Skip to main content
NCBI home page
Journal of Cancer Research and Clinical Oncology logoLink to Journal of Cancer Research and Clinical Oncology
. 2007 May 25;133(10):749–759. doi: 10.1007/s00432-007-0220-2

Microsatellite instability in Ewing tumor is not associated with loss of mismatch repair protein expression

I Alldinger 1, K L Schaefer 2, D Goedde 2, L Ottaviano 2, U Dirksen 3, A Ranft 3,4, H Juergens 3, H E Gabbert 2, W T Knoefel 1, C Poremba 2,5,✉
PMCID: PMC12160782  PMID: 17530287

Abstract

Only few clinical factors predict the prognosis of patients with Ewing tumors. Unfavorable outcome is associated with primary metastatic disease, age > 15 years, tumor volume above 200 ml, and the histological response to chemotherapy. The aim of this study was to elucidate the prevalence and clinical impact of microsatellite instability (MSI) together with the relation between MSI and mismatch repair protein expression in Ewing tumors. DNA from 61 primary Ewing tumors and 11 Ewing tumor cell lines was extracted and microsatellite analysis for the detection of instability or loss of heterozygosity was performed for the five markers of the Bethesda panel BAT25, BAT26, D5S346, D2S123, and D17S250, which represents the established marker panel for the analysis of hereditary non-polyposis colorectal carcinoma (HNPCC) patients. In addition, single nucleotide repeat regions of the two tumor genes BAX and transforming growth factor receptor II (TGFBR2) were also included. All of the 61 samples were suitable for LOH analysis and 55 for the determination of MSI-status. LOH of these microsatellite markers was detected in 9 of the 61 patients (14.8%). Over all, genetic instability, i.e. MSI and/or LOH, was detected in 17 tumors (27.9%). One out of the 11 tumor cell lines (STA ET1) was characterized by instability of all the five Bethesda markers, while from primary tumor samples, only one showed MSI in more than one microsatellite marker (D5S346 and D17S250, MSI-high). Eight of the fifty-five patients (14.5%) showed instability of one microsatellite locus (MSI-low). No instability was detected in BAT26, D2S123, BAX and TGFBR2. There was no significant correlation between MSI and loss of expression of mismatch repair proteins MLH1, MSH2, or MSH6. The impairment of the p53 signaling pathway (expression of TP53 and/or MDM2 by immunohistochemistry) was significantly associated with reduced overall survival (15 of 49 patients (30.6%), P = 0.0410, log-rank test). We conclude that MSI is not prevalent in Ewing tumor and that the nature of instability differs from the form observed in colorectal carcinoma, the model tumor of MSI. This is documented by the different pattern of MSI (no BAT26 instability) in Ewing tumors and the lack of a strict correlation between MSI-high and loss of expression of MSH2, MSH6 and MLH1.

Keywords: Ewing sarcoma, Microsatellite instability, TP53, MDM2

Introduction

Ewing tumors are bone-associated tumors affecting predominantly children and adolescents. They are characterized by the fusion of the EWSR1 gene on chromosome 22q12 to the transcription factors FLI1 (85%), ERG (10%), or, in rare cases, to another member of the ets transcription factor family (Delattre et al. 1994). While the detection of this translocation either by RT-PCR or by FISH in routinely processed material is of high diagnostic value (Dockhorn-Dworniczak et al. 1994; Friedrichs et al. 2006), the clinical impact of the variability on the architecture of the fusion transcripts is still a matter of debate (Huang et al. 2005).

Established factors associated with an unfavorable prognosis are primary disseminated disease, age > 15 years, large tumor volume, and axial primary site (Cotterill et al. 2000; Bacci et al. 2000). In the last decade, histological response to induction chemotherapy has been shown to be the strongest predictive factor (Picci et al. 1997). As not all patients receive surgery following induction chemotherapy, the latter is not available for all patients. Furthermore, several patients, lacking unfavorable predictive factors, show an early progress or relapse of their Ewing tumor. Therefore, additional predictive parameters are needed to identify these patients in order to provide a risk-adapted treatment strategy. Genetically, only few factors are known to be correlated with the prognosis of patients including impairment of the TP53 signaling pathway (Huang et al. 2005) and the number of secondary chromosomal alterations (Ozaki et al. 2001).

In carcinomas and especially in colorectal carcinoma, structural, numerical chromosomal alterations (referred to as chromosomal instability) are associated with the impairment of p53 tumor suppressor signaling pathway and poor prognosis. On the other hand, microsatellite instability (MSI) as another form of genomic instability is correlated with prolonged survival of patients (Popat et al. 2005; Risques et al. 2003). MSI, which describes the insertion or deletion of a few nucleotides in short repetitive sequence elements, was described as a frequent genotype in tumors belonging to the hereditary non-polyposis colorectal carcinoma syndrome, HNPCC. In these tumors, the impairment of the mismatch repair system is caused by an inherited mutation in MLH1, MSH2 or other members of the family of repair genes. MSI also occurs in 10–15% of sporadic colorectal carcinoma. In these cases, transcriptional silencing by promoter hypermethylation of MLH1 rather than mutation is the mechanism leading to the functional inactivation of the mismatch repair complex. Since in HNPCC, the detection of MSI is used to ascertain the diagnosis of this familiar cancer syndrome, many efforts went into finding a sensitive and specific set of marker satellites, leading to the establishment of the Bethesda panel that includes the mononucleotide STS’s BAT25 and BAT26 and the dinucleotide STS’s D2S123, D5S346, and D17S250. The instability of at least two of these markers is referred to as high MSI (MSI-H) associated with the loss of expression of at least one of the mismatch repair proteins and a better prognosis (Benatti et al. 2005).

