of cell life and death. Nat Cell Biol 4:E131–E136. doi:10.1038/ncb0502-e131 [DOI] [PubMed] [Google Scholar]
  15. Shimada T, Nishimura Y, Nishiuma T, Rikitake Y, Hirase T, Yokoyama M (2007) Adenoviral transfer of rho family proteins to lung cancer cells ameliorates cell proliferation and motility and increases apoptotic change. Kobe J Med Sci 53:125–134 [PubMed] [Google Scholar]
  16. Shiojima I, Sato K, Izumiya Y, Schiekofer S, Ito M, Liao R, Colucci WS, Walsh K (2005) Disruption of coordinated cardiac hypertrophy and angiogenesis contributes to the transition to heart failure. J Clin Invest 115:2108–2118. doi:10.1172/JCI24682 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Somanath PR, Razorenova OV, Chen J, Byzova TV (2006) Akt1 in endothelial cell and angiogenesis. Cell Cycle 5:512–518 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. van Nieuw Amerongen GP, Koolwijk P, Versteilen A, van Hinsbergh VW (2003) Involvement of RhoA/Rho kinase signaling in VEGF-induced endothelial cell migration and angiogenesis in vitro. Arterioscler Thromb Vasc Biol 23:211–217. doi:10.1161/01.ATV.0000054198.68894.88 [DOI] [PubMed] [Google Scholar]
  19. Wang HQ, Huang LX, Qu MJ, Yan ZQ, Liu B, Shen BR, Jiang ZL (2006) Shear stress protects against endothelial regulation of vascular smooth muscle cell migration in a coculture system. Endothelium 13:171–180. doi:10.1080/10623320600760282 [DOI] [PubMed] [Google Scholar]
  20. Wang HQ, Bai L, Shen BR, Yan ZQ, Jiang ZL (2007) Coculture with endothelial cells enhances vascular smooth muscle cell adhesion and spreading via activation of beta1-integrin and phosphatidylinositol 3-kinase/Akt. Eur J Cell Biol 86:51–62. doi:10.1016/j.ejcb.2006.09.001 [DOI] [PubMed] [Google Scholar]
  21. Warner KA, Miyazawa M, Cordeiro MM, Love WJ, Pinsky MS, Neiva KG, Spalding AC, Nor JE (2008) Endothelial cells enhance tumor cell invasion through a crosstalk mediated by CXC chemokine signaling. Neoplasia 10:131–139. doi:10.1593/neo.07815 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Ye J, Yuan L (2007) Inhibition of p38 MAPK reduces tumor conditioned medium-induced angiogenesis in co-cultured human umbilical vein endothelial cells and fibroblasts. Biosci Biotechnol Biochem 71:1162–1169. doi:10.1271/bbb.60617 [DOI] [PubMed] [Google Scholar]
  23. Zeng Q, Li S, Chepeha DB, Giordano TJ, Li J, Zhang H, Polverini PJ, Nor J, Kitajewski J, Wang CY (2005) Crosstalk between tumor and endothelial cells promotes tumor angiogenesis by MAPK activation of Notch signaling. Cancer Cell 8:13–23. doi:10.1016/j.ccr.2005.06.004 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Cancer Research and Clinical Oncology are provided here courtesy of Springer

RESOURCES