In other sporadic carcinomas the prevalence of MSI ranged from 0 to 37% of the cases (Samowitz et al. 2002; Yamamoto et al. 2001; Wu et al. 2004; Onda et al. 2001) and the clinical impact of MSI is by far not as clear as in colorectal cancer.

Even less data are available for the molecular substructure, prevalence and prognostic role of MSI in sarcomas.

Kawaguchi found MSI in 10 of the 40 soft tissue sarcomas, including the two MSI-H (Kawaguchi et al. 2005). In contrast to colorectal carcinoma, in this study a correlation between loss of MLH1/MSH2 expression and MSI could only be documented if MSI-L tumors were included. In one study on bone tumors by Tarkkanen et al. (1996), which included one Ewing tumor, no MSI was found. In contrast, Ewing tumors have been reported to harbor genomic instability in high frequency 13/23 patients (Ohali et al. 2004) using a panel of 17 microsatellites. Ebinger et al. (2005), on the other hand, analyzed a panel of eight mono- and dinucleotide microsatellites, which included the Bethesda panel of microsatellites, and found low frequency in 6% of the Ewing Tumors and no tumors displaying high-frequency MSI.

Due to these divergent findings, we attempted to evaluate the prevalence of MSI in a collection of 61 primary Ewing tumor samples, and to analyze the correlation of MSI and loss of mismatch repair protein expression in this tumor entity together with the impact of MSI on the clinical outcome.

Patients and methods

Patients

We analyzed paraffin-embedded Ewing tumor specimens from 61 patients operated on Ewing tumor in different hospitals in Germany. Thirty-eight patients were males (62.3%) and 23 were females. All specimens were analyzed for EWS translocations. Follow-up data were available for 49 patients registered in the EICESS92 or EURO-E.W.I.N.G. 99 study. The histological diagnosis of Ewing tumor was confirmed by a reference pathologist (C.P.) for each tumor.

Cell lines

The following 11 Ewing tumor cell lines, all characterized by an EWS gene rearrangement, were included: STA-ET-1, STA-ET-2.1, CADO, RM-82, TC-71, VH-64, WE-68, RD-ES, SK-N-MC, SK-ES, CHP-100 (Table 1). Cells were grown on gelatine coated culture flask in RPMI supplemented with 1% Penicillin-Streptomycin (10,000 U/ml penicillin and 10 mg/ml streptomycin), 2 mM L-glutamine, and 10% FCS under standard conditions.

Table 1.

Ewing tumor cell lines

Cell line EWS rearrangement TP53-status (Kovar et al. 1993)
CADO ES1 t(21;22) Wild type
RD-ES t(11;22) Arg273Cys
RM 82 t(21;22) Arg273His
SK ES1 t(11;22) Cys176Phe
SKNMc t(11;22) Truncation
STA ET1 t(11;22) Wild type
STA ET2.1 t(11;22) Cys277Tyr
TC71 t(11;22) Truncation
VH 64 t(11;22) Wild type
WE 68 t(11;22) Wild type
CHP 100 t(11;22) Not analyzed
Open in a new tab

DNA extraction

A slice of each tumor was stained with hematoxylin/eosin to assess the percentage of tumor cells. DNA was extracted from archived, paraffin-embedded tumor samples. Three to six 10 μm slices of the tumor sample were collected in a sterile, autoclaved test tube (1.5 ml). Tissue samples containing less than 80% of tumor cells as quantified by histopathological examination were microdissected prior to DNA extraction according to the suggestions of the German HNPCC Consortium (Muller et al. 2006).

About 1 ml xylene was added, incubated at 45°C for 15 min and centrifuged at 12,000g for 5 min. Supernatant was discarded. This procedure was repeated twice. Then 1 ml 100% ethanol was added to the pellet, mixed and centrifuged at 12,000g for 5 min. This procedure was repeated twice. The pellet was air-dried for approximately 15 min; 500 μl of a cell lysis solution were added, containing 50 mM Tris/HCl, pH 7.4, 25 mM EDTA, 500 mM NaCl, 0.1% Nonident P-40 and 1% SDS, and incubated at 65°C for 15 min; 20 μl of proteinase K (20 mg/ml) were added and the sample incubated at 56°C overnight. In cases of incomplete cell solution another 10 μl of proteinase K were added and the sample incubated for another hour. Then 1.2 μl RNase A (10 mg/ml) was added and the sample incubated at 37°C for 1 h. DNA was isolated using the Qiagen DNA Extraction kit (Qiagen, Hilden, Germany) following the manufacturer’s recommendations. DNA concentration was determined measuring OD260 at pH 7.5 in TE buffer (Eppendorf Bio Photometer, Hamburg, Germany) while DNA purity was estimated using the OD260/OD280 ratio.

Primers and PCR

Microsatellite analysis was performed using the recommended reference panel for the detection of MSI in colorectal cancer. This panel is composed of two mononucleotide repeats (BAT25 and BAT26) and three dinucleotide repeats (D5S346, D2S123, and D17S250) (Boland et al. 1998). Additionally, the microsatellites in the BCL2-associated X protein gene (BAX, a G8-repeat on 19q13.3–4) and the transforming growth factor receptor II gene (TGFBR2, a A10-repeat on 3p22) were studied.

Primers used to amplify microsatellite markers were as follows:

BAT26 forward TGACTACTTTTGACTTCAGCC
BAT26 reverse AACCATTCAACATTTTTAACCC
BAT25 forward TCGCCTCCAAGAATGTAAGT
BAT25 reverse TCTGCATTTTAACTATGGCTC
D2S123 forward AAACAGGATGCCTGCCTTTA
D2S123 reverse GGACTTTCCACCTATGGGAC
D17S250 forward GGAAGAATCAAATAGACAAT
D17S250 reverse GCTGGCCATATATATATTTAAACC
D5S346 forward ACTCACTCTAGTGATAAATCGGG
D5S346 reverse AGCAGATAAGACAGTATTACTAGTT
TGFBR2 forward ATGACTTTATTCTGGAAGATGCTG
TGFBR2 reverse CACATGAAGAAAGTCTCACCAGGC
BAX forward TTCATCCAGGATCGAGCAGGGCGA
BAX reverse CACTCGCTCAGCTTCTTGGTGGAC
Open in a new tab

BAT-26, D17S250, TGFBRII and BAX forward primers were labeled with the fluorescent probe TET, BAT25 and D2S123 forward primers were labeled with the fluorescent probe FAM, and D5S346 forward primer was labeled with HEX. PCR reactions were performed in a total volume of 20 μl containing 20 ng of genomic DNA, 2 μl 2 mM dNTP, 0.5 U Hotstart taq-Polymerase, 10 × buffer (both QIAGEN, Hilden, Germany) and primers in optimized concentrations: BAT25, D2S123, D5S346 and D17S250 primer concentrations were 10 μM, BAT-26 primer concentration 5 μM and TGFBR2 and BAX primer concentration 2.5 μM.

Multiplex PCR was performed with BAT25, D2S123 and D5S346 in one PCR, BAT-26 and D17S250 in a second and TGFBR2 and BAX in a third PCR under the same conditions: denaturing at 95°C for 15 min, 35 cycles of denaturing at 94°C for 60 s, annealing at 52°C for 60 s and extension at 72°C for 90 s, followed by an extension step at 72°C for 15 min.

PCR products were separated using an ABI Prism 310 single capillary genetic analyzer (Applied Biosystems, Foster City, CA, USA). MSI and LOH were assessed comparing the results with the peak pattern obtained from DNA from tumor-cell-free leukocytes. If one microsatellite was instable the tumor was considered MSI-L (low), in the case of two instable microsatellites it was considered MSI-H (high). MSI status was only reported if all the five markers showed sufficient PCR products.

LOH analysis

An allelic imbalance was referred to as an LOH if the ratio between the two alleles of a heterozygous sample has shifted to greater than 1.5 compared to the corresponding tumor-free reference sample.

Immunohistochemistry

For each Ewing tumor, six sections (2–3 μm thick) were cut and mounted on to glass slides covered with Histobond®. After dewaxing and rehydration of sections, antigenic site retrieval was accomplished by microwaving each slide for 5 min in 0.01 M citric acid buffer (pH 6.0). Endogenous peroxidase activity was blocked by incubation with 2% hydrogen peroxide for 20 min and non-specific binding prevented by incubation with 1% bovine serum albumin (BSA) in phosphate buffered saline (PBS). Sections were subsequently incubated with monoclonal antibodies against MSH2 (clone Ab-2, MERCK/Calbiochem, Darmstadt, Germany, dilution 1:80), MSH6 (clone 44, dilution 1:600) MLH1 (clone G168–728, dilution 1:240) (both BD Biosciences Pharmingen, Heidelberg, Germany), p53 (clone Ab-6, MERCK/Calbiochem, Darmstadt, Germany, dilution 1:500), p16 (clone Ab-7, NeoMarkers/Dunn, Asbach, Germany, dilution 1:50), or MDM2 (clone Ab-1, Oncogene Science/dianova, Hamburg, Germany, dilution 1:100) for 2 h at room temperature. Antibody binding was detected using the Elite Vectastain ABC kit together with the VIP peroxidase substrate kit for visualization (both Vector Laboratories Ltd, Peterborough, UK). Sections were counterstained with hematoxylin, then dehydrated and mounted.

Immunohistochemistry scoring

Staining results were scored independently by two pathologists (C.P. and D.G.). For all the six markers only nuclear staining was taken into account for the respective scoring system. According to the guidelines for the assessment of colorectal cancer, specimen were categorized positive if at least 10% of tumor cells show distinct nuclear staining of mismatch repair proteins. In the case of a missing internal control, normal colorectal tissue was used as a positive external control. The loss of expression was recorded when nuclear staining was observed in normal tissue but not in adjacent malignant cells. For p16 (Han et al. 2001), p53 and MDM2 (Ralhan et al. 2000), a semiquantitative scoring on a four-point scale based on the percentage of positively staining tumor cells was employed according to the indicated references (<10%: 0, 10–30%: 1, 30–50%: 2, >50%: 3). For statistical analysis, groups of negative and week staining (score 0 and 1) or moderate and strong staining (scores 2 and 3) were combined.

Survival analysis

The databases of two consecutive Ewing tumor trials of the German Society of Pediatric Oncology and Hematology (GPOH) (EICESS & Euro-E.W.I.N.G. 99) were frozen in November 2005. Overall survival (OS) time was calculated according to Kaplan and Meier from diagnosis to death or the last date seen where all living patients were censored. Univariate comparisons were made by using log-rank tests with an explorative character so no alpha-correction for multiple testing was done. Power of the tests to identify a reasonable difference in OS was somewhat limited due to small group sizes. Statistical analyses were carried out using the SAS statistical software package (Release 8.02, SAS Institute, Cary, North Carolina NC 27513, USA).

Results

Patients

The sixty-one patients in our study had a mean age of 20.7 years (3–57); 38 were males (62.3%), 23 females. A t(11;22) or t(21;22) chromosomal translocation was detected in tumor samples from 59 patients; 29 patients (47.5%) had an EWS/FLI1 gene fusion joining exon 7 to exon 6, 15 patients (24.5%) had an EWS/FLI1 transcript exon 7/exon 5. Other transcript variants were rare: EWS 7/FLI1 8 (3 patients), EWS 10/ERG 6 (2 patients) EWS 10/FLI1 5 (3 patients), EWS 10/FLI1 6 (3 patients), EWS 7/ERG 6 (3 patients) and EWS 9/FLI1 7 (1 patient).

Microsatellites

DNA of sufficient quality to perform MSI analysis could be extracted from tissue specimens of 55 patients. Tumor specimen of only one patient was characterized by instability of two Bethesda markers (D5S346 and D17S346) and was therefore referred to as MSI-H. Tumors of eight patients (14.5%) showed instability of one microsatellite marker (D17S250 once, three times BAT25 and four times D5S346, Fig. 1) and were therefore called MSI-L. In none of the 55 tumor tissue samples, the instability of BAT26 and D2S123-markers could be detected. PCR analysis for the mononucleotide repeats at the BAX and TGFBR2 genes could successfully be performed for 39 specimens showing no instability at all.

Fig. 1.

Fig. 1

Open in a new tab

Detection of microsatellite instability and loss of heterozygosity by microsatellite analysis. a Analysis of primary tumor tissue. I Instability of satellite D17S250 in primary tumor specimen; above Ewing tumor tissue, below non-tumor control. II Loss of heterozygosity at D2S123; above Ewing tumor tissue, below non-tumor control. b Analysis of Ewing‘s tumor cell lines. STA ET1 (above) shows MSI in all markers analysed, e.g. I D17S250 or II BAT25, while for cell line WE68 (below) no additional peaks can be detected

Among the 11 Ewing tumor cell lines tested for MSI, all but one did not show any evidence of MSI, regardless of the missing “normal tissue”. In contrast, cell line STA ET1 was characterized by additional alleles in all the five Bethesda microsatellite markers and was therefore classified as MSI-H (Fig. 1).

LOH

LOH was detected in tumors of nine patients (16.4%), 6 at D17S250, 3 at D2S123 and 2 at D5S346. One tumor sample was characterized by LOH at two loci (D17S250 and D5S346). Only one tumor specimen was characterized by both MSI-L (BAT25) and LOH at D2S123 (Fig. 1).

Overall 17 tumors (30.9%) showed genetic instability, i.e. LOH and/or MSI (Table 2).

Table 2.

Correlation between microsatellite status and expression of mismatch repair proteins, p16, p53, and MDM2

Patient no. EWS/FLI1–EWS/ERG MS LOH MMR p16 p53 MDM2
230 EWS7/FLI5 MSI-H 0 neg 0 0 0
253 n.d. MSI-L 0 n.s 3 0 0
241 EWS10/ERG6 MSI-L 0 n.s. 1 0 0
239 EWS7/FLI5 MSI-L 0 pos 0 0 0
259 EWS7/ERG6 MSI-L 0 pos 2 1 1
201 EWS7/FLI6 MSI-L 1 pos 3 1 0
245 EWS7/FLI6 MSI-L 0 pos 3 1 1
235 EWS7/FLI6 MSI-L 0 pos 0 2 1
228 EWS7/FLI5 MSI-L 0 pos 3 2 3
236 EWS10/FLI5 MSS 0 neg 2 0 0
193 EWS7/FLI6 MSS 1 pos 3 0 1
216 EWS9/FLI7 MSS 0 pos 3 0 0
203 EWS7/FLI5 MSS 0 pos 3 0 0
220 EWS7/ERG6 MSS 0 pos 1 0 0
225 EWS7/FLI6 MSS 0 pos 3 0 0
232 EWS7/ERG6 MSS 0 pos 3 0 0
233 EWS7/FLI5 MSS 0 pos 3 0 0
238 EWS7/FLI5 MSS 1 pos 2 0 0
246 EWS10/FLI5 MSS 0 pos 3 0 0
250 EWS10/FLI6 MSS 0 pos 0 0 0
254 EWS7/FLI6 MSS 1 pos 3 0 0
229 EWS10/FLI6 MSS 0 posa 3 0 0
257 EWS7/FLI6 MSS 1 neg 3 1 0
218 EWS7/FLI8 MSS 0 pos 3 1 0
244 EWS7/FLI5 MSS 0 pos 0 1 0
252 EWS7/FLI6 MSS 0 pos 3 1 0
202 EWS7/FLI5 MSS 0 pos 3 1 1
207 EWS7/FLI5 MSS 0 pos 3 1 0
211 EWS7/FLI6 MSS 0 pos 3 1 0
213 EWS7/FLI6 MSS 0 pos 3 1 0
223 EWS7/FLI6 MSS 0 pos 3 1 0
224 EWS7/FLI6 MSS 0 pos 3 1 1
234 EWS7/FLI6 MSS 0 pos 3 1 0
226 EWS7/FLI6 MSS 0 pos 3 1 1
248 EWS7/FLI6 MSS 0 pos 3 1 0
251 EWS7/FLI5 MSS 0 pos 3 1 0
255 EWS7/FLI6 MSS 1 pos 1 1 1
200 EWS7/FLI6 MSS 0 pos 3 0 2
258 EWS7/FLI6 MSS 0 pos 3 0 3
196 n.d. MSS 0 pos 0 1 2
215 EWS7/FLI6 MSS 0 pos 3 1 2
249 EWS7/FLI6 MSS 0 pos 3 1 3
209 EWS7/FLI5 MSS 0 n.s 2 2 0
219 EWS7/FLI6 MSS 1 pos 2 2 0
243 EWS7/FLI5 MSS 0 pos 3 2 1
247 EWS7/FLI6 MSS 0 pos 3 3 1
227 EWS7/FLI5 MSS 0 pos 1 2 2
231 EWS7/FLI6 MSS 0 pos 3 2 3
204 EWS7/FLI8 MSS 0 pos 3 3 2
212 EWS7/FLI5 MSS 1 pos 3 3 2
217 EWS7/FLI6 MSS 1 pos 0 3 2
242 EWS10/ERG6 MSS 0 pos 3 3 3
214 EWS7/FLI6 n.s. 0 n.s 3 0 0
195 EWS7/FLI5 n.s. 0 n.s 0 0 0
197 EWS7/FLI8 n.s. 0 pos 1 0 0
199 EWS7/FLI6 n.s. 0 pos 1 0 0
256 EWS10/FLI6 n.s. 0 pos 0 0 1
194 EWS10/FLI5 n.s. 0 pos 0 0 0
205 EWS7/FLI6 n.s. 0 pos 1 0 0
208 EWS7/FLI6 n.s. 0 pos 3 0 1
198 EWS7/FLI6 n.s. 0 posa 0 0 0
Open in a new tab

Patients were tested for EWS/FLI1 or EWS/ERG gene fusion as described elsewhere (Friedrichs et al. 2006) (n.d. not detectable). Microsatellite status (MS) was classified as instable (high or low, MSI-H or MSI-L), stable (MSS) or not suitable (n.s.). “1” indicates samples showing the loss of heterozygosity (LOH) for at least on microsatellite. Expression of mismatch repair proteins (MMR) was considered as either positive, negative or not suitable, while expression of p16, p53 and MDM2 was scored as negative, week, moderate, or strong (0, 1, 2, and 3, respectively)

apos one marker not evaluable

Immunohistochemistry of mismatch repair proteins

Tumor specimens of 59 patients could be successfully analyzed by means of immunohistochemistry. In 54 tumor samples we found a nuclear expression of MLH1, MSH2 and MSH6 (Fig. 2). In three specimen expressions, none of these proteins could be detected, with positive external control. Three reactions in two patients could not be assessed due to technical problems. One of the tumor tissues with no detectable expression of repair proteins was the patient with MSI-H. The other patients had stable microsatellites. The correlation between microsatellite status and expression of MSH2, MSH6 and MLH1 is shown in Table 2.

Fig. 2.

Fig. 2

Open in a new tab

Expression of marker proteins in Ewing tumor tissue detected by immunohistochemistry (amplification ×200)

Follow-up of patients

Follow-up data were available for 49 patients. Median follow-up time was 4.28 years. A 3-year OS for all patients was 0.633 (95% CI ± 0.135); 5-year OS was 0.591 (95% CI ± 0.138).

Data analysis revealed no significant differences between the OS of patients without (n = 35/42, 83.3%) and with MSI (at least one marker instable, n = 7, 16.7%, log-rank test, P = 0.429) or LOH (n = 11/49, 22.5%; P = 0.369). Figure 3 shows that also the combination of MSI and LOH to identify the tumors showing any kind of genetic instability, had no impact on the OS of patients (n = 14/36, 38.9%; P = 0.303).

Fig. 3.

Fig. 3

Open in a new tab

Overall-survival (OS) MSI or LOH positive vs. both low and negative (n = 49)

In addition to the direct analysis on genomic instability, i.e. MSI and LOH, we also investigated whether the p53 tumor suppressor protein itself and p16INK4A and MDM2, both involved in the TP53 signaling pathway, were aberrantly expressed in Ewing tumor samples.

A first pairwise analysis of p16, p53, and MDM2, respectively, revealed a significant correlation between MDM2 and p53 positive samples (P = 0.0009, Fisher’s exact test) while no correlation could be observed between p16 and one of the other markers.

In OS, no difference could be detected for patients without or low (n = 17/32, 53.1%) compared with moderate or strong expression of p16 INK4A (n = 15, 46.9%; P = 0.971).

There was a trend toward decreased survival time for patients with moderate and strong expression of p53 (P = 0.09) but not for MDM2 (P = 0.31; for both: n = 11/49, 22.5%; no expression: n = 38, 77.5%). About 15 of the 49 tumor specimens (32.7%) showed expression either of p53 or of MDM2 or of both. OS time of these patients was considerably shorter than for the 34 patients (69.4%) without expression of these proteins with 3-year OS of 0.677 vs. 0.533, and 5-year OS of 0.646 vs. 0.467 (P = 0.041, see Fig. 4).

Fig. 4.

Fig. 4

Open in a new tab

Overall-survival (OS) p53 or MDM2 positive vs. both low and negative (N = 49)

Discussion

To estimate the impact of MSI on the biology of Ewing tumors and to get information on putative underlying genetic mechanisms, we screened a series of paraffin-embedded tumor samples from 61 patients for MSI and correlated these data with the loss of immunohistochemical MLH1, MSH2, or MSH6 expression. Applying the Bethesda microsatellite marker panel, which was established to characterize HNPCC, 14.5% of tumors were categorized as MSI-L while only one tumor showed two instable microsatellites and was characterized as MSI-H. It is important to note that the pattern of instable microsatellite markers clearly differs from the pattern found in colorectal carcinoma. Of the two mononucleotid marker loci which are frequently affected in MSI-H colorectal carcinoma (Popat et al. 2005), instability of BAT25 was detected only once and instability of BAT26 in none of the Ewing tumor samples. These results are comparable with a previous study of 17 tumor samples (Ebinger et al. 2005).

An interesting exception was found in the Ewing tumor cell line STA ET1, which is instable for all the five Bethesda markers. Due to the unavailability of the primary tumor we do not know if this genetic phenotype was already present in the original tumor tissue or was acquired during in vitro culturing.

Another remarkable difference between colorectal carcinoma and Ewing tumor exists in the coherence of the expression of mismatch repair proteins and MSI-H: In colorectal carcinoma, MSI and the loss of either MLH1 or MSH2 shows convincing correlation (Ward et al. 2005). In contrast, in our collection of primary Ewing tumor samples, either no or all (MLH1, MSH2, MSH6) repair proteins were lost and this loss was not strictly correlated with MSI or even MSI-H.

Using a set of 13 microsatellite markers (only D17S250 and BAT26 from the Bethesda panel), Ohali et al. (2004) detected MSI in 48% of tumor samples from a series of 23 Ewing tumor patients (4 MSI-H, 7 MSI-L). The differing rates of MSI tumors in this study and our investigations may be due to the different microsatellite markers employed. Since the aim of our study was to investigate the impact of MSI, which is related to mismatch repair deficiency as observed in colorectal carcinoma, we focused on the Bethesda panel of microsatellite markers.

The correlation between mismatch repair protein deficiency and MSI in tumor entities other than colorectal carcinoma is quite heterogeneous: For familial and sporadic breast carcinoma, both MSI and loss of MLH1/MSH2 expression represent an extremely rare event (Adem et al. 2003). On the other hand, in ovarian carcinoma (Geisler et al. 2003) and endometrial carcinoma (Stefansson et al. 2002) pathological expression of mismatch repair proteins and MSI-high are significantly correlated. In adult acute myeloid leukemia MSI was found in 19.6% of the patients, but without correlating to the expression of MLH1, MSH2, or MSH6 as measured by RT-PCR. In 10 out of the 40 soft tissue sarcomas, MSI was detectable; however, a correlation between loss of MLH1/MSH2 expression and MSI could only be documented if MSI-L tumors were included (Kawaguchi et al. 2005). Finally, for the rare malignant melanoma of soft parts (MMSP, synonym: clear cell sarcoma of soft tissue), which are also characterized by a chromosomal translocation involving the EWS gene, a recent study has indicated a dramatically reduced prevalence of MSI compared with dermal malignant melanoma and, at the same time, could exclude loss of MLH1/MSH2 expression for all MMSP samples analyzed (n = 9). Taken together, these examples show that for both epithelial and mesenchymal tumors, there is no general rule in terms of prevalence of MSI and correlation to mismatch repair protein expression, and therefore, these features have to be determined separately for each tumor entity.

For our collective of Ewing’s tumors, there was no significant correlation between MSI-status and patients survival.

One possible explanation for the better prognosis of MSI-H colorectal carcinomas (Popat et al. 2005; Han et al. 2001) is the high amount of mutated proteins, which in turn are leading to the activation of the immune system as evidenced by elevated numbers of activated cytotoxic T cells infiltrating the tumor tissue (Banerjea et al. 2004; Phillips et al. 2004). This mechanism was not observed in colorectal carcinoma showing comparable low levels of MSI (MSI-L) like in our Ewing tumors. This may be an explanation that no favorable effect was observed for these sporadic MSI + tumors.

While MSI represents only one manifestation of genetic instability, in former studies, others and we were able to demonstrate that chromosomal instability is associated with tumor progression in Ewing tumor (Hattinger et al. 2002; Schaefer et al. 2004). It is well established that the loss of p53 efficiency is directly linked to both, tolerance of gross chromosomal replication errors as well as to an adverse effect on patient’s prognosis (Huang et al. 2005; de Alava et al. 2000). Moreover, several studies show a significant inverse correlation between MSI/mismatch repair impairment and positive staining for p53 in colon cancer (Ogino et al. 2006; Samowitz et al. 2001) and the same was also found for endometrial carcinoma: the endometroid subtype is characterized by MSI, near diploid karyotype, and lower incidence of p53 impairment while the non-endometroid subtype shows more often p53 mutation, aneuploidy but low prevalence of MSI (Cerezo et al. 2006).

As in this study on Ewing’s sarcoma, the significant coexpression of p53 and MDM2 is reported also for other tumor entities, colorectal carcinoma, (Broll et al. 1999), renal carcinoma, (Haitel et al. 2000), endometroid carcinoma (Ambros et al. 1996), supporting the existence of regulatory mechanism involving these to proteins. Using immunohistochemical positive staining of p53 and/or MDM2 as a surrogate marker of p53 efficiency, we could underline the high impact of this signaling pathway on patient outcome in contrast to MSI status: about one-third of patients was scored p53/MDM2 positive and was found to show a significantly reduced survival time.

On the basis of these findings, we conclude the kind of MSI found in Ewing tumors remarkably differs from MSI found in colorectal carcinoma with respect to frequency, the pattern of microsatellite markers affected, and the relationship to the mismatch repair proteins MLH1 and MSH2. The confirmation that p53 pathway impairment in Ewing’s tumors is associated with a worse prognosis of patients supports the claim to include this parameter in the routine staging analysis of this tumor entity.

Acknowledgments

This work was supported by grants from the “Forschungskommission der Medizinischen Fakultät Düsseldorf” and EuroBoNet (6th Framework Network of Excellence of the European Union).

Conflict of interest statement

None declared.

Footnotes

IA and KLS contributed equally to this study.

References

  1. Adem C, Soderberg CL, Cunningham JM, Reynolds C, Sebo TJ, Thibodeau SN et al (2003) Microsatellite instability in hereditary and sporadic breast cancers. Int J Cancer 107(4):580–582 [DOI] [PubMed] [Google Scholar]
  2. Ambros RA, Sheehan CE, Kallakury BV, Ross JS, Malfetano J, Paunovich E et al (1996) MDM2 and p53 protein expression in the histologic subtypes of endometrial carcinoma. Mod Pathol 9(12):1165–1169 [PubMed] [Google Scholar]
  3. Bacci G, Ferrari S, Comandone A, Zanone A, Ruggieri P, Longhi A et al (2000) Neoadjuvant chemotherapy for Ewing’s sarcoma of bone in patients older than thirty-nine years. Acta Oncol 39(1):111–116 [DOI] [PubMed] [Google Scholar]
  4. Banerjea A, Ahmed S, Hands RE, Huang F, Han X, Shaw PM et al (2004) Colorectal cancers with microsatellite instability display mRNA expression signatures characteristic of increased immunogenicity. Mol Cancer 3:21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Benatti P, Gafa R, Barana D, Marino M, Scarselli A, Pedroni M et al (2005) Microsatellite instability and colorectal cancer prognosis. Clin Cancer Res 11(23):8332–8340 [DOI] [PubMed] [Google Scholar]
  6. Boland CR, Thibodeau SN, Hamilton SR, Sidransky D, Eshleman JR, Burt RW et al (1998) A National Cancer Institute Workshop on Microsatellite Instability for cancer detection and familial predisposition: development of international criteria for the determination of microsatellite instability in colorectal cancer. Cancer Res 58(22):5248–5257 [PubMed] [Google Scholar]
  7. Broll R, Stark A, Windhovel U, Best R, Strik MW, Schimmelpenning H et al (1999) Expression of p53 and mdm2 mRNA and protein in colorectal carcinomas. Eur J Cancer 35(7):1083–1088 [DOI] [PubMed] [Google Scholar]
  8. Cerezo L, Cardenes H, Michael H (2006) Molecular alterations in the pathogenesis of endometrial adenocarcinoma: therapeutic implications. Clin Transl Oncol 8(4):231–241 [DOI] [PubMed] [Google Scholar]
  9. Cotterill SJ, Ahrens S, Paulussen M, Jurgens HF, Voute PA, Gadner H et al (2000) Prognostic factors in Ewing’s tumor of bone: analysis of 975 patients from the European Intergroup Cooperative Ewing’s Sarcoma Study Group. J Clin Oncol 18(17):3108–3114 [DOI] [PubMed] [Google Scholar]
  10. de Alava E, Antonescu CR, Panizo A, Leung D, Meyers PA, Huvos AG et al (2000) Prognostic impact of P53 status in Ewing sarcoma. Cancer 89(4):783–792 [PubMed] [Google Scholar]
  11. Delattre O, Zucman J, Melot T, Garau XS, Zucker JM, Lenoir GM et al (1994) The Ewing family of tumors: a subgroup of small-round-cell tumors defined by specific chimeric transcripts. N Engl J Med 331(5):294–299 [DOI] [PubMed] [Google Scholar]
  12. Dockhorn-Dworniczak B, Schafer KL, Dantcheva R, Blasius S, Winkelmann W, Strehl S et al (1994) Diagnostic value of the molecular genetic detection of the t(11;22) translocation in Ewing’s tumours. Virchows Arch 425(2):107–112 [DOI] [PubMed] [Google Scholar]
  13. Ebinger M, Bock T, Kandolf R, Sotlar K, Bultmann BD, Greil J (2005) Standard mono- and dinucleotide repeats do not appear to be sensitive markers of microsatellite instability in the Ewing family of tumors. Cancer Genet Cytogenet 157(2):189–190 [DOI] [PubMed] [Google Scholar]
  14. Friedrichs N, Kriegl L, Poremba C, Schaefer KL, Gabbert HE, Shimomura A et al (2006) Pitfalls in the detection of t(11;22) translocation by fluorescence in situ hybridization and RT-PCR: a single-blinded study. Diagn Mol Pathol 15(2):83–89 [DOI] [PubMed] [Google Scholar]
  15. Geisler JP, Goodheart MJ, Sood AK, Holmes RJ, Hatterman-Zogg MA, Buller RE (2003) Mismatch repair gene expression defects contribute to microsatellite instability in ovarian carcinoma. Cancer 98(10):2199–2206 [DOI] [PubMed] [Google Scholar]
  16. Haitel A, Wiener HG, Baethge U, Marberger M, Susani M (2000) mdm2 expression as a prognostic indicator in clear cell renal cell carcinoma: comparison with p53 overexpression and clinicopathological parameters. Clin Cancer Res 6(5):1840–1844 [PubMed] [Google Scholar]
  17. Han S, Ahn SH, Park K, Bae BN, Kim KH, Kim HJ et al (2001) P16INK4a protein expression is associated with poor survival of the breast cancer patients after CMF chemotherapy. Breast Cancer Res Treat 70(3):205–212 [DOI] [PubMed] [Google Scholar]
  18. Hattinger CM, Potschger U, Tarkkanen M, Squire J, Zielenska M, Kiuru-Kuhlefelt S et al (2002) Prognostic impact of chromosomal aberrations in Ewing tumours. Br J Cancer 86(11):1763–1769 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Huang HY, Illei PB, Zhao Z, Mazumdar M, Huvos AG, Healey JH et al (2005) Ewing sarcomas with p53 mutation or p16/p14ARF homozygous deletion: a highly lethal subset associated with poor chemoresponse. J Clin Oncol 23(3):548–558 [DOI] [PubMed] [Google Scholar]
  20. Kawaguchi K, Oda Y, Takahira T, Saito T, Yamamoto H, Kobayashi C et al (2005) Microsatellite instability and hMLH1 and hMSH2 expression analysis in soft tissue sarcomas. Oncol Rep 13(2):241–246 [PubMed] [Google Scholar]
  21. Kovar H, Auinger A, Jug G, Aryee D, Zoubek A, Salzer-Kuntschik M, Gadner H (1993) Narrow spectrum of infrequent p53 mutations and absence of MDM2 amplification in Ewing tumours. Oncogene 8(10):2683–2690 [PubMed] [Google Scholar]
  22. Muller A, Beckmann C, Westphal G, Bocker Edmonston T, Friedrichs N, Dietmaier W et al (2006) Prevalence of the mismatch-repair-deficient phenotype in colonic adenomas arising in HNPCC patients: results of a 5-year follow-up study. Int J Colorectal Dis 21(7):632–641 [DOI] [PubMed] [Google Scholar]
  23. Ogino S, Brahmandam M, Kawasaki T, Kirkner GJ, Loda M, Fuchs CS (2006) Combined analysis of COX-2 and p53 expressions reveals synergistic inverse correlations with microsatellite instability and CpG island methylator phenotype in colorectal cancer. Neoplasia 8(6):458–464 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Ohali A, Avigad S, Cohen IJ, Meller I, Kollender Y, Issakov J et al (2004) High frequency of genomic instability in Ewing family of tumors. Cancer Genet Cytogenet 150(1):50–56 [DOI] [PubMed] [Google Scholar]
  25. Onda M, Nakamura I, Suzuki S, Takenoshita S, Brogren CH, Stampanoni S et al (2001) Microsatellite instability in thyroid cancer: hot spots, clinicopathological implications, and prognostic significance. Clin Cancer Res 7(11):3444–3449 [PubMed] [Google Scholar]
  26. Ozaki T, Paulussen M, Poremba C, Brinkschmidt C, Rerin J, Ahrens S et al (2001) Genetic imbalances revealed by comparative genomic hybridization in Ewing tumors. Genes Chromosomes Cancer 32(2):164–171 [DOI] [PubMed] [Google Scholar]
  27. Phillips SM, Banerjea A, Feakins R, Li SR, Bustin SA, Dorudi S (2004) Tumour-infiltrating lymphocytes in colorectal cancer with microsatellite instability are activated and cytotoxic. Br J Surg 91(4):469–475 [DOI] [PubMed] [Google Scholar]
  28. Picci P, Bohling T, Bacci G, Ferrari S, Sangiorgi L, Mercuri M et al (1997) Chemotherapy-induced tumor necrosis as a prognostic factor in localized Ewing’s sarcoma of the extremities. J Clin Oncol 15(4):1553–1559 [DOI] [PubMed] [Google Scholar]
  29. Popat S, Hubner R, Houlston RS (2005) Systematic review of microsatellite instability and colorectal cancer prognosis. J Clin Oncol 23(3):609–618 [DOI] [PubMed] [Google Scholar]
  30. Ralhan R, Sandhya A, Meera M, Bohdan W, Nootan SK (2000) Induction of MDM2-P2 transcripts correlates with stabilized wild-type p53 in betel- and tobacco-related human oral cancer. Am J Pathol 157(2):587–596 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Risques RA, Moreno V, Ribas M, Marcuello E, Capella G, Peinado MA (2003) Genetic pathways and genome-wide determinants of clinical outcome in colorectal cancer. Cancer Res 63(21):7206–7214 [PubMed] [Google Scholar]
  32. Samowitz WS, Holden JA, Curtin K, Edwards SL, Walker AR, Lin HA et al (2001) Inverse relationship between microsatellite instability and K-ras and p53 gene alterations in colon cancer. Am J Pathol 158(4):1517–1524 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Samowitz WS, Curtin K, Neuhausen S, Schaffer D, Slattery ML (2002) Prognostic implications of BAX and TGFBRII mutations in colon cancers with microsatellite instability. Genes Chromosomes Cancer 35(4):368–371 [DOI] [PubMed] [Google Scholar]
  34. Schaefer KL, Brachwitz K, Wai DH, Braun Y, Diallo R, Korsching E et al (2004) Expression profiling of t(12;22) positive clear cell sarcoma of soft tissue cell lines reveals characteristic up-regulation of potential new marker genes including ERBB3. Cancer Res 64(10):3395–3405 [DOI] [PubMed] [Google Scholar]
  35. Stefansson I, Akslen LA, MacDonald N, Ryan A, Das S, Jacobs IJ et al (2002) Loss of hMSH2 and hMSH6 expression is frequent in sporadic endometrial carcinomas with microsatellite instability: a population-based study. Clin Cancer Res 8(1):138–143 [PubMed] [Google Scholar]
  36. Tarkkanen M, Aaltonen LA, Bohling T, Kivioja A, Karaharju E, Elomaa I, et al (1996) No evidence of microsatellite instability in bone tumours. Br J Cancer 74(3):453–455 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Ward RL, Turner J, Williams R, Pekarsky B, Packham D, Velickovic M et al (2005) Routine testing for mismatch repair deficiency in sporadic colorectal cancer is justified. J Pathol 207(4):377–384 [DOI] [PubMed] [Google Scholar]
  38. Wu M, Semba S, Oue N, Ikehara N, Yasui W, Yokozaki H (2004) BRAF/K-ras mutation, microsatellite instability, and promoter hypermethylation of hMLH1/MGMT in human gastric carcinomas. Gastric Cancer 7(4):246–253 [DOI] [PubMed] [Google Scholar]
  39. Yamamoto H, Itoh F, Nakamura H, Fukushima H, Sasaki S, Perucho M et al (2001) Genetic and clinical features of human pancreatic ductal adenocarcinomas with widespread microsatellite instability. Cancer Res 61(7):3139–3144 [PubMed] [Google Scholar]

Articles from Journal of Cancer Research and Clinical Oncology are provided here courtesy of Springer

RESOURCES